293012345
6789101112
13141516171819
20212223242526
272829303112

RSS

 Vladimir Putinin demonisointi
05.09.2014 18:54 | pelontorjunta

(Venäjän presidentti Putin voitonpäivänä Krimillä toukokuussa 2014)

Kokeneen Suomen idänpolitiikan asiantuntijan ja suurlähettilään, Heikki Talvitien, varoitus kesäkuulta 2014 kannattaisi jokaisen suomalaisen ymmärtää, koska Suomen liittyminen Natoon sisältää erittäin suuria ja kasvavia riskejä:

"Suuressa kriisissä me olisimme ensimmäinen kohde, sitä pitää välttää viimeiseen saakka. Miksi meidän pitäisi olla eteenpäin työnnetty tukikohta, joka pitää eliminoida?"

Tästä samassa vaarasta varoitteli Suomen EY (EU) -jäsenyyden armoton kritisoija tri Keijo Korhonen (entinen ulkoministeri ja YK-suurlähettiläs) jo heti vuoden 1992 alussa käynnistyneen ja aika syvälle kansaa jakaneen integraatiokeskustelun aikana. Korhonen näki jo silloin EY-jäsenyyden ensimmäisenä askeleena siinä kehityksessä jossa hänen mielestään Suomesta tehdään lännen eteen työnnetty tukikohta juuri jälleensyntynyttä uutta Venäjän valtiota vastaan. Korhosen teesit tyrmättiin silloin naurettavina (eihän Suomi ollut eikä kuulemma tulisikaan olemaan Naton jäsenmaa). Mutta Korhosen kuten eräiden muidenkin mielestä EY-jäsenyys ei tulisi jäämään viimeiseksi länsi-integraation osoitukseksi. Historia osoitti että näin myös  kävi. Nyt on Suomen osalta alkamassa se lopullinen vaihe. Maata jolla on yli 1300 kilometriä yhteistä rajaa Venäjän kanssa, ollaan tunkemassa vimmatusti Naton jäseneksi.

Putin läntisen median kuvaamana

Venäjän presidentti Vladimir Putinin räikeä demonisointi ei eroa oleellisesti ensimmäisessä maailmansodassa nähdystä Saksan keisarin tai toisessa maailmansodassa nähdystä Hitlerin taikka Stalinin demonisoinnista.  Vastaavan informaatiosodan demonisoinnin kohteeksi ovat joutuneet lännen valtaliiton muutkin vastustajat 2000-luvulla, kuten Saddam Hussein, Bashar al-Assad, Muammar Gaddafi tai Osama bin Laden. Näin vaikutetaan massojen reaktioihin, jotta haluttu ratkaisu ongelmaan voidaan toteuttaa: Ongelma–Reaktio–Ratkaisu.

Suomessa lännen eliitin omistama ja sen intressejä (NATO-tavoitetta) palveleva propagandakone – hallintoneuvostojen johtamat valtamediat – ovat olleet jo jonkin aikaa yksituumaisesti Venäjää vastaan. Kaikki soraäänet on leimattu ja hiljennetty nopeasti. Tunnetut russofobit ovat Suomessakin julkisuuden valokeilassa.

Informaatiosotaa on käyty jo vuosia mutta nykyisellään se käynnistettiin Venäjän parlamenttivaaleissa 2011 ja sitä voimistettiin edelleen presidentinvaaleissa. Välissä propagandan liekkiä on kohennettu milloin homokysymyksillä, Pussy Rioteilla, Sini Saareloilla, olympia-korruptioilla ja millä tahansa väitteillä, jotka ovat palvelleet Venäjän ja varsinkin sen valtiojohdon demonisointia. Putinia kannattaa yli 80 % venäläisistä, mutta syitä hänen varsin korkeaan ja melkoiselta osiin myös aika todentuntuiseen aitoon kannatukseen ei ole meidän mediassamme pohdittu.

Samaan aikaan Venäjän turvallisuuspalvelu FSB on torjunut tiukasti maataan vastaan lietsottuja värivallankumous-yrityksiä. Ulkomailta käsin rahoitettujen kansalaisjärjestöjen (NGO) toiminnan rajoittaminen vuonna 2012 tuotti nopeasti tuloksia ja mm. USAID:n vetäytyminen esti poliittista epävakautusta onnistumasta. Tämä epäonnistuminen sai lännen eliitin sotilaallisille takajaloilleen Venäjää vastaan.  

Valtioterroria, provokaatioita, väitöksiä, syyllistämistä, vaikenemista ja loputtomasti Venäjän-vastaista propagandaa. Näin voidaan tiivistää liekkiinsä lietsottu informaatiosota samalla kun Yhdysvaltain korkein sotilasjohto kertoo suunnittelevansa sotilaallisia toimia Venäjää vastaan. Käynnissä on näin ollen erittäin vaarallinen trendiä, jonka toimet ovat olleet kaukana kylmästä sodasta – kaikki viittaa sotilaallisen konfiktin käynnistämiseen, joka palvelee lännen (=USA:n) taloudellisia ja sotilaallisia hegemoniatavoitteita.  

USA:n ja NATO:n sotilaallinen invaasio Venäjää vastaan

Yhdysvaltain asevoimien komentaja kenraali Martin Dempsey kertoi 26.7. 2014 Pentagonin harkitsevan sotilaallisia vastauksia "Venäjän toimiin Ukrainassa". Hän kertoi suunnittelupöydälle nousseen sotilaallisia toimia, joita ei ole pidetty operaatiosuunnittelussa 20 vuoteen, koskien mm. tietoliikennettä ja meriyhteyksiä.

Kenraali Dempsey syytti Pentagonin sotaisista suunnitelmista Putinia ja väitti hänen tavoittelevan "Neuvostoliiton mahtia". Dempsey syytti Putinia siitä, että hän eskaloisi tapahtumia ja lietsoisi nationalismia, joka saattaa levitä koko Eurooppaan. Kenraali kertoi lännen sotaisista suunnitelmista globalistien Aspen Instituutissa.

Dempseyn sanoja ovat säestäneet todisteettomat USA:n valtionhallinnon syytökset ja väitökset kohti Venäjää mm. "vastuusta lennon MH17 alasampumisessa" ja "Venäjän tykistöiskuista kohti Ukrainaa" tai "raskaiden asejärjestelmien toimittamisesta Donetskin ja Luhanskin aluejoukoille". Millekään näistä länsimedian päivittäin toistamista syytöksistä ei ole esitetty todistemateriaalia ja kaikki mitä julkisuuteen on esitetty, on viitannut juuri päinvastaiseen todellisuuteen.

Käynnissä onkin lännen toimesta psykologisen sodankäynnin varsinaisia sotatoimia edeltävä aggression vaihe: sotapropaganda.

Lännen sotakoneen agressiiviset suunnitelmat vahvisti 24.7. Yhdysvaltain Euroopan asevoimien komentaja ja lukuisia Venäjän-vastaisia väitteitä pitkin kevättä ja kesää viljellyt kenraali Philip Breedlove. Hänen mukaansa nyt olisi aika varastoida Puolaan tarpeeksi aseita, ammuksia ja muuta varustusta, jotta suuret asevoimat voidaan keskittää Venäjää vastaan. Suuret sotavalmistelut ovat nousemassa pöydälle syyskuussa järjestettävässä NATO-kokouksessa.

USA:n suunnitelmissa on keskittää suuret sotavoimat useisiin Puolan tukikohtiin ja päätukikohdaksi suunnitellaan Stettinin alueella sijaitsevaa monikansallisten joukkojen tukikohtaa – NATO:n operaatioesikuntaa ja voimakeskittymää.  Kyse on siis eräänlaisesta uudesta "Sudenpesästä", jollainen perustettiin Puolaan Saksan toimesta operaatio Barbarossaa varten 1941.

NATO on aloittanut Itämeren ja Mustanmeren laivastokeskitykset sekä vahvistanut pitkin kevättä ja kesää 2014 Itä-Euroopan ilmavoimiaan. Tiedustelua on lisätty ja AWACS-koneet lentävät jo Venäjän rajoilla. Myös sotilasyksiköiden keskitykset Baltiaan ja Puolaan on aloitettu ja sotajoukkojen harjoitusohjelmia on jatkuvasti lisätty.

Näin toimitaan ennen sotilaallista hyökkäystä ja Venäjän kenraalit luonnollisesti alkavat samalla valmistautua lännen salamahyökkäysten torjuntaan.

Tämä tarkoittaisikin käytännössä kolmatta maailmansotaa, koska lännen valtaliiton hyökkäys Venäjälle olisi hyökkäys CSTO-sotilasliittoa vastaan, joka aktivoisi myös SCO- ja BRICS-liittolaisten vastatoimet. Ottaen huomioon nykyisen maailman turvallisuuspoliittisen rakenteen, samalla sekunnilla kun/jos länsijoukot avaavat tulen venäläisiä vastaan ainakin 60 maata on heti mukana tuhoisassa maailmansodassa.

Silloin ratkaisevat geopoliittiset välttämättömyydet, kuten suurlähettiläs Talvitie osuvasti varoitti. Suomen asema Itämeren ja Murmanskin laivaston läheisyydessä sekä Pietarin naapurissa antaa vahvan ja kolminkertaisen syyn Venäjän kenraaleille suorittaa tarvittaessa välitön Suomen uhan eliminointi kansallisessa vaaratilanteessa. Se tarkoittaa voimakkaita ennaltaehkäiseviä iskuja.

Tämä on huolestuttava tosiasia, mutta ymmärrettävä, jos menemme Venäjän saappaisiin ja huomioimme sen elintärkeät intressit ja sen strategiset lainalaisuudet. Ja juuri siksi Suomi ei saa missään tilanteessa muodostaa uhkaa sotilaallisesti ylivoimaiselle Venäjälle, jonka se tekisi mm. sotilasliitto NATO:n jäsenmaana tai länsijoukkojen kauttakulkumaana. Mikään salainen NATO-sopimus ei ole nyt turvaksi vaan uhkaksi.

Kun media luopui henkisestä puolueettomuudesta


 

Sampo Ahto:

"Pienen maan kansalaisena olen luonnollisesti varpaillani suuren naapurin vierellä, oli se sitten kuka tahansa. Mutta Yhdysvallat on varsinaisesti se, jota pelkään. Maa on tosin tuhansien kilometrien päässä, mutta maailmanlaajuisine pyrkimyksineen sen kohtaa yleensä kaikkialta, missä on levotonta. Maailman kypsyttämiselle demokratiaan ei näy loppua. "

 

Parhaan suojan oikeassakin sodassa tarjoaisi meille suomalaisille tietenkin se, että onnistuisimme pysyttelemän riitapukareista erossa. Mutta sama pätee myös nyt käynnissä olevaan propagandasotaan. Mahdollisimman tasapuolinen tiedonvälitys olisi perusedellytys sille, että viileän harkintakykyisesti osaisimme välttää propagandakranaattien iskemiä. Tällaiseen tiedonvälitykseen valtamediamme ei valitettavasti kykene eikä kai halua sellaista yrittääkään. Kun johtavat poliitikkomme jo aikapäiviä sitten ovat julistaneet luopuneensa henkisestä puolueettomuudesta niin sanotun läntisen arvoyhteisön hyväksi, media on ollut samalla linjalla. Seuraukset näkyvät. Meille jaettava tieto on etupäässä sen näkemyksen välittämistä, mikä on vallalla ”lännessä”. Siitä suunnasta tulevat kranaatit siis lähinnä osuvat meihin. Neutraalin tiedonvälityksen antama suoja puuttuu päämme päältä. Toki tietoja voisi hankkia itsekin, mutta siihen tarvitaan aikaa, kielitaitoa ja kokemusta.

Hyväksi osoittautunut keino propagandassa on sitten antiikin päivien ollut vastustajien johtajien demonisointi ja arvostelun keskittäminen heihin. Tuoreimmalta ajalta ovat varmaan muistissa vielä tapaukset Saddam Hussein tai Gaddafi, joihin keskitettiin sanallisen sodan todellinen rumputuli. Tulos oli erinomainen, ja harva kai vieläkään kykenee näkemään kyseisissä herroissa mitään myönteistä. Sen sijaan vaikkapa Brunein sulttaanista emme tiedä juuri mitään, vaikka hänen käskystään Bruneissa vastikään otettiin rangaistuksina käyttöön kivittäminen kuoliaaksi ja jäsenten katkominen. Miksi puhua pahaa miehestä, jolla on myötämieltä ja öljyä lännelle?

Ukrainan kriisissä päädemoniksi on otettu Vladimir Putin. Meilläkin on kyselty, kuka pysäyttäisi Putinin, ja vähintäänkin rivien välissä on vihjailtu, että miehellä saattaa olla pahoja suunnitelmia myös Suomen suhteen. Muualla on käytetty vielä rajumpaa kieltä, mistä meillä ei ole kehdattu edes puhua. Voisi kai muuten herätä epäilys, etteivät Ukrainan ”demokraatitkaan” taida olla pelkkiä pulmusia. Niinpä enkelinkasvoinen Julia Tymošenko sanoi Putinin suunnittelevan hyökkäystä länteen ja Länsi-Euroopan hävittämistä. Rouva ilmoitti haluavansa henkilökohtaisesti ampua luodin Putinin päähän ja toivoi lännen käyttävän ydinasetta Venäjää vastaan. Tietysti hän luonnehti Putinia myös fasistiksi. Mussolinin opeilla tuntuukin menevän nykyään hyvin, sillä fasisteja ovat kuulemma myös Tymošenko itse ja hänen leirinsä, jos Moskovan vastapropagandaa olisi uskominen.

Mitä Ukrainassa todella tapahtui ja tapahtuu?

Yksityiskohtiin menemättä suuri yleistilanne idässä on seuraava: Neuvostoliiton luhistumista
seurasi venäläisjoukkojen vetäytyminen itään suurin piirtein vuoden 1918 Brest-Litovskin rauhan rajalle. Venäläisten lähtöä edesauttoi tietenkin se, että enemmistö luovutettujen alueiden väestöstä sydämestään toivoi sitä.

Sitä seurasi Yhdysvaltojen tulo perässä. Varsovan liiton lakkauttaminen ei tuonut tullessaan Naton lakkauttamista, vaan vastoin annettuja lupauksia läntisen sotilasliiton itäraja oli kohta runsaan sadan kilometrin päässä Pietarista. Moskovan näkökulmasta katsoen Yhdysvallat saartoi Venäjää yhtä perusteellisemmin, ja erilaisia värillisiksi tai kukkaisvallankumouksiksi kutsuttu ja vallansiirtoja tukemalla Washington pyrki entisellä innollaan tekemään maailmaa ”kypsäksi demokratialle”. Tämä tarkoittaa Yhdysvaltoja hallitsevan pienen piirin maailmanherruutta.

Tapahtumat Ukrainassa saivat lopulta Putinin käymään vastahyökkäykseen. Korruptoitunut ja kansallisesti jakautunut maa ei ole historiallisista ja strategisista syistä Venäjälle ja venäläisille mikä tahansa paikka, mutta nyt sekin oli liukumassa lännen tukemien vallankaappaajien avulla vastapuolen leiriin. Jotain Putinin oli pakko tehdä, kun vaihtoehtona häämötti katastrofi, joka venäläisten silmissä olisi ollut vailla vertaa.

Nopea vastaisku Krimillä onnistui hyvin, ja tällä kertaa olivat venäläiset niitä, joiden puolella asukkaiden enemmistö oli. Aikoinaanhan kansallisen itsemääräämisoikeuden periaate oli julistettu pyhäksi periaatteeksi, vaikka todellisuudessa siitä ei ole koskaan suuremmin välitetty. Nyt siitä välittivät vain venäläiset, koska se sopi heille. Läntisessä arvoyhteisössä siitä ei nyt puhuttu mitään, mutta eihän asia tunnu muutenkaan kuuluvan esimerkiksi Euroopan unionin asialistalle. Toukuussa 2014 tilanne oli käynyt yhä hallitsemattomammaksi. Venäläiset ja toiselta puolen amerikkalaiset vasalleineen tekivät tietenkin kulissien takana kaiken mahdollisen omaa asiaansa edistääkseen, mutta kiihtyneet ja kiihdytetyt ukrainalaiset eivät olleet niin vain hillittävissä.

Ukrainan sodan jälkimmäinen vaihe muodostui vieläkin brutaalimmaksi alkaen Kiovan uusliberaalisten ja uusfasistisen hallinnon sotilaallisella hyökkäyksellä Ukrainan itäosan venäläiskielistä ja venäläismielistä osaa vastaan. Tuloksena mittava humanitäärinen katastrofi. Sotilaallisesti Kiovan joukkojen hyökkäys päättyi tappioon kapinallisten venäläismielisten paremmin motivoituneiden joukkojen lyötyä hyökkääjä ja aiheuttaen niille monin paikoin kovat tappiot. Elokuun lopulla 2014 oli eräillä rintamaosuuksilla Kiovan joukkojen taistelumoraali romahtanut ja karkuruus valtavaa. Samaan aikaan hallitus Kiovassa hajosi ja Ukrainan talous näyttää olevan romahdustilassa. Uudet vaalit on määrä käydä lokakuussa tilanteessa jossa merkittävä osa maata ei edes tule osallistumaan koko vaaleihin. Kiovassa kamppailu on siirtynyt uusliberaalien ja uusfasistien väliseksi.

Pandoran lippaasta ulos päästetyt henget eivät tunnetusti mene helpolla takaisin lippaaseensa. Helsingin Sanomain pääkirjoituksessa 3. toukokuuta saatiin sitten lukea jotain sellaista kuten :

”Venäjän valtiollinen televisio ei edes pyri totuudellisuuteen. Televisiota hallitsevat propaganda, leimaaminen, hysterian lietsominen ja uhkakuvien rakentelu.”

Joiltakin osin Helsingin Sanomat saattoi olla jopa oikeassa. Mutta samaa se harrastaa itsekin, tosin vastakkaisessa hengessä. Puhumattakaan lännen propagandakoneistosta. Kotoinen media näyttää Ukrainan sodassa ottaneet aika kritiikittömän kannan Kiovan hallituksen ja Washingtonin ”tiedonvälitykseen” myöhemminkin.

”Tää on viimeinen taisto”

Johdattelevissa kyselyissä on suomalaisilta viime aikoina kyselty useamman kerran, pelätäänkö täällä Venäjää. Pienen maan kansalaisina saamme luonnollisesti olla varpaillamme suuren naapurin vierellä, oli se sitten kuka tahansa. Mutta Yhdysvallat on varsinaisesti se, jota on tällä hetkellä syytä eniten pelätä. Tällainen tulos saatiin myös viime vuonna tehdystä kansainvälisestä tutkimuksesta jonka mukaan maailman väestöstä eniten oli niitä joiden mielestä USA on suurin uhka maailman rauhalle.  USA on tosin tuhansien kilometrien päässä, mutta maailmanlaajuisine pyrkimyksineen sen kohtaa yleensä kaikkialta, missä on levotonta. Maailman kypsyttämiselle demokratiaan pommeilla, lennokeilla ja risteilyohjuksilla ei näy loppua. Tuloksena tästä on ollut useimmiten vain katastrofeja kuten esim. Irakissa äärimmäisen väkivaltaisen ISIS:n nousu osoittaa.

Tietämättömillä tämä USA:n politiikan sekopäisyys on käsittämätöntä. Mutta tämän kaiken voi käsittää paremmin jos miettii asiaa Washingtonin uuskonservatiivisesta perspektiivistä. Amerikkalaisten ulkopoliittisten oppien ytimessä on lähes messiaaninen oppi jonka mukaan maailmasta on tehtävä Amerikan mukainen kuva. On työnnettävä vaikka kurkusta alas oppi ”vapaudesta ja demokratiasta”. Itse USA:ssa demokratialla ei nykyisin mene oikein hyvin. Maan poliittinen elämä koostuu kahdesta valtavilla lobbareiden rahoilla rahoitetusta suuresta puolueesta joiden eteenkin ulkopoliittinen linja ei eroa sanottavimmin toisistaan ellei sitten oleta demokraatti-puolueen olevan ulkopolitiikassa jopa republikaaneja hysteerisemmän ja epätasapainoisemman. Ei ihme että entisen Neuvostoliiton johto näki jopa republikaanipresidentit aavistuksen verran enemmän vakautta tuovina kuin demokraatit joskin Bushin uuskonservatiivisina vuosina tämä näkemys taisi kuolla.

Ehkäpä suurin motiivi amerikkalaisten aggressiivisuuteen johtuu siitä että maan ulkopoliittinen eliitti vaistoaa imperiumin voimien olevan hiipumassa. Maa on korviaan myöten veloissa eikä pysty  nykymenolla maksamaan itse luomaansa globaalia hegemoniaa. Siksi USA:n eliitti taistelee nyt viimeisellä rannalla etupäässä juuri dollarin puolesta jotta se pysyisi johtavana maailmanlaajuisena valuuttana, sellaisena jolla tärkeimmät tuotteet ja raaka-aineet hinnoitellaan. Näin USA maksattaa imperiuminsa sota- ja muut toilailut myös muilla mailla. Samaan aikaan Kiinasta on kehittymässä maailman suurin talous, valtavan ydinasearsenaalin omaavan Venäjän raaka-aine resurssit ovat maailman suurimmat, Intian merkitys kasvaa ja nämä kolme paikallista ydinasemahtia ovat tiivistäneet yhteistyötään Etelä-Amerikan suurvallan Brasilian kanssa ja ovat yhdistäneet tässä verkostoitumisessaan talouskasvuun päässeen Afrikan yhteistyöhön. On syntynyt USA:n globaalin hegemonian kanssa kilpaileva ja vahvistuva uusi voimatekijä nimeltään BRIC (tai BRICS jos siihen lasketaan mukaan myös Etelä-Afrikka). Se käsittää noin 42% maapallon väestöstä ja yhdessä Afrikan kanssa yli 58%.


Vladimir Putin – mies jota ei hämätä

Neuvostoliiton hajoaminen vuonna 1991 johti tilanteeseen jossa imperiumin ydinalue Venäjä joutui lähes kymmeneksi vuodeksi alennustilaan lännen myötämielisen, mutta heikon Boris Jeltsinin aikana. 1990-luku merkitsi ns. ryöstökapitalistien, oligarkien kulta-aikaa. Venäjä vajosi vuosiksi taloudelliseen, sosiaaliseen ja henkiseen alennustilaan. Taloudessa kokeiltiin lännen suosittelemia oppeja ”vapaasta markkinataloudesta” tuhoisin seurauksin.

KGB:n palveluksessa olleen Vladimir Putinin nousu Venäjän presidentiksi 1990-luvun lopussa merkitse käännettä. Putinin toiminta on tähdännyt yhteen tärkeään tavoitteeseen: isänmaan alennustilan päättymiseen sekä turvaamaan Venäjän rajat USA:n johtaman imperiumin tunkeutumista vastaan. Putinilla oli täysi syy nähdä länsi petollisena olihan lännen johtajat luvanneet että Neuvostoliiton lakkauttaminen ei johtaisi Naton laajentumiseen Saksan itäosia lukuunottamatta muualle Itä-Eurooppaan eikä entisiin neuvostotasavaltoihin. Länsi petti Venäjälle annetut lupaukset. Tätä Putin, tiedustelu- ja turvallisuuskoulutuksen saanut patriootti ei tule koskaan unohtamaan.

Venäjän uusi hallitsija on samalla kertaa paitsi pragmaatikko, myös erittäin terävä, analyyttinen, tuntee historian, geopolitiikan sekä sotilaalliset tosiasiat paremmin kuin hänen lopulta aika keskinkertaiset läntiset vastapelurinsa. Ja koska Putinilla on saatavilla Venäjän tunnetusti kovatasoisen tiedustelun ratkaisevan tärkeää materiaalia milloin tahansa tietää hän myös vastapuolensa heikkoudet. Mm. sen millainen paperitiikeri Nato tosiasiassa on. Vastoin yleistä luuloa 2010-luvun Natosta ei ole konventionaalisen sodan käynnin osalta vastusta Venäjälle koska USA:n sotilaallinen voima on sidottu etupäässä Aasiaan ja Lähi-Itään. Ongelmana Natolle on sen mitättömät maavoimien reservit. Euroopan Nato-armeijat ovat kuin pöytälaatikkoyrityksiä joiden uskottavuus varsinkin pitkäkestoista sotaa varten on olematon. Putinilla on myös kädessään pahimman kriisin osalta pelote jonka luulisi laittavan ainakin Euroopan Nato-maat miettimään kahdesti esim. Ukrainaan tunkeutumista: Venäjän tuhannet strategiset ydinaseet.

Myös informaatiosodankäyntiin on Venäjän vahva mies kiinnittänyt huomiota. Hän hallitsee sosiaalisen median, hänellä on tv-uutiskanavat käytössä myös englanninkieliselle maailmalle (kuten RT). Ne ovat kiinnostavalla tavalla paljastaneet täysin oikeutetusti länsimaiden mediapelin, valheet, puolitotuudet ja yleisen mielipiteen manipuloinnin Ukrainan sodassa. Tämä Venäjää lähellä oleva uusi media on pystynyt osoittamaan Kiovan hallituksen joukkojen brutaalit toimet mm. Itä-Ukrainan siviiliväestöä vastaan. Nämä täysin autenttiset ja suurelta osin uskottavat kuvat ja videot ovat vetämässä läntisen valtamedian väitteiltä maton pois alta. Itä-Ukrainaan hyökkää joukkoja joka alkaa pelottavasti muistuttaa Natsi-Saksan väkivaltakoneistoa menetelmineen. Tämäkö on siis se arvoyhteisö jota Nato-maat tukevat. Samoin Kiovan helmikuun 2014 väkivaltaisuudet voitiin myöhemmin osoittaa tapahtuneen ukrainalaisten kansallismielisten äärioikeistolaisten ääriainesten toimesta. Länsi syytti sitä ennen tästä Ukrainan entistä ”vallankumouksella” syrjäytettyä hallintoa. Todellisuuden paljastuttua on lännen media ollut ampumistapauksista hiljaa.

Wikileaks-paljastukset jossa CIA rahoitti Kiovan helmikuun 2014 ”vallankumouksen” ja jossa USA:n ulkopoliittisen johdon on täytynyt tietää millaista joukkoa tähän uuteen Kiovan hallintoon kuului (uusliberalistien lisäksi runsaasti äärioikeistolaisia, uusfasistisia ja natsimielisiä aseellisia ryhmiä). On ilman muuta selvää että Putinin tiedustelukoneisto pystyy aukaisemaan paljon salattua materiaalia joka jättää USA:n ulkopoliittisen johdon maalitauluun. Tämä ei ole edes vaikeaa. USA:n suvereeni hegemonia ennen Putinin kautta teki siitä ylimielisen ja nyt se kostautuu.

Verkko USA:n ympärillä kiristyy

Kukaan ei varmuudella voi tietää mitä Vladimir Putin todella ajattelee ja miten hän aikoo jatkossa toimia. Yksi asia on varma. Hän ei tule koskaan alistumaan miksikään lännen sätkynukeksi ja sylikoiraksi. Putin on patriootti viimeistä päälle ja päättänyt palauttaa Venäjän kunnian. On jokseenkin selvä että Ukrainassa (ja Valko-Venäjässä) on jo raja jonka yli läntistä imperiumia ei tulla päästämään.

Koska Putin on tiedustelu- ja turvallisuuspalvelun mies voimme spekuloida mitä hänellä on takataskussaan. Vihollista ei tarvitse lyödä taistelukentällä mutta sitä voidaan kuluttaa, ahdistaa, väsyttää ja lopulta demoralisoida monin tavoin. Tällä hetkellä Ukraina ei ole USA:n ainoa päänsärky. Jos USA kuvitteli Al Qaedan olleen painajaisista pahin, se erehtyi. Todellinen vertaansa vailla oleva painajainen nousi Lähi-Idässä kesällä 2014 ja sitä kutsutaan nimellä ISIS. Jatkuvaan sotaan kyllästynyt USA:n kotirintama ja presidenttinä melko totaalisesti epäonnistunut Barack Obama joutuvat nyt tilanteeseen jossa USA:n olisi lähdettävä Irakiin ja Syyriaan metsästämään ISIS-järjestön taistelijoita. Karmeampaa tilannetta Obamalle ei olisi luvassa. Samaan aikaan Syyriassa lännen vastustama Al Assadin hallinto (jota Venäjä tukee) näyttää kääntäneen sodan edukseen.

Putinin tapainen viileän analyyttinen ja illuusioista pois kuorittu mies näkee mahdollisuuksia heikentää USA:ta monin tavoin monissa maailman polttopisteessä. Hän tuntee riskit mutta näkee myös mahdollisuudet eikä epäröi käyttää hyväkseen niitä heikentääkseen niitä voimia jotka ovat saartamassa Venäjää. Kuten sodassa pitkälle edennyt armeija on erittäin haavoittuvainen huollon suhteen ja riskissä uupua, niin on myös USA:n globaalin imperiumin osalta. Mitä pitemmälle se on tunkeutunut sitä enemmän se näyttää keräävän vihamiehiä ympärilleen. Ja mitä kovaotteisemmin USA demokratisoi maailmaan sitä rajummaksi kasvaa vastarinta. ISIS edustaa uutta vaihetta taistelussa. Jos USA aikoo sen kukistaa mitä se saa vastaansa kymmenen vuoden kuluttua?

Verkko väsymisen merkkejä osoittavan USA:n ympärillä alkaa kiristyä ja Vladimir Putin tietää sen oikein hyvin. Georgiassa 2008 alkanut menestyksellinen torjuntataistelu USA:n tunkeutumista vastaan jatkuu. Putininin motivaatiot eivät liity ”valloituksiin” sinänsä vaan tietyn suojavyöhykkeen rakentaminen Venäjän lähelle. On täysin selvä asia että niin Ukraina kuin Suomikin eivät missään tapauksessa saa joutua tässä skenaariossa lännen etuvartioasemiksi. Vain sokea ja hullu ei ota tällaisia asioita huomioon.

 


( Päivitetty: 05.09.2014 19:15 )

 - pelontorjunta | Kommentit (3)Kommentoi



 Chimamanda Adichie: ”Yhden Tarinan” Vaarallisuus
01.06.2014 17:58 | pelontorjunta

  Chimamanda Adichie (oik) puhumassa kesällä 2009 Oxfordissa, Englannissa siitä kuinka yhden kertomukseen varaan rakentuva käsitys muodostaa vaaran.

 

Olen kertomusten kirjoittaja ja haluaisin kertoa teille muutaman henkilökohtaisen kertomuksen siitä, mitä kutsun ”yhden tarinan vaaraksi”.

Kasvoin yliopistokampuksella itäisessä Nigeriassa. Äitini sanoo, että aloin lukea kaksivuotiaana, mutta luulen, että neljä on lähempänä totuutta. Luin brittiläisiä ja amerikkalaisia lastenkirjoja. Olin myös aikainen kirjoittaja. Kun aloitin noin seitsemänvuotiaana kirjoittamaan lyijykynällä väriliitupiirrustuksilla kuvitettuja tarinoita, joita äitiparkani joutui lukemaan.

Kirjoitin juuri sellaisia tarinoita, joita luin. Kaikki hahmoni olivat valkoisia ja sinisilmäisiä. He leikkivät lumessa. He söivät omenoita. Ja he puhuivat paljon säästä, kuinka ihanaa oli, että aurinko alkoi paistaa. Tämä siitä huolimatta, että asuin Nigeriassa. En ollut koskaan käynyt Nigerian ulkopuolella. Meillä ei ollut lunta. Söimme mangoja. Emmekä koskaan puhuneet säästä, koska sille ei ollut tarvetta.

Hahmoni myös joivat paljon inkivääriolutta, koska hahmot brittikirjoissa, joita luin, joivat inkivääriolutta. Huolimatta siitä, ettei minulla ollut tietoa, mitä se oli. Ja vuosien ajan minulla olisi epätoivoinen halu maistaa inkivääriolutta. Mutta se on toinen tarina.

Mielestäni tämä osoittaa, miten vaikutuksille alttiita ja herkkiä me olemme tarinan edessä, varsinkin lapsena. Olin lukenut vain kirjoja, joissa oli ulkomaalaisia, ja olin vakuuttunut, että kirjoissa luonnostaan piti olla ulkomaalaisia ja niiden piti kertoa asioista, joihin en voinut samaistua.

Asia muuttui, kun löysin afrikkalaiset kirjat. Niitä ei ollut paljon saatavilla. Eikä niitä ollut niin helppo löytää kuin ulkomaalaisia kirjoja. Kirjailijoiden kuten Chinua Achebe ja Camara Laye ansiosta käsitykseni kirjallisuudesta muuttui. Tajusin, että kaltaiseni ihmiset – tytöt, joiden iho on suklaan värinen, ja joiden käkkärä tukka ei mennyt poninhännille – voivat myös elää kirjallisuudessa.

Aloin kirjoittaa asioista, joita havaitsin. Rakastin lukemiani amerikkalaisia ja brittiläisiä kirjoja. Ne lietsoivat mielikuvitustani. Ne avasivat minulle uusia maailmoja. Mutta tahaton seuraus oli, että en tiennyt itseni kaltaisten ihmisten voivan olla olemassa kirjallisuudessa. Afrikkalaisten kirjailijoidne löytäminen teki tämän: Se pelasti minut ”yhdeltä tarinalta” siitä, mitä kirjat ovat.

Tulen sovinnaisesta, keskiluokkaisesta nigerialaisesta perheestä. Isäni oli professori. Äitini toimi hallinnossa. Joten meillä, kuten oli tapana, oli kotiapulaisia, jotka usein tulivat läheisistä maalaiskylistä. Kun täytin kahdeksan vuotta saimme uuden apuripojan. Hänen nimensä oli Fide. Äitini kertoi hänestä ainoastaan, että hänen perheensä oli hyvin köyhä. Äitini lähetti jamssia ja riisiä, ja vanhoja vaatteitamme hänen perheelleen. Kun en syönyt loppuun ateriaani, äitini sanoi:

”Syö loppuun! Etkö tiedä? Fiden perheen kaltaisilla ihmisillä ei ole mitään.”

Joten tunsin käsittämätöntä sääliä Fiden perhettä kohtaan.

Yhtenä lauantaina menimme käymään hänen kyläänsä. Hänen äitinsä näytti kauniisti värjätystä raffianiinistä tehdyn koristellun korin, jonka hänen veljensä oli tehnyt. Hätkähdin. Mieleeni ei ollut tullut, että kukaan hänen perheessään voisi itse asiassa tehdä jotain. Olin vain kuullut heidän olevan köyhiä, joten minun oli mahdotonta nähdä heidät muuta kuin köyhinä. Heidän köyhyytensä oli minun yksi tarinani heistä.

Vuosia myöhemmin mietin tätä, kun lähdin Nigeriasta yliopistoon Yhdysvaltoihin. Olin 19-vuotias. Amerikkalainen huonetoverini järkyttyi minusta. Hän kysyi, missä olin oppinut puhumaan englantia niin hyvin, ja hämmästyi kun kerroin että Nigeriassa englanti on virallinen kieli. Hän kysyi voisiko kuunnella ”heimomusiikkiani”, kuten hän sitä kutsui, ja oli siksi hyvin pettynyt, kun otin esille Mariah Carreyn kasetin. Hän oletti, etten tiennyt, miten käyttää hellaa. Minuun iski tieto: Hän sääli minua jo ennen kuin tapasi minut. Hänen lähtökohtansa minua, afrikkalaista, kohtaan oli holhoava, hyvää tarkoittava sääli. Huonetoverillani oli vain yksi tarina Afrikasta. Tarina katastofista. Tässä tarinassa ei ollut mahdollista afrikkalaisten olla samanlaisia kuin hän millään tavalla. Ei mahdollisuutta monimutkaisemmille tunteille kuin sääli. Ei mahdollisuutta yhteyteen tasavertaisina ihmisinä.

On sanottava, että ennen kuin menin Yhdysvaltoihin, en tietoisesti hahmottanut itseäni afrikkalaisena. Mutta Yhdysvalloissa kaikki kääntyivät puoleeni Afrikka-asioissa. Huolimatta siitä, etten tiennyt mitään paikoista kuten Namibia. Mutta omaksuin tämän uuden identiteetin. Monin tavoin ajattelen itseäni nykyään afrikkalaisena. Vaikka onkin aika ärsyttävää, kun Afrikkaan viitataan maana. Tuorein esimerkki tuli muuten ihanalla lennollani Lagosista kaksi päivää sitten, kun he ilmoittivat Virginian lennolla hyväntekeväisyystyöstä, ”Intiassa, Afrikassa ja muissa maissa”.

Vietettyäni muutaman vuoden Yhdysvalloissa afrikkalaisena aloin ymmärtää huonetoverini reaktiota minuun. Jos en olisi kasvanut Nigeriassa ja tietäisin Afrikasta vain uutisoinnin kautta, minäkin ajattelisin Afrikkaa paikkana, jossa on kauniita maisemia, kauniita eläimiä, ja vaikeaselkoisia ihmisiä, jotka taistelevat typeriä sotia, kuolevat köyhyyteen ja AIDSiin, ovat kykenemättömiä puhumaan puolestaan, ja odottavat pelastusta kiltiltä valkoiselta ulkomaalaiselta. Näkisin afrikkalaiset samoin kuin olin lapsena nähnyt Fiden perheen.

Tämä yksi tarina Afrikasta tulee uskoakseni länsimaisesta kirjallisuudesta. Tässä lainaus John Locke – nimisen lontoolaisen kauppiaan kirjoituksesta. Hän purjehti Länsi-Afrikkaan vuonna 1561 ja piti kiehtovaa päiväkirjaa matkastaan. Viitattuaan mustiin afrikkalaisiin ”petoina, joilla ei ole taloja”, hän kirjoittaa:

”He ovat myös päättömiä ihmisiä, joiden suu ja silmät ovat heidän rinnassaan”.

Olen nauranut joka kerta, kun luen tämän. Täytyy ihailla John Locken mielikuvitusta. Tässä kirjoituksessa tärkeää on se, että se edustaa afrikkalaisten tarinoiden kerrontatavan alkua lännessä. Traditiota, jossa Saharan eteläpuolinen Afrikka on negatiivisessa valossa, erilainen, tumma, ja ihmiset ovat, ihanan runoilijan Rudyard Kiplingin sanoin ”puoleksi piruja, puoliksi lapsia”.

Joten aloin ymmärtää, että amerikkalaisen huonetoverini on täytynyt läpi elämänsä nähdä ja kuulla eri versioita tästä yhdestä tarinasta. Kuten oli professorini joka kerran kertoi minulle, ettei romanini ollut ”autenttisen afrikkalainen”. Olin taipuvainen myöntämään, että romaanissani oli useita puutteita, että se oli epäonnistunut useissa kohdin. Mutta en ollut kuvitellut, että se oli epäonnistunut saavuttamaan jonkin afrikkalaisen autenttisuuden. Itse asiassa, en tiennyt, mitä afrikkalainen autenttisuus oli. Professorini kertoi, että hahmoni olivat liian paljon hänen kaltaisiaan, koulutettu keskiluokkainen mies. Hahmoni ajoivat autoa. He eivät nähneet nälkää. Joten he eivät olleet autenttisia afrikkalaisia.

Minun täytyy myöntää, että olen itsekin yhtä syyllinen yhden tarinan kysymyksessä. Muutama vuosi sitten vierailin Meksikossa Yhdysvalloista. Poliittinen ilmapiiri Yhdysvalloissa oli silloin kireä. Maahanmuutosta keskusteltiin paljon. Ja kuten usein tapahtuu Amerikassa, maahanmuutosta tuli synonyymi meksikolaisille. Oli lukemattomia tarinoita meksikolaisista ihmisinä, jotka huijasivat terveydenhuoltojärjestelmää, yrittivät rajan salaa, joita pidätettiin rajalla, ja sen sellaista. Muistan kävelleeni ensimmäisenä päivänä Guadalajarassa katsellen töihin meneviä ihmisiä, käärimässä tortilloja torilla, tupakoimassa, nauramassa. Muistan ensimmäisenä olleeni hieman yllättynyt. Sitten mieleni valtasi häpeä. Tajusin, että olin niin uppoutunut median tarinoihin meksikolaisista, että heistä oli tullut mielessäni säälittäviä köyhiä maahanmuuttajia. Olin niellyt tarinan yhdenlaisista meksikolaisista, enkä olisi voinut olla enemmän häpeissäni. Niin luodaan yksi tarina, näytetään ihmiset yhtenä asiana, vain yhtenä asiana, uudelleen ja uudelleen, ja sellaisia heistä tulee.

On mahdotonta puhua yhdestä tarinasta puhumatta vallasta. On olemassa igbonkielinen sana, jota aina ajattelen ajatellessani valta-asemia maailmassa, ja se on ”nkali”. Se on substantiivi, joka kääntyy jotakuinkin ”olla suurempi kuin toinen”. Kuten talouselämämme ja poliittinen maailma, tarinat ovat liiaksi määriteltyjä nkalin perusteella. Miten ne kerrotaan, kuka ne kertoo, milloin ne kerrotaan, kuinka monta tarinaa kerrotaan, kaikki riippuu vallasta. Valta on kyky kertoa ei vain tarina toisesta henkilöstä mutta tehdä siitä henkilön määrittelevä tarina. Palestiinalainen runoilija Mourid Barghouti kirjoittaa, että jos haluaa riistää kansaa, helpoin tapa on kertoa heidän tarinansa (vain osaksi), aloittaen (kohdasta) ”toiseksi”. Aloita tarina alkuperäisten amerikkalaisten nuolista äläkä brittien saapumisesta, ja saata aivan eri tarinan. Aloita tarina afrikkalaisen valtion epäonnistumisesta äläkä siirtomaavaltojen ohjaamasta afrikkaisen valtion luomisesta, ja saat aivan erilaisen tarinan.

Puhuin vastikään yliopistossa, jossa opiskelija kertoi minulle, että on kovin sääli, että nigerialaiset miehet ovat hyväksikäyttäjiä, kuten isähahmo romaanissani. Kerroin hänelle, että olin juuri lukenut romaanin nimeltä ”Amerikan psyko” - ja oli niin sääli, että nuoret amerikkalaiset ovat sarjamurhaajia. Tietysti sanoin sen hieman ärsyyntyneenä. Ei olisi ikinä tullut mieleenikään, että vain luettuani romaanin, jossa hahmo on sarjamurhaaja, että hän olisi jotenkin tyypillinen edustaja kaikista amerikkalaisista. Ei siksi, että olisi parempi ihminen kuin tuo opiskelija, vaan koska Amerikan kulttuurisesta ja taloudellisesta mahdista johtuen, minulla oli useita tarinoita Amerikasta. Olin lukenut Tyleria, Updikea, Steinbeckia, ja Gaitskilliä. Minulla ei ollut vain yhtä tarinaa Amerikasta.

Kun opin muutama vuosi sitten, että kirjailijoilla odotetaan olevan hyvin onneton lapsuus, jotta he menestyisivät, aloin ajatella, miten voisin keksiä hirveitä asioita, mitä vanhempani ovat tehneet minulle. Mutta totuus on se, että minulla oli hyvin onnellinen lapsuus, täynnä naurua ja rakkautta, hyvin kiinteässä perheessä. Mutta minulla oli myös isoisiä, jotka kuolivat pakolaisleireillä. Serkkuni Polle kuoli, koska oli vailla riittävää terveydenhuoltoa. Yksi läheisimmistä ystävistäni, Okoloma, kuoli lentokoneonnettomuudessa, koska paloautoilla ei ollut vettä. Kasvoin sortavien sotilashallitusten aikana. Ne eivät arvostaneet koulutusta, joten joskus vanhempani eivät saaneet palkkaansa. Joten lapsena näin, kuinka hillo katosi aamiaispöydästä, sitten margariini katosi, sitten leipä oli liian kallista, sitten maitoa säännösteltiin. Ja ennen kaikkea, eräänlainen pysyvä poliittinen pelko valloitti elämämme.

Kaikki nämä tarinat tekivät minusta sen mitä olen. Mutta vain negatiivisten tarinoiden vaaliminen latistaa kokemukseni ja jättää huomiotta monet muut tarinat, jotka muokkasivat minua. Yksittäinen tarina luo stereotyyppejä. Stereotyyppien ongelma ei ole se, että ne eivät olisi tosia, vaan se että ne ovat epätäydellisiä. Ne tekevät yhdestä tarinasta ainoan tarinan. Toki Afrikka on katastrofien maanosa. On suunnattomia sellaisia, kuten järkyttävät raiskaukset Kongossa. Ja masentavia, kuten se tosiasia, että 5 000 ihmistä hakee yhtä työpaikkaa Nigeriassa. Mutta on tarinoita, jotka eivät kerro katastrofeista. Ja on hyvin tärkeää, yhtä tärkeää, puhua niistä. Minusta on aina tuntunut, että on mahdotonta sitoutua kunnolla paikkaan tai henkilöön sitoutumatta kaikkiin tarinoihin siitä paikasta tai henkilöstä.

Yhden tarinan seuraus on tämä: Se ryöstää ihmisiltä arvokkuuden. Se tekee ihmisten tasa-arvon tunnustamisen vaikeaksi. Se korostaa, kuinka olemme erilaisia, eikä kuinka samanlaisia olemme. Mitä jos ennen Meksikon matkaani olisin seurannut maahanmuuttokeskustelua molemmilta puolilta, Yhdysvaltojen ja Meksikon? Mitä jos äitini olisi kertonut meille, että Fiden perhe on köyhä ja ahkera? Mitä jos meillä olisi afrikkalainen televisio joka näyttäisi erilaisia afrikkalaisia tarinoita ympäri maailman? Mitä nigerialainen kirjailija Chinua Achebe kutsuu ”tarinoiden tasapainoksi”. Mitä jos huonetoverini tietäisi nigerialaisesta kustantajastani, Mukta Bakaraysta, hämmästyttävä mies, joka jätti työnsä pankissa seuratakseen unelmaansa kustantamon perustamisesta? Perinteistä ajattelua oli, että nigerialaiset eivät lue kirjallisuutta. Hän oli eri mieltä. Hän koki, että ihmiset, jotka osaavat lukea, lukisivat, jos kirjallisuudesta tehtäisiin kohtuuhintaisia ja sitä olisi saatavilla. Pian hänen julkaistuaan ensimmäisen romaanini, menin TV-asemalle Lagosiin haastatteluun. Nainen, joka toimi siellä viestinviejänä tuli luokseni ja sanoi:

”Pidin hirveästi romaanistasi. En pitänyt sen lopusta. Sinun pitää kirjoittaa jatko-osa, ja siinä tulee käymään näin...”

Ja hän kertoi, mitä minun pitäisi kirjoittaa jatko-osaan. En ainoastaan hurmaantunut, olin hyvin liikuttunut. Tässä oli nainen, tavallinen nigerialainen, jonka ei muka pitänyt olla lukija. Hän ei ollut ainoastaan lukenut kirjaa, vaan ottanut sen omakseen, ja tunsi oikeudekseen kertoa minulle, mitä kirjoittaa jatko-osaan. Mitä jos huonetoverini tietäisi ystävästäni Fumi Ondasta, peloton nainen, joka emännöi TV-ohjelmaa Lagosissa, ja on päättänyt kertoa tarinoita, joiden toivoisimme unohtuvan? Mitä jos huonetoverini tietäisi sydänleikkauksesta, joka tehtiin Lagosin sairaalassa viime viikolla? Mitä jos huonetoverini tietäisi nigerialaisesta nykymusiikista? Lahjakkaat ihmiset laulavat englanniksi, pidgniniksi, igboksi, jorubaksi ja ijoksi, sekoittaen vaikutteita Jay-Z:lta Felaan, Bob Marleyhin ja isovanhempiinsa. Mitä jos huonetoverini tietäisi naisasianajajasta, joka äskettäin meni oikeuteen Nigeriassa haastaakseen typerän lain, jonka mukaan naisten pitää saada aviomiestensä lupa ennen kuin he voivat uusia passinsa? Mitä jos huonetoverini tietäisi Nollywoodista, täynnä kekseliäitä ihmisiä ,jotka tekevät elokuvia teknisistä puutteista huolimatta? Elokuvat ovat niin suosittuja, että ne todella ovat paras esimerkki, kuinka nigerialaiset kuluttavat sitä, mitä he tuottavat. Mitä jos huonetoverini tietäisi ihanan kunnianhimoisesta kampaajastani, joka juuri aloitti oman yrityksensä myydäkseen hiuslisäkkeitä? Tai niistä miljoonista muista nigerialaisista, jotka aloittavat yrityksiä ja joskus epäonnistuvat, mutta jatkavat kunnianhimoisina?

Joka kerta mennessäni kotiin kohtaan samat ärsytystä aiheuttavat asiat, kuten useimmat nigerialaiset: meidän epäonnistuneen infrastruktuurimme ja hallituksen. Mutta myös uskomattoman joustavuuden ihmisissä, jotka kukoistavat hallituksesta huolimatta pikemminkin kuin sen ansiosta. Opetan kirjoitustyöpajoissa Lagosissa joka kesä. On uskomatonta, miten monet ihmiset hakevat, miten monet ihmiset haluavat kirjoittaa, kertoa tarinoita. Nigerialainen kustantajani kanssa käynnistimme voittoa tavoittelemattoman ”Farafina Trust'in”. Meillä on isoja unelmia rakentaa kirjastoja ja kunnostaa kirjastoja, jotka ovat jo olemassa, ja hankkia kirjoja valtion kouluille, joilla ei ole mitään kirjastoissaan, ja järjestää useita työpajoja lukemisesta ja kirjoittamisesta kaikille niille ihmsille, jotka haluavat kertoa monia tarinoitamme.

Tarinat merkitsevät. Monet tarinat merkitsevät. Tarinoita on käytetty riistämiseen ja parjaamiseen. Mutta tarinat voivat myös voimauttaa ja inhimillistää. Tarinat voivat rikkoa ihmisten arvokkuuden. Mutta tarinat voivat myös korjata rikkoutuneen arvokkuuden. Amerikkalainen kirjailija Alice Walker kirjoitti tämän etelästä kotoisin olevista sukulaisistaan, jotka olivat muuttaneet pohjoiseen. Hän esitteli heille kirjan etelän elämästä, minkä he olivat jättäneet taakseen.

”He istuivat lukien kirjaa itsekseen, kuunnellen minua lukemassa kirjaa, ja tietynlainen paratiisi saavutettiin uudelleen.”

Haluaisin lopettaa tähän ajatukseen. Kun hylkäämme ”yhden tarinan”, kun ymmärrämme, että ei ole olemassa vain yhtä tarinaa mistään paikasta, me saavutamme uudelleen tietynlaisen paratiisin. Kiitos.

 

Chimamanda Adichie, Oxfordissa Englannissa heinäkuussa 2009.


( Päivitetty: 02.06.2014 11:50 )

 - pelontorjunta | Kommentoi



 Jalkapallokulttuurin sielu ja kuinka se halutaan murhata
03.04.2014 14:21 | pelontorjunta

(Kuva: Racing Clubin kannattajat (oik.) sekä San Lorenzon laulavat juhlivat kannattajat (vas.) Argentiinassa)

 

Koskaan ei voida unohtaa sitä kuinka se iski tuhannen voltin voimalla suoraan sydämeen. Se ei ollut vain jotain tavallista urheilua vaikka se oli tavallista urheilu jossa 22 pelaajaa taistelee pallosta kentällä, yrittävät saada sen haltuun ja laittaa se vastustajan maaliin tai estää vastustajaa näin tekemästä. Kymmenien muiden joukkuepelien tapaan se on hyvin yksinkertainen peli, joskin äärimmäistä taitoa, hyvää fyysistä kuntoa, taktista osaamista ja strategista silmää vaativa. Mutta siinä pelissä on jotain muutakin joka erottaa sen aivan ylivoimaiseksi muihin lajeihin verrattuna. Se suuri erottava tekijä liittyy pelin ympärillä olevaan kulttuuriin. Italialaiset käyttivät ilmaisua kuinka elämä on osa jalkapalloa. Jopa ihmiset jotka eivät tunnustaneet olleensa erityisen kiinnostuneita koko pelistä saattoivat jostain omituisesta syystä vajota depressioon tietämättään siitä että surumielisyyden syy saattoi olla heille tiedostamaton – kunnes muistivat että jokin heitä lähellä oleva seura, usein oman kaupungin, oli hävinnyt ottelun. Moni ei edes tiennyt alitajuisesti kannattaneensa tuota tiettyä seuraa.



Synty

 

Nykymuotoinen jalkapallopeli on lähtöisin Englannista. Samantapaisia pelejä oli jo aiemmin pelattu muun muassa Song-dynastian Kiinassa (tsu chu), Etelä-Amerikan intiaanien parissa, antiikin Kreikassa (episkyros), Rooman valtakunnassa (harpastum), 600-luvulla Japanissa (kemari). Keskiajalla eri puolilla Eurooppaa pelattiin väkivaltaisia pallopelejä. Englannissa pelattiin mob footballia, Ranskassa pelattiin 1100-luvulta lähtien soulea ja Italiassa kansansuosioon nousi gioco de calcio.

Sanan jalkapallo (engl. football) ensimmäinen kirjallinen maininta on vuodelta 1409. Lajin pelivälineeseen viitattiin ensimmäistä kertaa samalla nimellä vuonna 1486. Yhdysvalloissa käytetty sana soccer syntyi 1800-luvun lopulla. Se johdettiin nimen association football alusta.



Työväenliikkeen peli joka levisi lähes kaikkialle

 

Britanniassa edelläkävijöitä järjestäytyneen seurapalloilun osalta olivat skotlantilaiset. Sieltä ajatus järjestäytyneestä seura- ja sarjatoiminnasta levisi Englantiin. Englannin liiga (The Football League) perustettiin vuonna 1888 Aston Villan puheenjohtajan William McGregorin aloitteesta. Liigaa pelattiin ensimmäisen kerran kaudella 1888–1889 kahdentoista keski- ja pohjoisenglantilaisen joukkueen voimin. Lauantai-iltapäivien otteluista tuli suosittua ajanvietettä erityisesti työväenluokkaisten miesten keskuudessa, ja lajin vetovoimaa kiihdyttivät entisestään sanomalehtien kirjoittelu otteluista sekä vedonlyöntimahdollisuudet.

Jalkapallo alkoi levitä Britteinsaarten ulkopuolelle 1900-luvun alussa. Ensimmäisiä maaotteluita pelattiin vuosisadan ensimmäisinä vuosina niin Etelä-Amerikassa kuin Keski-Euroopassakin. Kansainvälinen jalkapalloliitto perustettiin vuonna 1904, ja se otti MM-kisojen järjestämisen ohjelmaansa heti. Eri valtioista ei kuitenkaan löytynyt vielä tuolloin riittävästi rahaa eikä innostusta. Olympiaohjelmaan jalkapallo oli tullut jo vuonna 1900, mutta ensimmäinen turnaus, johon osallistui maajoukkueita seurojen sijaan ja jota myös FIFA piti virallisena, pelattiin vasta Lontoon olympialaisissa 1908. Olympialaiset alkoivatkin kehittyä MM-kisojen eräänlaiseksi edeltäjäturnaukseksi seuraavina vuosikymmeninä.

1920-luvulla monet Euroopan maat olivat siirtymässä kohti ammattilaisuutta, mutta olympialaisissa saivat kilpailla vain amatöörit. Tuolloin FIFA päätti alkaa järjestää MM-kisoja, ja ensimmäinen turnaus pelattiinkin jo vuonna 1930 Uruguayssa. Kisoihin osallistui 13 joukkuetta, ja mestaruuden voitti isäntämaa nujerrettuaan finaalissa Argentiinan maalein 4–2. MM-turnauksia alettiin pelata neljän vuoden välein, mutta toinen maailmansota katkaisi rytmin jo kolmannen turnauksen jälkeen. Kun kisoja jatkettiin 1950-luvulla, Brasilia oli noussut maailman kärkipäähän. Se voittikin maailmanmestaruuden vuosina 1958 ja 1962.



Eri maat, eri kulttuurit, ei tapa ajatella

 

Kun jalkapallo sellaisena kuin se uusilla säännöillä oli muodostunut alkoi levitä Brittein Saarilta muualle Eurooppaan ja Amerikan mantereelle havaittiin miten eri tavalla pelaajat ja kannattajat sen omaksuivat. Syntyi jalkapallokulttuureita, voimakkaita keskuksia jotka olivat täysin autonomisia suhteessa brittiläiseen käsitykseen pelistä.

Euroopassa Itävalta-Unkarin alueelle, Balkanille, Espanjan Baskimaahan, Kataloniaan, Italiaan, Saksaan sekä mm. Benelux-maihin ja Ranskaan syntyi peli- ja kannattajakulttuurit jotka erosivat toisistaan. Suomen tapaisessa maassa yhdenmukaistava ajattelumalli pyrki pitkään häivyttämään tämän tosiasian ja muokkaamaan täysin virheellistä kuvaa jossa Britannia on pelin keskipiste ja muut maat enemmän tai vähemmän vain sopeutuvat siihen viitekehykseen jonka britit luovat. Vasta 1970-luvulta lähtien ihmisten alkaessa entistä enemmän matkustaa ja nähdä eri maita paikallisine ominaispiirteineen liittyen myös jalkapalloon alkoi Englanti-keskeisyys osoittaa ensimmäisiä murenemisen merkkejä. Monilla avautui ettei Englanti ole ainoa maa jossa on ”oikea jalkapallokulttuuri”. Sitä oli muualla jopa enemmän.

Jalkapallo tapana pelata ja sisäistää eri maissa, jopa eri provinsseissa, osoittaa miten kulttuurisidonnainen se on ollut koko modernin historiansa (n. 150 vuotta) aikana. Emme käsittele vain taktiikoita, pelistrategiaa ja edes pelityylejä joita eri puolilla maailmaa eri aikoina on syntynyt.  Joka tapauksessa on selvää että on kyse on evoluutiosta jossa peli muuntuu olosuhteisiin sopivaksi. Englanti saattoi keksiä pelin UUDESTAAN 1800-luvulla mutta ilman Etelä-Amerikan La Platan alueen vaikutusta olisiko ja milloin moderni lyhyt syöttöpeli, seinäsyöttöpeli käsitetty. Uruguay – parin miljoonan ihmisen kansakunta – nousi 1920-luvulla jalkapallon ykkösmaaksi.

Jatkoa seurasi. Argentiinalaiset loivat sen tulisen nopean hyökkäävän, joskus myös rajun, voimakkaasti tunteisiin vetoavan pelitavan, jota vastaan myöhempinä vuosikymmeninä eurooppalaiset joukkueet olivat ajoittain suurissa vaikeuksissa. Latinalaisen Amerikan kauneimmaksi helmeksi muodostui kuitenkin brasilialainen tapa pelata jalkapalloa. Se oli niin kaunista että mm. vuoden 1970 MM-kisoissa Brasilian maajoukkue pelasi sellaista jalkapalloa että tuntui suorastaan kipeältä katsoa miten kaunista peli saattoi olla. Jokainen joka muistaa vuoden 1970 Brasilian maajoukkueen pelit Meksikon kisoissa kiittää Jumalaa ja/tai omia vanhempiaan siitä että oli ehtinyt syntyä ajoissa maailmaan ja ehti katsoa nuo kisat. Tämä on syytä mainita juuri siksi että se mitä myöhemmin alkoi tapahtua on ollut niin kovin tuskallista seurattavaa.



Identiteetti, paikallisvastustaja sekä viha-rakkaussuhde

 

Jokainen kansainvälistä seurajalkapalloa seurannut havaitsee ilmiön jota ei voi rationaalisesti ymmärtää. Jalkapallokulttuuri ei ole vain pokaalien voittamista, pelien voittamista ja pelkkää menestystä. Kannattajalle paikallinen identiteetti on (tai ainakin vielä taannoin oli) määrittelevä tekijä. Ihmiset kannattivat lähes yksinomaan paikallista seuraa. Vastoin yleistä (eteenkin suomalaista) luuloa oman maajoukkueen kannattaminen ei ole koskaan ollut tärkein identiteettiä määrittelevä tekijä missään vahvassa jalkapallokulttuurissa. Itseasiassa kaikkialla maailmassa on havaittavissa yksi yhteinen nimittäjä: jotta suurta spektaakkeli voi edes syntyä tarvitaan tietty vastakkainasettelu. Tarvitaan ”me” ja tarvitaan ennen kaikkea ”he”. Ilman ”heitä” ei ole ”meitä”.

Klassisia esimerkkejä haetaan yleensä ensimmäiseksi Britanniasta. Niitä ovat paikallisottelut mutta myös kahden kilpailevan naapurikaupungin kamppailut. Tunnetuin lienee Skotlannin Glasgown ”Old Firm” ottelu Rangersin ja Celticin välillä. Identiteetti rakentuu – totta tai tarua – siihen että Rangersin kannattajat ovat protestantteja (voi pitää osin paikkaansa) ja Celticin katolisia (ei pidä paikkaansa, joukossa paljon myös muita). Celticillä on ilman muuta myös suuri kannatus Irlannin katolisten keskuudessa, koska Irlannissa ei ole suuria jalkapalloseuroja joihin rakentaa identiteetti. Siltä osin vihreä saari on samanalaisessa asemassa kuin Suomi.

Sitten on tietenkin tätäkin suurempia esimerkkejä Euroopassa kuten Real Madridin ja Barcelonan ”El Classico”, Milanon ja Rooman paikallisottelut sekä eteenkin viime vuosina yleiseen tietoisuuteen tullut turkkilaisten Fenerbachen ja Galatasarayn kohtaaminen. Esimerkkejä löytyy myös Pohjois-Afrikassa eräistä paikallisotteluista joiden kiihkeä tunnelma päihittää mennen tullen mitkä tahansa Britannian tai manner-Euroopan klassikot. Viime vuosikymmeninä juuri muslimimaissa on syntynyt näitä klassisia paikalliskamppailuita tai naapurikaupunkien joukkueiden kohtaamisia joissa kiihkeys on ylivertaista eurooppalaisiin vastaaviin verrattuna. Ne lienevät tunnetasoltaan lähellä jo klassikoiden todellista huipputasoa.

Aivan omaa luokkaansa ovat sitten latinalaisen Amerikan paikalliset hegemoniataistelut. Uruguayssa se on tietenkin Penarolin ja Nacionalin sekä Chilessä Colo Colon ja Universidadin kohtaaminen. Argentiinassa Buenos Airesin valtavuuden takia näitä kohtaamisia on huomattavan paljon. Media nostaa virheellisesti ylivertaiseen asemaan vain Boca Juniorsin ja River Platen kiihkeän kamppailun mutta tosiasiassa näitä ”klassikoita” on muuallakin. Monissa niissä kannattajien kiihkeys ylittää Bocan ja Riverin kohtaamisen vaikka katsojia olisikin hieman vähemmän. Joka kuvittelee että Argentiinassa sarjajalkapallo rakentuu Bocan ja Riverin ympärille on totaalisen väärässä. Näiden kahden seuran merkitys on lähinnä vain siinä että niitä halveksitaan ehkä enemmän kuin muita koska sikäläinen sekä kansainvälinen media ja tuotteistajat haluavat näin uskotella massoja. Argentiina ei ole Skotlanti eikä Espanja. Gimnasia sytyttää Estudiantesin kannattajat tunnetasolla La Platassa vahvemmin kuin River tai Boca. Brasilian osalta on myös totaalisen typerää korostaa liikaa Flamengon ja Fluminensen kohtaamisia.

Näiden tapahtumien taustalta löytyy selkeä heimoajattelusta kumpuava me-henki. Se on sitäkin voimakkaampi kun sitä lähinnä oleva toinen joukko kohdataan. Silloin kuin vastustaja on pienempi,  kaukaisempi mahdollisesti jokin toisesta maasta tullut, ei vastaavaa tunnetta koskaan synny. Kyse on silloin enemmänkin vain omasta pullistelusta, tärkeän ottelun voittamisesta esim. sarjatilanteen tai turnauksen kannalta siis vain yhdestä ottelusta. Jalkapallokulttuuri on hyvin pitkälle riippuvainen kahdesta kilpailevasta valtakeskittymästä, kahdesta seurasta. Monet sarjat rakentuvat tämän ympärille. Muu on pitkälle sitten ”vain” urheilua ja tulosta. Kulttuuri siis tarvitsee samanalaisia rakennusosia jotka ovat sytykkeinä maiden sisällissodille – kaksi kilpailevaa keskittymää jotka eivät ole tunnustaneet eivätkä tule koskaan tunnustamaankaan toisen hegemoniaa.


Suuri käänne 1970-luvulla – markkinavoimat ammattilaisjalkapalloon


Vielä 1960-luvulla ja suurelta osin vielä 1970-luvulla jalkapallo oli pitkälle kansallista ja paikallista.   Euroopassa ja latinalaisessa Amerikassa ei oltu vielä koettu sitä mitä Yhdysvaltojen urheilussa oli jo tapahtunut. Ns. gonzokirjallisuuden suuri nimi Hunter S. Thompson mainitsi lähes kulttiasemaan kohonneessa kirjassaan ”Suuri hainmetsästys”, kuinka USA:n baseball ja NFL-jalkapallo (grid iron) oli muuttunut 1970-luvulle tultaessa. Thomsonin mukaan vielä 1950-luvulla katsomot täyttyivät lajien vakaumuksellisimmista kannattajista, työväenluokkaan kuuluvista miehistä ja nuorisosta. Sitten alkoi kehitys jossa suuret korporaatiot ottivat seurat haltuunsa, modernisoivat katsomot, nostivat lippujen hinnat, tuotteistivat pelin.

Ammattilaisjoukkueurheilusta tehtiin brändi. Siitä tehtiin massoille myytävä kulutustuote. Kannattajista haluttiin tehdä kuluttaja. Ja vaikka amerikkalainen joukkueurheilu ei ole kuuna päivänä ollut tunnetasolla jalkapallon veroinen, niin lopputulos USA:ssa oli joka tapauksessa selvä. Tapahtuma latistui. Mutta se ei välttämättä vienyt katsojia stadioneilta. Mutta katsojarakenne muuttui. Se keskiluokkaistui, siellä oli entistä enemmän liike-elämän edustajia ja julkkiksia. Lajit vietiin sen kiihkeimmiltä kannattajilta jotka siirtyivät osin korkeiden hintojen ja esikaupunki-ilmiön takia seuraamaan otteluita televisioista.

Euroopassa ensimmäiset merkit kaupallistumisen lisääntymisestä havaittiin myös 1970-luvulla. Mainostaminen lisääntyi. Otteluita televisioitiin entistä enemmän. Britanniassa mainokset pelipaitoihin tulivat vasta 1970-luvun lopulla mutta juuri Britanniassa kaupallistaminen ja tuotteistaminen lähti – tosin muita myöhemmin – kiihkeämpään vauhtiin. Britanniassa oli olemassa eräitä syitä (tai tekosyitä?) jonka takia siellä käänne oli jopa muita maita rajumpi.

Ei voida kiistää sitä tosiasiaa etteikö Britanniassa ns. jalkapallohuliganismi olisi voimistunut 1960-luvun lopulta lähtien. Kautta aikojen katsomoväkivaltaa tai väkivaltaa ennen ja jälkeen ottelujen on ollut. Sitä koettiin jo 1800-luvulla. Mutta 1970-luvulla huliganismi saavutti ainakin median silmissä suoranaisen ruton aseman. Ns. jalkapallojunat alkoivat 1960-luvulta lähtien kuljettaa lauantaisin tuhansia kannattajia vierasotteluihin. Yhteiskunnan yleinen ilmapiiri, populaarikulttuuri, nuorisokulttuuri, yleinen moraalikoodiston muutos toi kaupunkien kaduille, stadioneiden lähistölle sodan jälkeen syntyneet suuret ikäluokat jotka toimivat eri tavoin kuin aiemmat. Samaan aikaan yhteiskunnassa romahtivat vanhat koossa pitävät instituutiot. Omituisella tavalla jalkapallo ja uskollisuus seuraa kohtaa oli enää ainoa yhteisöä koossa pitävä tekijä. Samaistumalla jalkapallojoukkueen kannattamiseen saatoit vielä osoittaa kuuluvansa johonkin ”heimoon”.

Lähempi tarkastelu osoittaa että ”epidemiaksi” karannut jalkapallohuliganismi oli osin myytti, jota media ja tietyt poliittiset tahot käyttivät hyväkseen. On varsin yleisesti tiedetty tosiasia että pääministeriksi kohonnut Margaret Thatcher ei erityisemmin pitänyt jalkapallosta. Hän oli syntyisin työväenluokkaisesta perheestä, irrottautunut tästä maailmasta ja osin ehkä siitä syystä vieroksui kaikkea mikä viittasi työväenliikkeen identiteettiin. Jalkapallo oli yksi näistä. Media puolestaan näki huliganismissa hyvän uutisoinnin aiheen. Huliganismia paisuteltiin. Tässä uuskonservatiivisessa ilmapiirissä jossa sosiaalietuja leikattiin ja jossa ”jokaisen piti olla oman onnensa seppä” jalkapallohuliganismi leimattiin luuserin malliksi. Äärimmillään jokainen jalkapallon kannattaja sai säälittävän hölmön/puolirikollisen leiman.

Koska Englannin sarjajalkapallolla on tietty traditio ja anglosaksisella medialla on globaali valta-asema, syntyi tilaus sille että suuri raha, monikansalliset sijoittajat tulevat brittiläiseen jalkapalloon. Sitä ennen olisi vain suoritettava vallankaappaus. Seurat olisi kaapattava lopullisesti kannattajilta sijoittajille ja koko pelistä tehtävä brändi. Tapahtumat Heyselin stadionilla 1985 sekä Sheffieldissä 1989 olivat suuren rahan kannalta varsinaisia onnenpotkuja. Kummatkin tapahtumat ovat ainakin osittain virheellisen historiantulkinnan sävyttämiä. Heyselissä Liverpoolin kannattajat eivät hyökänneet italialaisten ”kimppuun”. Kyseessä oli huonosti organisoidun ottelun karkaaminen täysin avuttomien järjestäjien käsistä sekä joukkopako jossa ihmisiä kuoli. Sheffieldissä tilanne oli sama. Sille seuralle joka toi paikalle huomattavasti enemmän kannattajiaan varattiin vähemmän paikkoja katsomosta. Onnettomuuksien pääsyy oli surkea tapahtumista vastuussa olleiden organisointi. Mutta joka tapauksessa uuskonservatiivinen ajattelu halusi nyt kertakaikkisesti heittää katsomosta ulos nuhjuiset hielle ja kaljalle haisevat kannattajat. Jalkapallo haluttiin ”siistiksi” ja paremmin markkinoitavaksi tuotteeksi.


Kuinka seurat kaapattiin kannattajilta korporaatioille


1980-luvulta lähtien ammattilaisjalkapallo tuotteistettiin lopullisesti. Tulokset olivat kieltämättä vaikuttavia. Kun Jari Litmanen siirtyi hollantilaiseen Ajaxiin 1990-luvun alussa oli seuran liikevaihto vain noin miljoonaa euroa. Kun hän sieltä lähti oli liikevaihto kymmenkertaistunut. Vuonna 1977 maksoi pääsylippu Englannin liigan ylimmän sarjatason otteluun vähemmän kuin 2 puntaa (istumapaikka). Seisomakatsomoon pääsi alle punnalla. Englannin Valioliigan syntyessä 1990-luvun alkupuolella joutui lipusta maksamaan vähintäin kymmenkertaisen, jopa 20 kertaisen hinnan. Tänään lippu, jos sellaisen ylipäätänsä onnistuu ostamaan lontoolaisen valioliigaseuran otteluun maksaa usein n. 60 puntaa. Sama kehitys on havaittavissa Espanjassa. Kyllä. Stadionit ovat nyt hienoja, osa suorastaan uskomattoman upeita. Hyvästä tasosta kannattaa maksaa, vai kannattaako?

Tämä kehitys on johtanut siihen mikä USA:ssa koettiin suosituissa joukkuelajeissa jo sukupolvi aiemmin. Lajin kiihkein kannattajajoukko on osin suljettu stadioneilta. Kenellä on varaa maksaa jokaisesta ottelusta 50-100 euroa? Kenellä on varaa ostaa 1 000 – 3 000 euroa maksava kausikortti, sillä tuo hankinta on monelle itse asiassa lähes ainoa keino päästä seuraamaan omaa joukkueettaan stadionilla varsinkin jos seura on menestyvä? Kun mietitään syitä siihen miksi katsomot ja niiden tunnelma Euroopassa (ja osin muuallakin) on muuttuneet viimeisen 30-40 vuoden aikana ei stadioneiden modernisointi, seisomakatsomoiden häviäminen ole vähäinen asia. Itse asiassa se on muuttanut hyvin oleellisesti kaiken.

Rinnan stadionien modernisoinnin on katsojien valvonta lisääntynyt. Stadioneilla, niiden välittömässä läheisyydessä, rautatieasemilla, joukkojen kokoontumispaikoilla. Katsojia tarkkaillaan, kontrolloidaan ja rangaistaan nykyisin hyvinkin vähäpätöisistä syistä. Näyttää siltä että esim. Britanniassa on huliganismin vastainen taistelu jäänyt päälle kuin vanha vinyylilevy vaikka huliganismi on ollut pääsarjatasolla jo kauan kadonnutta kansanperinnettä.

Katsojarakenteen muutos ei ole estänyt sitä etteikö peleissä kävisi paljon katsojia. Saksan pääsarjan keskimääräinen yleisömäärä on n. 40 000 kun se Beckenbauerin ja Mullerin aikana - ”kultaisina vuosina” - oli vain puolet tästä (20 000 – 24 000). Englannin pääsarjatasolla yleisömäärät ovat nyt yhtä korkeita kuin ne olivat 1960-luvun alussa ja lähes 70% korkeammat kuin 1980-luvun puolivälissä. Seurat saavat monikymmenkertaiset pääsylipputulot verrattuna 40 vuoden takaiseen aikakauteen.

Mutta kaikkein rajuimmin ovat nousseet muut tulot. Sitä on kaikkinainen fanituotevalikoima, krääsä. Tässä näkyy globaali-ilmiö. Suuret seurat myyvät valtavat määrät fanituotteita, esim. pelipaitoja mm. Aasiassa. Tv-sopimukset tuovat vielä suuremmat tulot. Sitten on erityyppiset näytösottelut. Seurojen tuotteistamisessa mennään jo niin pitkälle että seuraan voidaan ostaa pelaaja Kiinasta, Japanista tai Etelä-Koreasta vain siitä syystä että näin seuran brändiä voidaan parantaa huomattavasti noilla valtavilla markkina-alueilla. Monien suurseurojen katsomoissa näkee hyvinkin kaukaisista maista tulleita ”pyhiinvaeltajia”. Tätä valtavaa liiketoimintaa perustellaan kalliilla maailmanluokan pelaajien hankinnoilla. Tämä mieletön kolmannen maailman huippupelaajien ryöstö kuihduttaa omalla osallaan mm. itäeurooppalaisen, latinalaisen Amerikan, Afrikan ja P-Afrikan kansallisia sarjoja maiden parhaimpien pelaajien siirtyessä läntisen Euroopan suurimpiin sarjoihin. Käänteisesti tämä vähentää tarvetta harjoittaa junioritoimintaa näissä läntisen Euroopan maissa.

Eräs viimeaikojen pöyristyttävin esimerkki tulee maasta joka on voittanut sekä pelin maailmanmestaruuden että kaksi kertaa Euroopan mestaruuden; kyse on tietenkin Ranskasta. Qatarin valtio päätti muutama vuosi sitten sijoittaa valtavan summan rahaa ammattilaisjalkapalloon ja etsi parasta mahdollista sijoituskohdetta. Sen Qatarin sijoittajat löysivät 12 miljoonan asukkaan Pariisista. Hämmästyttävä asiahan on se että Pariisi, Euroopan pääkaupunki, on jokseenkin autio jalkapallosta. Jättikaupungissa on vain yksi kohtalaisen merkittävä seura nimeltään Paris Saint German. Tässä PSG-seurassa oli qatarilaisille unelmakohde. Alkoi valtava rahavirtojen vyöry seuraan. Sen mukana megaluokan pelaajahankinnat, uusi valmennusjohto jolta ei tule resurssit loppumaan. Seuran liikevaihdon väitetään nousseen jo viidenneksi suurimmaksi vauhdilla joka enteilee sitä että PSG:stä, äskettäin suurelle yleisölle tuiki tuntemattomasta seurasta saattaa tulla 1-2 vuoden sisällä liikevaihdoltaan maailman suurin. Samalla alkoi tuttu ilmiö seuran katsomossa: lippujen hinnat nousivat, menestyksen myötä katsojamäärät kohosivat mutta entisten raivoavien kannattajalaumojen sijasta katsomo on säyseä lammaslauma. Sen laulaa kumoon kevyesti tuhat saksalaista vierailevaa jalkapallofania. Ei liene sattuma että Ranska oli se tietyn eurooppalaisten maiden muodostaman klikin johtaja joka äänesti vuoden 2022 MM-kisat Qatariin - eräs esimerkki siitä mille moraaliselle tasolle ammattilaisjalkapallo on vajonnut.



Muutos katsomoissa – poissa oleva nuoriso ja yhä latteampi tunnelma

 

Tuotteistaminen, kalliit lippujen hinnat ja yhä useamman katsojan muuttuminen kausikortin omistajaksi, eräänalaiseksi suurkuluttajaksi ei ole voinut olla vaikuttamatta jalkapallo-ottelujen luonteeseen eteenkin Euroopassa ja muissa vauraissa maissa. Tämä muutos on todennäköisesti kaikkein järkyttävimmällä tavalla näkyvissä esim. Manchester Unitedin tapaisessa seurassa.

Oli kerran aika jolloin Manchester United kiihkeine kannattajineen oli suoranainen käsite. Tämä aika vallitsi 1960-luvun lopulta aina 1970-luvun lopulle asti. Eräänalainen huipentuma oli skotlantilaisen Tommy Dochertyn ollessa seuran managerina 1970-luvun puolivälissä. Miten muuten voidaan selittää sitä hillitöntä, osin jopa hysteeristä kannatusta mitä seura nautti kannattajiensa keskuudessa pelattuaan kaudella 1974-75 Englannin liigan 2.divisioonassa ja siitä huolimatta lyödessään yleisömäärissä kaikki pääsarjatason seurat. Sen vierasotteluihin saattoi matkustaa helpostikin yli 10 000 kannattajaa junilla ja linja-autoilla vaikka osalle ei ollut edes lippuja tiedossa. Suuri tekijä oli ilman muuta seuran kannattajien identiteetti, fanaattinen halu sitoutua seuraan joka oli ollut jo vuosia syöksykierteessä. Mutta hyvin suurelta osin maniaa selitti myös Tommy Docherty, joka oli niitä viimeisiä brittimanagereita jotka puhuivat sitä kieltä mitä seisomakatsomoissa ymmärrettiin.

Se miltä Manchester Unitedin Old Trafford näyttää 40 vuotta myöhemmin on masentavaa katsottavaa. Tunnelmasta ei juuri voi puhua jos vertaa sitä Dochertyn aikakauteen. Asian voi ymmärtää vain tuntemalla taustat. Kun Dochertyn vuosina Stretford End-päätykatsomossa katsojien keski-ikä oli 19 vuotta on se tänään peräti 43 vuotta. He kaikki istuvat. Hyvin harva laulaa enää. Jopa seisomaan nouseminen saattaa aikaansaada sanktioita. Koko tunnelma eteenkin ennen ottelua vaikuttaa perin lattealta.

Manchester Unitedin stadionin surkea tunnelma onkin muodostunut nykyisin yleiseksi vitsin ja ivailun aiheeksi Britanniassa vaikka todellisuudessa asia on oikeastaan traaginen. Syytä irvailuun ei muutenkaan ole sillä tilanne kaikkialla Englannin Valioliigassa on lähes yhtä masentava. Suomalaiseen veikkausliigaan verrattuna se on varmasti parempi mutta vain siksi että siellä on 15 kertaa enemmän yleisöä. Vanha kannattajakulttuuri näyttää olevan Englannissa katoamassa. Manchester Unitedin hirvittävä kohtalo kehittyä brändituotteeksi - ”Unelmien Teatteriksi” - voi olla lopun alkua jalkapallokulttuurille läntisissä rikkaissa maissa.

Muualla Euroopassa tilanne näyttää yhtä uhkaavalta joskaan ei vielä yhtä pahalta. Ehkä Englanti on vain kehityksen kärjessä. Saksa sallii yhä omassa Bundesliigassa stadioneille seisomakatsomot ja niinpä britit kadehtivat jo saksalaista jalkapallokulttuuria. Siellä perinteisille kannattajille annetaan arvo ymmärtämällä se mikä merkitys kannattajakulttuurille näillä seisomakatsomoilla on. Lajin sitoutuneimmat kannattajat ovat aina halunneet katsoa ottelunsa näillä teransseilla. Niillä on valtavan paljon parempi tunnelma. Saksalaisseurat ymmärtävät brittiseuroja paremmin niiden arvon myös sosiaalisesti - seisomakatsomot mahdollistavat vähävaraisimmille tilaisuuden kokea Saksan Bundesliigan ilmapiiri. Kritiikki hurjasti käyttäytyviä kovan linjan kannattajia, seisomakatsomoiden ultria sekä latinalaisen Amerikan barras bravoja kohtaan ontuu toisaalta, sillä nämä kiihkeät ydinryhmät ovat toisaalta äärimmäisen tärkeitä "elämänlähteitä" monien italialaisten, balkanilaisten ja latinoseurojen tulevaisuudelle. He ovat kuin ydinseurakunta, todellinen "uskovien yhteisö" paikallisseurakunnan keskellä.

Mutta yleinen trendi näyttää olevan Euroopassa kohti vain istumakatsomoita sillä niiden avulla nostetaan pääsylipputuloja. Katsojia on myös helpompi kontrolloida. UEFA puolestaan on kieltänyt seisomakatsomoiden käytön omissa euro-otteluissaan joka omalta osaltaan ajaa useat mannereurooppalaiset seurat seuraamaan Englannin esimerkkiä. Euroopan tämän ajan menestyksekkäämmän maan Espanjan sarjapelien tunnelmaa ei voida erityisemmin kehua. Sarja rakentuu kahden suurseuran FC Barcelonan ja Real Madridin ympärille. Molemmat ovat megaseuroja mutta ovat olemukseltaan jokseenkin yhtä latteita brändejä kuin vaikkapa edellä mainittu nykyajan Manchester United.

Lisäksi taustalla väijyy myös amerikkalaistyyppinen uusi uhkakuva: suursijoittajan omistama seura voidaan periaatteessa siirtää jopa entisestä kaupungista toiseen, jopa aivan toiseen maahan. USA:n ja Kanadan monia urheiluseuroja on siirretty eteenkin pohjoisista kaupungeista USA:n "aurinkovyöhykkeelle". Eurooppalaiselle jalkapallolle tällainen ilmiö olisi jo suoranaista pilkantekoa mutta tämä mahdollisuus voi vielä tulevaisuudessa reaalisoitua.

Noin neljännesvuosisadassa koko kuva ammattilaisjalkapallosta on muuttunut. Vielä 1990-luvun alussa otteluiden suorat televisioinnit eivät olleet kovinkaan yleisiä. Nyt sateliittikanavien aikakautena otteluita voidaan seurata kymmeniltä kanavilta. Periaatteessa voit hyvinkin katsoa kuusi ottelua päivässä. Kenenkään psyyke ei kestä moista suurkuluttamista. Samalla yhä useammalle paljastuu karmea totuus - mitään maagisuutta pelissä ei enää ole. UEFA:n mestareiden liiga, täysin paisuteltu ja hypetetty 8 kuukautta kestävä näytelmä on suorastaan tuhonnut kaiken sen hohdon mitä monet kuvittelivat pelissä yhä olevan. Uskomatonta yliarvostettua roskaa, "unelmateollisuutta".


Tuhoutuuko jalkapallokulttuuri lopullisesti?


Näiden esimerkkien jälkeen voidaan esittää kysymys: tuhoutuuko jalkapallokulttuuri? Tai: jos tuhoutuu niin onko sillä niin väliä? Kysehän on lopultakin vain yhdestä pelistä ja viihteestä.

Näin tietysti on jos peli ja sen mukana syntynyt ainutlaatuinen globaali ilmiö käsitetään vain viihteeksi ja välineeksi tehdä rahaa. Mutta asia ei ole näin yksinkertainen. Kyse on hyvin keskeisestä ilmiöstä. Voidaanko mikä tahansa uskonto, ideologia, kulttuuri ostaa ja myydä? Tai että onko oikein että paikallinen kulttuuri, sillä sitähän jalkapalloseurat ja niiden kannattajat juuri taannoin edustivat, hävitetään?

Olisi syytä laajentaa käsitettä jalkapallosta ja hyväksyä siihen liittyvään kannattamiskulttuuriin suuri annos uskonnollisuutta, heimoajattelua ja valtavaa kaipuuta yhteisöllisyyteen jota moderni talous ja poliittinen eliitti pyrkii kuristamaan. Se on myös osattava nähdä osana maskuliinista nuorisokulttuuria, sillä kannattamiskulttuurissa nuoruus, maskuliinisuus on tärkeä osa. Eliitin ja markkinavoimien brutaali hyökkäys jota käydään traditionaalista kannattajakulttuuria vastaan kaikin tavoin kaikkialla maailmassa on osattava peilata myös poliittisista motiiveista käsin, jossa eteenkin nuoret miehet muodostavat aina myös potentiaalisen uhan. Onko pelkkä sattuma että jalkapallokulttuurin moraalinen alennustila ajoittuu samaan aikakauteen jolloin perinteinen vasemmistolainen työväenliike on ahtaalla?

Kautta aikojen on tiedetty se, että poliittiset johtajat ja koko poliittinen eliitti on ollut perso mielistelemään urheilumenestystä ja kannattajalaumoja, niissäkin kun on paljon potentiaalisia äänestäjiä. Mutta toisaalta samat tahot ovat aina suhtautuneet tietyllä huolestuneisuudella tähän moni paikoin hyvin hurjaan joukkoon. Sen kanssa haluttaisiin siipeillä mutta se haluttaisiin pitää myös aisoissa. 

Palataan sinne missä lähes pidäkkeettömään kokonaisvaltaiseen jalkapalloseuran rakastamiseen suhtaudutaan yhä lämmöllä, esim. Argentiinaan. Vuonna 1978 Argentiina voitti ensimmäisen kerran jalkapallon maailmanmestaruuden. Näin tämän asian tiivisti uruguaylainen kirjailija Eduardo Galeano:

”Avajaisseremonian aikana kenraali Videla antoi Havelangelle kunniamerkin sotilasmarssin soidessa Buenos Airesin Monumental-stadionilla. Muutaman askelen päässä toimi täydellä teholla Argentiinan Auschwitz eli Laivaston mekaniikkakoulun kidutus- ja teloitusleirit. Ja muutamaa kilometriä kauempana lentokoneet pudottivat eläviä vankeja mereen.”

 

Naapurimaassa Chilessä diktaattorin rikokset olivat vähintäin samaa luokkaa. Kenraali Augusto Pinochetista ei ole varmaa tietoa olisiko hän myöhemmin uskaltanut jalkapallo-otteluihin sillä hän olisi saattanut kuulla laulua siitä ”kumpi tätä maata hallitsee, kansa vain huoranpenikka”. Espanjassa syvä viha Real Madridia vastaan oli kauan vahvinta siellä missä sisällissodassa asetuttiin tasavaltaisten puolelle. Tämä muisto eli pitkään Athletic Bilbaon ja Barcelonan kannattajien sisällä. Real Madrid koettiin kenraali Francon seuraksi.

Poliittisia intohimoja vahvempi on kuitenkin kannattajien halu olla osa paikalliskulttuuria. San Lorenzon (kuva), Racingin (kuva), Colonin, Gremion, Magrebin, Hajduk Splitin ja Aris Salonikin kannattajille on oman seuran kannattaminen osa paikallisidentiteettiä, kuulumista osana omaan yhteisöön. Nimitettäköön sitä heimoajatteluksi. Se on joka tapauksessa tuloksena evoluutiokehityksestä, kuulumista omaan tiettyyn joukkoon urbaanissa ympäristössä. Se voi olla sytykettä mm. rasistiseen ja muukalaisvihamieliseen asennoitumiseen mutta sen ei sitä tarvitse olla. Latinalaisessa Amerikassa, Euroopassa ja Pohjois-Afrikassa saman seuran kannattajat ovat yhtä oli heidän ihonvärinsä mikä tahansa.

Kaikki eivät ole vielä antaneet periksi ”modernille jalkapallolle”, munattomalle, hajuttomalle käsitykselle jalkapallosta vain pelkkänä viihteenä ja tuotteena. Saksalainen kohuseura St. Pauli on anarkistinen seura paitsi siksi että se heittää surutta ulos kaikki sellaiset stadioniltaan jotka tulevat sinne lietsomaan rotuvihaa, rasismia tai homofobiaa, myös siksi että kannattajien suuri osa vastustaa kaikkea sitä toimintaa jolla suuri raha pyrkii kaappaamaan jalkapallon ja seuran sen kannattajilta. Seuran kannattajien ideologia lähtee puhtaasti siitä että on parempi pelata vaikka 3. divisioonassa kuin olla menestyksellinen brändi ja tuotemerkki. Tämä voi olla mahdotonta aikakautena jolloin lähes kaikki tuotteistetaan. Olisiko siis lähdettävä etsimään realistista kolmatta tietä St.Paulin ja vastenmielisen ”nykyjalkapallon” väliltä?

Ehkäpä tehtiin virhe kun turvallisuuden tavoittelussa (=huliganismin torjunta) mentiin liian pitkälle. Joskus ”rikollisuuden” jahtaaminen voi johtaa hyvin negatiivisiin tuloksiin. Huligaanit voivat siirtyä jalkapallosta tappelemaan mobiililaitteita hyväksi käyttäen vaikka syrjäseuduille etukäteen järjestettyihin turnajaisiin. Ehkäpä tehtiin virhe kun stadioneista tehtiin antiseptisiä, komeita, mutta hengettömiä areenoita, vain istumakatsomoineen. Meillä on nyt uusi ”Englannin tauti” joka voi johtaa siihen, että jalkapallospektaakkeli muuttuu yhä enemmän hengettömäksi ruumiiksi. Siitä merkkeinä on yhä useammin stadioneiden kaiuttimista kuuluva hyvin säälittävä, keinotekoinen "hengennostatus", jolla ei ole mitään tekemistä kannattajien sisältä lähtevän omaehtoisen kannustuksen kanssa.

Sietämätön taistelu maailman parhaimmista pelaajista vain kourallisen eurooppalaisten megaseuran kesken näivettää tuhansien tavallisten seurojen toimintaa Euroopassa, latinalaisessa Amerikassa ja Afrikassa. Se näivettää kansalliset ja paikalliset erityispiirteet sekä siirtää yleisen huomion kohti maailmanlaajuisia tympeitä sieluttomia jalkapallobrändejä. Kehitys on tappamassa kansallisia sarjoja. UEFA:n Mestareiden liiga on vain kärjistänyt seurojen välisiä tuloeroa, lisännyt tasoeroja johtaen yhä enemmän siihen että kansallisia sarjoja dominoivat vain pari seuraa. Tämä kaikki johtanee siihen että kokonainen uusi nuori sukupolvi saattaa menettää oikean aidon kosketuksen koko suuremoiseen lajiin ajamalla kannattajat televisioiden ääreen, tulevaisuudessa vain sosiaaliseen mediaan.

Mutta entä sitten jos valtavien joukkojen laulut katsomoissa vaimenevat? Entä sitten kun fanaattiset ultrat ja barras bravat, suurten laulavien, ulvovien, mylvivien orkestereiden kapellimestarit on heitetty ulos jalkapallosta kuten ns. ”huligaanit” Britanniassa aiemmin? Entä sitten kun tuhansien tonnien betoninen stadion ei enää lähdekään lentoon pallon iskiessä vastustan maaliin? Sitten kun tunnelma on ”siistiytynyt”. Puhukoot FIFA:n ja UEFA:n johtajat mitä tahansa jalkapallon suuruudesta mutta mikäli nuorelta sukupolvelta sulkeutuvat ovet jalkapalloareenoilta tympeän tuotteistamisen, kalliiden lippujen, korkean nuorisotyöttömyyden takia, alkaa todelliselle aidolle jalkapallokulttuurille soida kuolinkellot. Missä on nuoriso, siellä on toivo ja tulevaisuus. Siellä on elämä.

Ponga huevo San Lorenzo, vamos vaya al frente

Que aca está tu hinchada, que acá está tu gente

Porque ser de San Lorenzo es muy diferente

Este sentimiento, nadie lo comprende

 

Que no tiene explicación, eso es verdad

Cada vez te quiero mas, y siempre yo voy a estar presente

Este sentimiento es verdadero,

Ciclón te amoo, sin vos me muero.

 

Espanjankieliset sanat San Lorenzo- seuran kannattajien laulusta kuvaavat  heidän tunteensa seuraansa kohtaan. Kyseessä on Buenos Airesin suurkaupunkialueen tietyn asuinalueen ihmisten oma seura. Laulu kertoo kuinka mahdotonta ulkopuolisten on tajuta mitä on olla juuri tämän kyseisen seuran kannattaja. ”Tätä tunnettu kukaan ei voi käsittää”. He laulavat siitä että ”ilman sinua kuolemme” mikä voidaan käsittää myös siten että kannattaja ilman muita kannattajia jää myös yksin, kuolee. Seura on nimenomaan sen kannattajien. Tuskin kukaan täysjärkinen kuolee sen takia että jää ilman jotain pörssiyhtiön omistamaa brändituotetta. Seuran kannattamisessa on kyse lopultakin ihmisen ikävästä toisen luo, kutsu juhlaan, karnevaaliin, kutsua jakamaan valtava tunne yhdessä. Ihmisen erottaminen toisesta ihmisestä on rikos.


( Päivitetty: 04.04.2014 12:13 )

 - pelontorjunta | Kommentoi



 Kun nainen rakastaa naista
22.03.2014 08:23 | pelontorjunta

(Kuva:When Night Is Falling. Petra (Rachael Crawford) ja Camille (Pascale Bussières))

Ne eivät ole enää vain yksittäistapauksia vaikka nämä harvinaisuudet nostetaan helpommin mediassa esille. Cyntia Nixon teki sen. Lindsay Lohan on sitä tehnyt. Lukuisat TV-sarjat rakentuvat sen päälle. Onko kyse naisten mielikuvituksesta, miesten kauhuskenaariosta vai ovatko heteroliitoissa elävät naiset todellakin lisääntyvässä määrin jättämässä miehensä löydettyään rakkauden kohteen toisesta naisesta? On myös uutta tieteellistä tutkimusmateriaalia joka osoittaa että rakastuminen vain ja ainoastaan vastakkaisen (tai saman) sukupuolen ihmiseen ei olekaan niin itsestään selvä ja ehdoton taipumus kuin on aiemmin luultu. Mieltymys erityisesti naisten keskuudessa voi olla luultua joustavampi.

Tilastoja siitä kuinka monet naiset ovat jättäneet miesystävänsä tai aviomiehensä toisen naisten takia on vaikea löytää. Vaikka esim. Yhdysvaltojen tilastohallinto (US Census Bureau) ylläpitää tietoja avioliitoista, avoliitoista, erityyppisistä parisuhteista sekä eroista ei tietoja naisten takia miehensä hylänneiden määrästä ole saatavilla. Mutta monet muutkin asiantuntijat kuin Binnie Klein Yalen yliopiston psykologian laitoksesta ovat havainneet vaihtoehtoisten suhteiden olevan yleistymässä.

"On selvää, että seksuaalisen suuntautumisen muutosta on tapahtumassa enemmän kuin aiemmin. Hyväksynnän raja-aita on madaltunut ja siihen on olemassa mahdollisuuksia enemmän kuin aiemmin”, toteaa Klein.

Pieni kuvaava esimerkki löytyy hänen omista potilaistaan joista jo lähes kymmenkunta oli jättänyt miehensä toisen naisen takia ja he pelkäsivät heille aiheutuvan surua ja murhetta mikäli he palaavat takaisin heterosuhteisiin. Feministi Susan Bordo on havainnut saman ilmiön. Tietyn tabun murtuminen on lisännyt mahdollisuuden ”laajentaa” seurustelureviiriä.

Britanniassa julkaistujen tutkimusten mukaan niiden naisten osuus joilla oli ollut suhde toisen naisen kanssa nousi vuosien 1990-2012 välillä 1,8%:sti peräti 8%:iin.

 

Synnynnäinen vai kasvatuksen myötä tullut?

 

Viime vuosikymmeninä tutkijat ovat yrittäneet selvittää mikä määrittää sukupuolisen suuntautumisen. Onko kyse synnynnäisestä vai ympäristön/kasvatuksen myötä kehittyneestä taipumuksesta? Voiko se muuttua ihmisen elinaikana? Joukko tutkimuksista 1990-luvulla viittaisi eteenkin miespuolisten homojen kromosomien eroihin heteromiehiin verrattuna. Mutta myöhemmät tutkimukset seksuaalisesta suuntautumisesta viittaisivat useisiin kuten ympäristö-, kognitiivisiin sekä biologisiin tekijöihin. Kirjailija-tutkija Teemu Keskisarja omassa seksuaalirikollisuuden historiaa käsittelevässä kirjassaan löysi yllättävän vähän homoseksuaalisuuteen liittyneitä tapauksia verrattuna esim. 1600- ja 1700-luvuilla hämmästyttävän yleisiin eläimiin sekaatumisiin. Keskisarja on julkisuudessa esittänyt kiinnostavan kysymyksen siitä onko homous sittenkään vain ja ainoastaan biologinen ilmiö.

Ajatus siitä, että ihmisen seksuaalisuus muodostaa jatkumon on ollut voimassa vuodesta 1948, kun Alfred Kinsey esitteli kuuluisan kuuden pisteen asteikon, jossa 0 edustaa täydellistä heteroseksuaalisuutta , 6 merkitsee täydellistä homoseksuaalisuutta ja bi-seksuaalisuus asettui näiden ääripäiden väliin. Uusimmat tutkimukset ovat kuitenkin osittain romuttamassa Kinseyn pisteytysteorian ja aivan erityisesti lesbojen osalta. Ei ole ollenkaan varmaa että nainen jakautuu tiukasti kolmeen kategoriaan suuntautumisessa. Moni heteroksi itsensä luullut, sellainen joka ei olisi kuuna päivänä kuvitellut ihastuvansa seksuaalisesti naiseen, koki tällaisen ”muutoksen”.

Erityisesti juuri naisten osalta on havaittu huomattavaa ”muuntautumista” - he saattoivat ihastua tai rakastua ihmiseen täysin riippumatta siitä oliko tämä mies tai nainen. Miehillä tätä ilmiötä olisi tutkimusten mukaan vähemmän: homojen ja biseksuaalien joukko koostui reilusti yli 50%:sti homoista, miehistä jotka eivät tunteneet mitään seksuaalista halua naista kohtaan. Sen sijaan naisten osalta biseksuaalien osuus oli selkeästi suurempi kuin lesbojen (sellaisten jotka eivät voisi kuvitellakaan seurustelevansa miehen kanssa). Lisäksi näiden ”joustavien” osuus näyttää olevan selvässä kasvussa. Nainen miehiä useammin näyttäisi siis kykenevän rakastumaan ja ihastumaan ”tapauskohtaisesti”, joko mieheen tai toiseen naiseen.

Vuonna 2004 tehtiin merkkipaaluna pidettävä tutkimus Northwestern Universitiessä, USA:ssa. Kokeessa naispuoliset henkilöt kiihottuivat seksuaalisesti katsoivat he sitten voimakkaasti eroottisia hetero- tai lesbofilmejä. Tämä koski sekä lesboja että heteronaisia. Miespuoliset heteromiehet sen sijaan kiihottuivat sekä lesbojen että heterojen seksistä mutta eivät homomiesten seksistä. Itse asiassa vain homomiehet kiihottuivat homojen seksistä. Tätä tutkimus paljasti perustavaa laatua olevan eron miesten ja naisten aivojen välillä.

Ajatus siitä että libido voi vaihdella edestakaisin voi järkyttää ahtaan traditionaalisen tulkinnan kannattajia (niitä joiden mukaan nainen voi olla vain joko hetero, lesbo- tai bi-seksuaalinen). Mutta haastatteluilla täydennetyt tutkimukset ovat linjassa uuden väljemmän tulkinnan kanssa. Monet heterosuhteesta lesbosuhteeseen siirtyneet naiset totesivatkin että he viehättyivät persoonaan, eivät sukupuoleen. Naisten erilainen emotionaalinen rakenne mahdollistaa tällaisen reviirin laajennuksen. Lesbosuhteessa ollut voi myös siirtyä joustavasti heterosuhteeseen. Naisia ylipäätänsä ei voida siis lokeroida niin vain suuntautumisryhmään.

 

Kun yö saapuu

 

1980-luvun loppu ja aivan erityisesti 1990-luku oli erityyppisten lesboelokuvien ja lesboutta sivuavien tv-sarjojen läpimurtoaikaa. Genre on tullut jäädäkseen joskin sen suurin julkinen kohu on hellittämässä. Siitä on tullut osa viihdeteollisuutta. Osa tuotannosta on saavuttanut arvostusta (kuten The Hours-elokuva), osa on jäänyt unohduksiin. Yksi elokuva on mielenkiintoisella tavalla jäänyt vaille kriitikkojen yleistä arvostusta kun taas ”suuremman” yleisön keskuudessa se on noussut jopa eräänlaiseksi kulttituotteeksi. Tämä elokuva: When Night Is Falling (Kun yö saapuu) olkoon populaarikulttuurinen hahmotelma siitä miksi se on ollut yleisön joukossa suhteellisen suosittu mutta kriitikkojen ei. Siksi tämä elokuva ilmiselvistä puutteistaan huolimatta ansaitsee lähemmän tarkastelun.

Kun yö saapuu on kanadalaisen Patricia Rozeman vuonna 1995 ohjaama ja kirjoittama äärimmäisen romanttinen kahden naisen rakkaustarina, joka valittiin aikoinaan yleisön suosikiksi mm. Berliinin elokuvafestivaaleilla. Mitä ilmeisemmin 1990-luvun puoliväli oli kuitenkin tällaisten eroottisen lesboutta käsittelevän elokuvan kannalta liian aikainen ajankohta jotta se olisi saavuttanut megasuosion. Mutta se on säilyttänyt kiinnostavalla tavalla pitkäaikaisen suosion katsojien keskuudessa paitsi sen kotimaassa Kanadassa sekä naapurimaa USA:ssa, myös Euroopassa, Japanissa ja mm. Lähi-Idässä (eteenkin internetin mahdollistavan yksityisyydensuojan takia) .

Rozeman itse myöhemmin totesi tehneensä elokuvan ”kieli poskella” eikä edes väittänyt pyrkineensä ”totuudenmukaisuuteen”. Joitakin poikkeuksia lukuun ottamatta aina omasta egostaan tietoiset tosikkomaiset elokuvakriitikot teilasivat elokuvan yleisesti juoneltaan ”lapsellisena” ja ”epäuskottavana”. Se sai NC17-luokittelun (kielletty alle 18-vuotiailta) mm USA:ssa ja sen 1990-luvun mittapuun mukaan ”voimakkaasti eroottisia” kohtauksia leikattiin. Lähes 20 vuodessa sen eroottisuuden suhteen ollaan jo hieman eri kannalla, nuivasti siihen suhtautuneet luokittelivat sen pehmopornoksi. Filmin teilaajat yleensä kuitenkin antoivat tunnustusta sen visuaalisuudesta, kauneudesta ja tietystä taiteellisesta virityksestä. Oikeastaan voimakkaan tosikkomaisen kriittisyyden sijasta elokuvaa pitäisi yhä tänään lähestyä toisesta lähtökohdasta. Esimerkiksi siten että se on eräänlainen kaunis satu lesboille ja biseksuaaleille siitä mitä lesborakkaus voisi kauniissa haaveissa olla. Unelmiahan tarvitaan kai aina. Keskeiset teesit elokuvassa ovat: halu, himo, aistillisuus, visuaalisuus, menettämisen pelko ja suoranainen tuskallinen pakahduttava halu omistaa ja tulla omistetuksi.

 

Camille, Petra ja Martin

 

Elokuva on perusteeltaan kolmiodraama. Camille Baker opettaa mytologiaa kristillisessä collegessa ja seurustelee komean ja mukavan kollegansa Martinin kanssa. Työpaikan konservatiivisessa ilmapiirissä heidän suhdettaan valvotaan ja pariskuntaa painostetaan menemään naimisiin. Molemmat ovat ns. uraputkessa. Camille ei kuitenkaan ole täysin varma tunteistaan. Jo heti elokuvan alussa sekä Martinin että Camillen seurustelusuhde paljastuu harmaaksi, värittömäksi - eräänlaiseksi mitäänsanomattomaksi korrektiudeksi – kaverisuhteeksi tai kumppanuudeksi. He ovat harmaita pukujaan myöten ja ehdollistettuja. Miljoonat elokuvan katsoneet voisivat helposti tunnistaa itsensä tässä kaksikossa.

Elokuvan alussa Camillen koira löytyy kuolleena. Koira on ollut se jota Camille on todellisuudessa rakastanut enemmän kuin ketään muuta. Pesulassa Camille tapaa sattumalta kauniin sirkuksessa työskentelevän Petran joka empaattisena ihmisenä lähestyy kuollutta koiraansa surevaa Camillea. Petra vaihtaa heidän pyykkinsä tahallaan saadakseen tavata Camillen uudestaan. Jo tässä toisessa kohtaamisessa syntyy intohimon, epävarmuuden ja pelon värittämä jännite aran Camillen ja kokeneen Petran välillä. Intohimoinen suhde toiseen naiseen ei kuitenkaan noudata ollenkaan sitä moraalikoodia jota Camille on tottunut seuraamaan ja kohta hänen onkin pakko tehdä valinta kahden rakastamansa ihmisen ja kahden erilaisen elämäntavan välillä.

Kuten niin tavallista myös Camillen ja Petran suhteessa peilautuu toisaalta voimakastahtoisen, intohimoisen dominoivan persoonan (Petra) ja toisaalta aran, hauraan, estoisen ja alistuneen persoonan (Camille) dialogi. Mutta tässä ei ole kaikki. Kiinnostavalla tavalla juuri Camille onkin se joka tekee elokuvan käänteentekevät aloitteet. Juuri hän suutelee ensiksi Petraa ja juuri hän tekee ensimmäisen aloitteen sukupuoliyhdynnästä. Voimakas, osin maskuliinisuutta ja tiettyä poikamaisuutta tihkuva Petra on ehkä suhteen kannalta se jolla on se kaikkein polttavin pelko siitä että ”lopulta kaikki menee aikanaan tavanomaiseksi”. ”Everything gets ordinary eventually”.

 

Camille: Miksi olet niin tappiomielialaan taipuvainen?

Petra: Katsos, minä olen rakastanut aiemminkin. Ja menettänyt.

 

Jos mikä on elokuvan keskeisin pelko sen naiskaksikoilla liittyy juuri tähän suhteen kääntymiseksi tavanomaiseksi. Petran kannalta se että hän ei tässä yhteiskunnassa saa omakseen naista jota hän rakastaa. Camille – ennen elokuvan loppuhuipentumaa – että hän menee ”tavanomaiseen” heteroparisuhteeseen eläen elämänsä siinä viitekehyksessä minkä hänen taustansa kalvinilaisen kristillisyyden kasvattamana on hänelle asettanut. Sillä tässä elokuvassa linja on valittu. Sen linjan mukaan lesbous edustaa vapautta ja kristinusko kahlitsevuutta. Camillen miesystävä Martin esitetään elokuvassa virkamiesrakkauden, hajuttomuuden ja värittömyyden ilmentymänä. Tällainen mies edustamassa heteroseksuaalista maskuliinisuutta varmistaa sen, että yksi jos toinenkin nainen muuttuu lesboksi ennätyksellisen nopeasti. Kuin pisteenä i:n päälle tietenkin miehen kristillisyys. Hyvin yleisesti uskontohan pidetään seksuaalisuutta ja aistillisuutta latistavana tekijänä vaikka esimerkiksi monet tarkasti näkevät taiteilijat voivat olla tästä hyvinkin eri mieltä.

 

Kristinusko ja sirkuselämä

 

Länsimaisen kulttuurin eräs tuntomerkki jo 1800-luvulta lähtien on ollut esittää kulttuurin ytimessä olleen kristinusko jos ei kaiken pahuuden alkuna ja juurena niin ainakin kaikenlaisen intohimon tuhoajana. Niin myöskin Kun yö saapuu-elokuvassa. Onko niin että meidän aikanamme yhä tarvitaan tällainen kärjistys jotta vastakkainasettelu voidaan esittää? Ikään kuin meidän maallistuneen valtakulttuurimme koko olemus itsessään ei olisi jo lattea, harmaa ja kaikenlaisen todellisen aistillisuuden tappaja kaikenlaisesta kvasiseksuaalisuudesta huolimatta. Puhumattakaan siitä että jopa kapinalliseksi aikanaan luokiteltu porno on aivan avutonta, konsanaan pahempi aistillisuuden tappaja kuin mikään fundamentalistinen uskonto, tuotteistettu, kyyninen, teollinen ja kylmä.

Joka tapauksessa elokuvassa ahdasmielisen, maallistumisen paineessa taistelevan kalvinilaisen kristinuskon ja toisaalta avantgardistinen sirkuselämän vastakkainasettelu on laitettu toimimaan toistensa peilinä. Oikeassa elämässä sirkuselämä taitaa vain olla huomattavan paljon harmaampi, ankeampi ja taloudellisestikin ahdistavampi. Kiinnostavalla tavalla elokuvassa tapahtuukin puolenvaihto kun sirkusyhteisön eräs jäsen Tory hyppää ns. ulos laivasta. Hän on nainen joka haluaa vakiintua sirkuselämästä jonka ”vapaus” ei sovi hänelle. Elokuvan lopussa Toryn ja Martinin katseet kohtaavat kahvilan ikkunan läpi. Se syntyykö kahden pettyneen/petetyn välille suhde sitä tämä elokuva ei kerro. Se kyllä ainakin tiedetään että tässä maailmassa nainen hakee puolisoa heterosuhteessa sellaisesta miehestä joka takaa taloudellisen turvan ja vakauden. Mitä vauraampi mies sitä kovempi kysyntä naisten keskuudessa. Itse kukin heteromies voi hyvällä syyllä miettiä millä muilla perusteilla kuin valtavalla omaisuudella joku Donald Trump nappaa itselleen hemaisevan mimmin muilta. Seksuaalisella vetovoimallako?

Elokuvassa kristinusko, tässä tapauksessa siis kalvinilainen suunta joutuu tukalaan tilanteeseen maallistuvan ajan haasteiden edessä. Se, että kristinusko joutuu aivan kohtuuttomaan asemaan yli tuhannen vuoden traditionsa kanssa homosuhteen hyväksymispaineen kanssa jää käsittelemättä kunnolla. Totta kai sellaiset ihmisryhmät ja poliittiset suunnat joilla ei ole tällaista traditiota takanaan/taakkanaan ovat helpommassa asemassa. Ihmisillä joilla ei ole ylipäätänsä mitään periaatteita voivat hypätä minkä tahansa muotiaatteen tukijoiksi. Homoseksuaalisuudesta onkin aatteellisesti kehittynyt todellista merkitystään huomattavasti elämää suurempi lyömäase jota käytetään kaikkialla maallistuneessa lännessä ns. traditionaalisen perheinstituution korvaamiseksi uudella.

Tässä kulttuurievoluutiossa alkuperäinen tarkoitus: ihmisarvoisen elämän mahdollistaminen seksuaalisille vähemmistöille näyttää vähitellen painuvan jopa taka-alalle todellisten niljakkaimpien (poliittisten) ambitioiden noustessa enemmän esille. Toki mahdollisuus päästä käsiksi esim. miljoonaperintöihin voi olla kiihoke joskin seksuaalisten vähemmistön valtava enemmistö tuskin on sen varakkaampaa porukkaa kuin heteroenemmistökään. Tällaiset asiat eivät varmasti ole homojen ja lesbojen ykköstavoitteita. Ylipäätänsä voidaan kysyä kuinka moni homo ja lesbo tuntee nykyisin jopa kiusaantumista kun heidän oma asiansa on tullut kaikenlaisten suvaitsevaisuudella keikaroivien poliittisten helppoheikkien suosikkiarsenaaleihin. Kuka heistä aivan oikeasti haluaisi olla jatkuvasti julkisuuden valokeilassa? ”Jättäkää meidät (heidät) rauhaan”.

 

Kaunis rakkaus

 

Se mistä Kun yö saapuu-elokuva ansaitsee tunnustusta liittyykin sitten nimenomaan sen aistillisuuden ja todellisen eroottisuuden esille nostamiseen. Se mikä on eroottista ja aistillista on tietysti makuasia. Tarvitaan kyllä melkoista kyynisyyttä, tiettyä halveksuntaa ja lesbofobiaa siltä mieheltä/naiselta joka viitsii elokuvan nähtyään väittää etteikö siinä esitetty kohtauksia joissa ei olisi ollut kauneutta. Etsimällä saa etsiä rakkauselokuvaa jossa olisi aistillisuuden suhteen onnistuttu yhtä hyvin tai paremmin. Ja nimenomaan tästä ovat hyvin monet sekä lesbonaiset että heteromiehet olleet samaa mieltä. Kuten aiemmin on jo mainittu on tutkimuksellista tietoa että lesboelokuvien seksillä on erittäin kiihottava vaikutus sekä naisiin että heteromiehiin. Tässä elokuvassa saavutettiin muutamissa kohtauksissa aivan huipputaso. Miksi?

Camillen ja Petran rakastelukohtauksissa murskataan kerrankin se länsimaisille filmeille tyypillinen ominaisuus: vauhtisokeus, suorittamispakko sekä todellisten tunteiden haihduttaminen. Se alkoi jo suudelmista. Se näkyi katseissa. Ja vaikka se ei koskaan näytellyt pääteemaa oman lisänsä siihen antoi Camillen suloinen vaaleaihoisuus ja Petran ihana tummaihoisuus. Kohtauksien eroottisuus johtuu juuri toisaalta arkuuden, pelon mutta myös intohimon, omistamisen ja vapaaehtoisen suloisen antautumisen yhdistelmästä. Kuinka hellästi, hitaasti, hyväillen ja varoen Petra riisui Camillen alastomaksi. Kuinka täydellinen oli Camillen halu antaa Petran tehdä hänelle hyvää ja omistaa hänet. Aika oli pysähtynyt. Oli vain kaunis rakkaus.

Kontrasti Camillen ja Martinin rakastelukohtaukseen oli valtava. Siinä kyse oli suorittamisesta. Oli kyse sitten kalvinilaisesta moraalikoodista tai sitten ehkä todennäköisemmin vain länsimaisen modernin yhteiskunnan suorituskeskeisyydestä – työn tekemisestä – joka tapauksessa heidän tapauksessaan ei ollut kyse mistään rakastelusta, todellisesta hellyydestä. Kyse oli työtehtävästä. Kuinka monta sataa miljoonaa tällaista suorituskeskeistä ”rakastelua” täyttää tämän päivän länsimaalaisten ”seksuaalisesta vapautumisesta” nauttimaan päässeiden ihmisten makuuhuoneet?

Tämä suorittamispakko opetetaan meille jo aikaisessa vaiheessa. Se tungetaan aivoihimme jo puberteetti-iällä. Paineet kasvavat. Ei ihme että epäonnistumiset lisääntyvät. Uruguaylainen kirjailija Eduardo Galeano kirjoittikin osuvasti 1990-luvulla että aivan kuten jalkapallossa ovat maalit vähentyneet ovat myös ihmisten elämässä orgasmit vähentyneet. Ja jos orgasmeja onkin, ne eivät ole komeita kuten eivät ole useimmat jalkapallo-otteluissa syntyneet maalitkaan vaikka selostajat käyttävät mitä tahansa euforisia superlatiiveja. Velvollisuus syrjäytti ilon. Harvardin liiketalouden tunneilla saatettiin vielä jopa 1970-luvulla opettaa tuleville liikemiehille sitä kuinka hyvä seksi antaa hyvän unen. Ei ole varmuutta vieläkö tätä ankaraa jesuiittamaista oppia jaetaan tulevaisuudentekijöillemme. Business as usual.

Camillen ja Petran rakkauden kuvaaminen herättää heteromiehen ajattelemaan sitä varsin konkreettista asiaa: miksi ylipäätänsä naiset voivat rakastaa miestä jos tämä mies ei kykene hellyydenosoituksessa ja tunnetasolla lähellekään siihen kuin nainen? Ja jo pelkästään niinkin konkreettisen asian kuin orgasmin suhteen nainen on aivan ylivoimaisessa asemassa. Voihan hän saada periaatteessa kymmenen kertaa orgasmin yön aikana kun taas miehen osalta tuollainen ei onnistu kuin äärimmäisen harvoilta ja valituilta sekä tietysti valehtelijoilta. Miten oireellista on myös se tutkimuksellinen tieto jonka mukaan useimmat naiset ovat orgasmin jälkeen hyvin onnellisia kun taas orgasmista sinänsä nauttinut mies hämmästyttävän usein ja pian, täysin luonnollisesti, muuttuu alakuloisemmaksi. Ikään kuin luonto itse olisi asettanut tällaisen eston miehelle.

Vielä 1980-luvun alussa esiintyi kiistanalaisia tutkimuksia jotka esittivät että lesbojen seksuaalinen elämä olisi hyvinkin olematonta, pelkkää yhteiseloa. Synnytettiin käsite "kuolemasta lesbojen vuoteessa". Jo silloin tutkimustuloksia kritisoitiin laajalti, sillä se perustui siihen virhekäsitykseen että aktien lukumäärä olisi sama kuin sukupuolielämän taso. Uusimmat tutkimukset ovat näet paljastaneet jotain aivan muuta. Lesbosuhteessa elävät saavat huomattavasti enemmän ja tiheämpään orgasmeja kuin heterosuhteessa elävät. Orgasmit ovat niin yleisiä että niitä pidetään jo itsestäänselvyytenä ja useimmat lesbot saavat useita orgasmeja aktin aikana. Lesbojen yhdyntöjen pituudetkin ovat aivan toista luokkaa kuin heteropareilla. Usein yli tunnin tai jopa 2-3 tuntia kun taas heteroseksin kesto on useimmiten huomattavasti alle puolen tunnin (10-20 minuuttia). Lesbot hyväilevät, koskettelevat, suukottelevat ja katsovat toisiaan enemmän kuin heteroparit mikäli amerikkalaiset ja australialaiset tutkimukset ovat uskottavia.

Nämä mittarit viittaavat siihen että lesbojen seksielämä olisikin tasokkaampaa kuin heteroparien (ja homomiesten).

 

Osa miehistä syrjäytyy

 

Kaipuu parisuhteeseen ja seksiin on ihmisen perustarpeita, vaikka se ei johtaisikaan enää perinteisen perheen perustamiseen. Mutta jos parisuhdetta – ja seksiä – kaipaavia sinkkuja on näin paljon, miksi etsivät eivät löydä toisiaan? Koska naisten potentiaalia kumppania koskevat kriteerit ovat kasvaneet, sanoo sukupuolijärjestelmiä tutkinut Henry Laasanen ja kärjistää:

”Aikaisemmin riitti, että miehellä on säännöllinen työ ja hän kykenee huolehtimaan itsestään ja perheestään. Enää tämä ei takaa menestystä parisuhdemarkkinoilla, mutta se ei välttämättä riitä mihinkään seksisuhdemarkkinoillakaan, koska sielläkin vaatimukset ovat koventuneet.”

Laasasen mukaan yhä useampi ”kunnon mies” jää yksin, osa pysyvästi – eikä kaikille naisillekaan riitä sellaisia kumppaneja, joita nämä etsivät, koska etsintä keskittyy ”parhaaseen A-ryhmään”.

Kaukana on jo se aika jolloin vaatimattominkin heteromies löysi kumppanin pariutumismarkkinoilta. Sodasta palasi ikäluokat joissa vaje oli 10% tai jopa 15%. Tällainen asetelma suosi miehiä ja muokkasi vanhempien suomalaisten asenteita. Suuri käänne tapahtui seuraavan sukupolven aikana kun luonnollinen tasapaino saavutettiin ja kun naisten koulutustaso ohitti miesten vastaavan ja he siirtyivät työelämään.

Henry Laasasen teesit on otettu vastaan ristiriitaisesti, osin pilkallisestikin vaikka niille on olemassa vankat perusteet. Tietyn miesryhmän tilannetta pahentaa myös tekijä joka ilmenee edellä mainituissa uusissa amerikkalaistutkimuksissa: naiset ovat miehiä edullisemmassa asemassa sillä heillä on miehiä selvästi suurempi kyky laajentaa omaa seurustelureviiriään radikaalista. He voivat rakastua aivan yhtä hyvin sekä miehiin että toisiin naisiin. Tällaiselle kehityskululle on olemassa naisten kognitiivisten ominaisuuksien lisäksi muitakin suotuisia edellytyksiä.

Aikana jolloin naisten riippumattomuus miehistä on kasvanut huomattavasti on jokseenkin varmaa että yhä useampi nainen ei enää välttämättä tunne pakottavaa tarvetta hakea suhdetta miehistä. Spermapankkien ja keinohedelmöitysten aikana ei edes suvunjatkaminen vaadi perinteistä miehen ja naisen välistä suhdetta. Rinnan tämän lääketieteen aiheuttaman mullistuksen kanssa etenee tietyn miesjoukon – ehkä 10-20% - lyöminen ulos sekä työ- että avioliittomarkkinoilta. Suuri joukko ”jätkiä” tarvitsevia ammatteja on tuhoutunut lyhyessä ajassa. Työelämän muutokset suosivat toisenlaista miestyyppiä.

On jokseenkin turhaa enää edes yrittää ylläpitää käsitystä naisesta ”heikkona astiana”. Sitä hän ei todellisuudessa ole koskaan ollutkaan. Koko käsitys on miesten kehittelemä ja toisaalta naiset ovelasti ovat osanneet tätä myös hyödyntää. Naiset ovat monessakin mielessä miehiä voimakkaampia. He elävät pitempään, kestävät kipua ja tuskaa paremmin kuin miehet. He ovat harkitsevampia, eliminoivat suuret riskit paremmin mutta samalla ovat myös emotionaalisesti paremmin kehittyneitä. Yhteiskunnan suurimmista epäonnistujista ylivoimainen enemmistö, ehkä yli 90% on juuri miehiä. Ellei naiset evoluutiokehityksessä ja mm. työelämässä muutu sitten ”jätkämäisiksi”. Tällaisiakin merkkejä on havaittavissa.

Naisilla on joka tapauksessa miehiä paremmat sosiaaliset verkostot ja he ovat kiistatta miehiä parempia ilmaisemaan tunteitaan. Naisten hellyydenosoitukset toisiaan kohtaan ovat hyväksyttävämpiä kuin miesten vastaavat miehiä kohtaan. Mutta ennen kaikkea: mies ei kykene laajentamaan pariutumisreviiriään kuten nainen. Vain homomies tuntee seksuaalista vetovoimaa samaa sukupuolta olevaa henkilöä, toista miestä kohtaan. Sen sijaan nainen, hän joka luuli olleensa hetero (ja ehkä onkin, sitähän ei siis pystytä enää varmuudella toteamaan), huomaakin eräänä päivänä rakastuneensa toiseen naiseen, tuntevansa tätä kohtaa intohimoa, palavaa rakkautta sekä valmiutta osoittaa sen hänelle. Viimeistään sitten ”kun yö saapuu”. Tämä naisten miehiä ylivertaisempi emotionaalinen kyky pariutua ihmisen, ei sukupuolen kanssa voi mullistaa kulttuuriamme enemmän kuin on tähän asti ajateltukaan.

 


( Päivitetty: 25.03.2014 13:20 )

 - pelontorjunta | Kommentoi



 Kun raha alkoi menettää valtaansa – ihmiskunnan matka kohti ilmaistaloutta
28.02.2014 17:38 | pelontorjunta

Vuonna 1971 informaatioajan aamunkoitossa sosiaalitieteilijä Herbert Simon kirjoitti:

”Informaatiosta rikkaassa maailmassa informaation runsaus tarkoittaa jonkin muun niukkuutta : kaiken sen niukkuutta, jota informaatio kuluttaa. On melko ilmeistä, mitä informaatio kuluttaa: se kuluttaa vastaanottajien huomiokykyä. Niinpä informaation runsaus synnyttää huomion niukkuutta.”

Simon havainnoi taloustieteen ehkä vanhimman säännön ilmentymistä: ”Jokainen runsaus luo uuden niukkuuden.” Meillä on taipumus antaa suurin arvo sille, mitä meillä ei ole runsain mitoin. Se pätee jokaiseen erinomaiseen asiaan, joka nousee halpojen paljoushyödykkeiden merestä ulottuen hienosta ruoasta muotoilluissa pulloissa myytyyn veteen.

Abraham Maslow totesi vuonna 1943 ilmestyneessä uraa uurtavassa artikkelissaan ”Ihmisen motivaation teoria”:

”On täysin totta, että ihminen elää yksinomaan leivästä kun leipää on vähän. Mutta mitä tapahtuu ihmisen haluille, kun leipää on runsaasti ja kun hänen vatsansa on kroonisesti täynnä?”

Hänen nykyään maineikkaaseen ”tarpeiden hierarkiaan” perustuva vastauksensa oli seuraava: ”Muita (ja korkeimpia) tarpeita ilmenee välittömästi ja fysiologisten nälkien asemasta nämä hallitsevat eliötä.” Hänen pyramidinsa pohjalla ovat fyysiset tarpeet, kuten ruoka ja vesi. Niiden yläpuolella on turvallisuus. Seuraava taso on rakkaus ja kuuluminen, sitten arvostus ja huipulla on viimein ”itsensä toteuttaminen” luovuuden kaltaisilla merkityksellisillä pyrkimyksillä.

Samanlainen hierarkia soveltuu informaatioon. Kun perustiedon ja viihteen tarpeemme ovat tyydytetyt, alamme suhtautua valikoivammin siihen, mitä tietoa ja viihdettä oikeastaan haluamme, ja tässä prosessissa opimme itsestämme ja käyttövoimastamme enemmän. Lopulta monet muuttuvat passiivisista kuluttajista aktiivisiksi tuottajiksi, joita motivoivat luomisen psyykkiset palkinnot.

 

Huomio- ja mainetalous

 

Normaalisti kuluttajamarkkinoilla rahan niukkuus auttaa meitä suunnistamaan tarjolla olevassa tuotteiden runsaudessa – ostamme vain sen mihin meillä on varaa (luottokorteista huolimatta). Tällä tavalla myös kapitalismi ”pitää kirjaa” kulutuskysynnästä ja seuraa millaisia hintoja kuluttajat ovat valmiita maksamaan. Mutta mitä tapahtuu verkossa, missä yhä useammat tuotteet on koodattu ohjelmistoon ja jotka voidaan sen seurauksena tarjota ilmaiseksi? Raha ei ole enää markkinoiden tärkein signaali. Sen tilalle tulee kaksi ei-rahallista tekijää.

Näitä kahta sanotaan usein ”huomiotaloudeksi” ja ”mainetaloudeksi”. Huomion ja maineen markkinoinnissa ei ole tietenkään mitään uutta. Jokainen tv-ohjelma joutuu kilpailemaan ensimmäisessä taloudessa ja jokainen tuotemerkki toisessa. Julkisuuden henkilö rakentaa maineen ja muuttaa sen huomioksi. Verkkokokemuksessa ainutlaatuista on näiden kahden mitattavuus ja miten ne muuttuvat päivä päivältä todellisen talouden kaltaisiksi.

Mikä määrittelee ”talouden”? 1700-luvun puoliväliin saakka ”taloutta” käytettiin lähinnä politiikan ja lain piirissä. Adam Smith kuitenkin antoi termille modernin merkityksen, kun hän määritteli taloustieteen markkinoiden tutkimukseksi, erityisesti muodossa jonka ilmaisemme nykyään lyhyesti ”valinnan tieteeksi niukkuuden vallitessa”.

Nykyään taloustiede tutkii muutakin kuin rahallista markkinoita. 1970-luvulta lähtien on syntynyt käyttäytymistaloustieteen ja ”neurotaloustieteen” kaltaisia erikoisaloja, jotka pyrkivät selittämään, miten ihmiset päättävät kokemiensa kannusteiden perusteella. Huomio ja maine ovat usein näiden alojen osio, vaikka niitä ei olekaan muodollisesti määritelty markkinoiksi.

Entä jos huomiota ja mainetta voitaisiin käsitellä yhtä kvantitatiivisesti kuin rahaa? Entä jos voisimme muotoilla ne asianmukaisiksi markkinoiksi ja voisimme selittää jae ennustaa ne monilla samoista yhtälöistä, joita taloustieteilijät käyttävät perinteisissä rahallisissa talouksissa? Sen onnistumiseksi huomiolla ja maineella tulisi olla samat piirteet kuin muilla valuutoilla: niiden tulisi olla mitattavia, äärellisiä ja vaihdettavia.

Nyt päästään jo lähelle tätä sen ansiosta , että Tim Berners-Lee loi modernin hyperlinkin v. 1989. Sen on yksinkertainen asia, pelkkä merkkijono, joka alkaa ”http://”, mutta se synnytti muodollisen kielen huomion ja maineen vaihdolle ja molempien valuutat. Kun nykyään muodostaa blogillaan linkin jonkun kanssa, vastapuolelle annetaan käytännössä hieman omaa mainetta. Eräässä mielessä omalle yleisölle sanotaan:

”Jätä minut. Mene tähän toiseen paikkaan. Luulen, että pidät siitä, ja jos niin käy, kenties arvostat minua enemmän, kun suosittelen sitä. Ja jos arvostat minua enemmän, kenties palaat sivustolleni useammin.”

Ihanteellisessa tilanteessa tällaisen maineen siirron jälkeen kumpikin osapuoli on rikkaampi. Hyvät suositukset kasvattavat lukijakunnan luottamusta ja suosituksen kohteena olemiseenkin liittyy luottamusta ja suosituksen kohteena olemiseenkin liittyy luottamusta. Ja luottamuksen mukana tulee lukijoita.

Jo vuosia todellisen maineen kauppapaikan nimi on ollut Google. Mitä muuta verkon mainevaluuttaa on kuin GooglePageRank-algoritmi, joka mittaa tulevat linkit, jotka määrittävät mielipideverkoston, joka on www. Ja mikä on parempi huomion mitta kuin verkon liikenne?

Talouden kielellä ilmaisten vaihdamme mainetaloudesta huomiotalouteen ja käteiseen seuraavalla kaavalla: Sivustosi taloudellinen arvo on liikenne, jonka PageRankisi (yhden ja kymmenen väliin sijoittuva luku) tuo tiettyä termiä koskevan Google-haun tuloksista kerrottuna tämän termin avainsana-arvolla. Ja liikenne voidaan muuntaa vanhaksi kunnon käteiseksi yksinkertaisesti ajamalla sivustolla AdSense-mainoksia ja jakamalla tulot Googlen kanssa.

Elämme nykyään Google-taloudessa ainakin osan elämäämme pidämme siitä tai emme. Tyypillisellä sivustolla 25-50% kaikesta liikenteestä tulee Google-hauista. Kokonainen ”hakukoneoptimointi”-niminen teollisuudenala on syntynyt auttamaan sivustoja lisäämään näkyvyyttä Googlen silmissä. PageRank on maineen kultakanta. Googlen johtoryhmä rukkaa alinomaa algoritmia säädellen rahavarantoja. Verkon kasvaessa he välttävät PageRankin ”inflaation” tekemällä siitä vaikeamman ansaita. Jos he havaitsevat PageRank-väärennöksiä, kuten roskalinkkejä, se säätävät algoritmin poistamaan ne liikenteestä. He pitävät valuuttansa arvoa yllä pyrkimällä pitämään hakutuloksensa olennaisempana kuin kilpailijoiden tulokset , ja se säilyttää Googlen markkinaosuuden (nykyisin n. 70%). Alan Greenspanin (entinen USA:n keskuspankin FED:n johtaja) työ ei paljoa poikennut tästä.

Googlessa on huomattu nykyisten todellisten keskuspankkiirien tapaan, että yhden valuutan säätely on kaukana koko talouden säätelystä. Googlea voidaan pitää verkon USA:na – se on vain monista maine- ja huomiotalouksista suurin. Se ei ole suljettu talous, koska se on vain osa suurempaa verkkotaloutta. Ja sen ympärillä on lukemattomia muita maine- ja huomiotalouksia, joilla kullakin on oma valuuttansa. Facebookilla on ”kaverit”, Twitterillä ”seuraajat”, Slashdotilla ”karma” jne. Kukin käyttäjä voi päätellä miten se muutetaan rahaksi, jos sitä haluaa (useimmat eivät sitä edes halua), mutta huomion ja maineen kvantifiointi on nykyään globaalia toimintaa.

Verkossa nämä taloudet elävät rinnakkain ja nousevat ja laskevat huomion vuoroveden mukana. Vaikka ne haluavat säädellä mainetta kokonaisuudessaan, ne eivät siihen pysty. On myös kasvava suljettujen verkkotalouksien luokka, jossa keskuspankkiireilla on paljon enemmän valtaa. Ne ovat verkkopelejä, kuten Warhammer ja Lineage, jotka tyypillisesti käyttävät kahta valuuttaa: huomiovaluuttaa, jossa pelaajat ansaitsevat lumerahaa pelatessaan, ja todellista rahaa, jolla he voivat ostaa lumerahaa, elleivät halua käyttää aikaansa sen hankkimiseen. Pelit kohtaavat niukkuuksista suurimman: ajan. Nuoremmilla pelaajilla on aikaa mutta vähemmän rahaa. Vanhemmilla rahaa muttei aikaa. Nuoremmat pelaajat voivat kerätä huomiota klikkauksillaan. Vanhemmat voivat ostaa oikoteitä. Pelien suunnittelijat yrittävät tasapainottaa nämä kaksi oikealla tavalla, jotta pelaajat pystyvät kilpailemaan ja etenemään kummallakin tavalla. Ja kun suunnittelijat toimivat näin, he luovat samalla muutamia historian kvantifioiduimmista ei-rahallisista talouksista.

 

Lahjatalous

 

Vuonna 1983 julkaisi sosiologi Lewis Hyde kirjan The Gift (Lahja). Se oli ensimmäisiä kirjoja, jotka pyrkivät selittämään ihmisen ehkä vanhimman sosiaalisen perinteen mekanismin: tavaroiden antamisen maksutta. Hän keskittyi lähinnä Tyynenmeren saarille ja muihin ”alkuperäisyhteisöihin” jotka eivät olleet omaksuneet muodollisia rahatalouksia. Siellä asema saavutettiin niissä lahjojen vaihdoilla ja rituaaleilla, siis rahan kulttuurisilla vastineilla.

Monilla näistä kulttuureista oli runsaasti luonnonvaroja – ruokaa puissa – joten luonto huolehti niiden perustoimeentulosta. Tästä syystä ne pystyivät nousemaan Maslowin pyramidia ja keskittymään sosiaalisiin tarpeisiin. Joissakin Pohjois-Amerikan alkuperäiskansojen heimoissa lahjaan liittyvä hiljainen sääntö oli, että se velvoitti vastalahjaan (”lahjan palauttamiseen”). Lahjoja ei myöskään saanut pitää, vaan sen sijaan ne oli annettava lahjana uudelleen joillekin muille (”lahjan on aina liikuttava”). Nykyään pidämme termiä ”intiaanin lahja” (eli vastalahjan odottaja) halventavana, mutta se perustuu Hyden havaintoihin: Näissä kulttuureissa lahjaa ei oikeastaan voinut pitää. Sen sijaan se oli hyvän tahdon ilmaus ja se pysyi tällaisena vain, jos se kiersi jatkuvasti.

Hyde keskittyi lähinnä lahjatalouksiin , joissa vaihdettiin tavaroita eli todellisia esineitä. Aina on myös ollut paljon suurempi tekojen lahjatalous, jossa toisille tehdään palveluksia maksutta. Samaan tapaan kuin huomio- ja mainetaloudet, myös tämä utuinen lahjatalous on yhtäkkiä tullut kirkkaaksi ja mitattavaksi, kun se siirtyy verkkoon.

Perinteisessä mediamaailmassa, ihmiselle on maksettava kirjoittamisesta. Jokin on kuitenkin muuttunut. Aktiivisten blogien määrä ylitti 12 miljoonan rajan vuonna 2009 ja kasvu näyttäisi jatkuvan. Vain muutama tuhat heistä (vähintäin kerran viikossa kirjoittavat) saavat kirjoittamisestaan palkan. Suuntaus näkyy kaikkialla Amazonin amatöörien tuotearvioista ulottuen elokuvaharrastajiin, jotka ovat tehneet IMDB:stä maailman kattavimman elokuvia ja elokuvan tekijöitä koskevan informaatiokokoelman.

Tässä ei ole mitään uutta, sillä ihmiset ovat aina luoneet ja osallistuneet ilmaiseksi. Aikaisemmin heidän tekemisiään ei sanottu ”työksi”, koska siitä ei maksettu, mutta aina kun antaa ilmaisen neuvon tai ryhtyy vapaaehtoiseksi johonkin, tekee asian, joka toisessa yhteydessä olisi jonkun toisen työtä. Nyt ammattilaiset ja amatöörit ovat yhtäkkiä samoilla huomiomarkkinoilla, ja nämä rinnakkaiset maailmat kilpailevat keskenään. Ja amatöörejä on paljon enemmän kuin ammattilaisia.

Mikä motivoi amatöörien luovuutta, jos ei raha? Monet olettavat, että lahjatalouden käyttövoima on lähinnä anteliaisuus, mutta kuten Hyde havaitsi Tyynenmeren saarten asukkaista, tilanne ei yleensä ole vain näin altruistinen. Adam Smith oli oikeassa: Valistunut oma etu on ihmiskunnan vahvin voima. Ihmise tekevät asioita ilmaiseksi pääasiassa omista syistään: Huvin vuoksi, koska heillä on jotain sanottavanaan, koska haluavat ihmisten kiinnittävän huomion heihin, koska haluavat omien näkemystensä huomioon ottamista ja lukemattomista erittäin henkilökohtaisista syistä.

Vuonna 2007 O'Reilly Mediassa työskentelevä päätoimittaja Andy Oram tutki käyttäjien tuottaman dokumentoinnin hämmästyttävää valikoimaa ohjelmistojen, laitteiston ja pelien käyttöohjeita, jotka menevät paljon alkuperäisten tuottajien tekemiä pitemmälle ja pohti, mikä motivoi ihmiset tekemään ne. Hän jatkoi selvitystään vuoden verran ja taulukoi sen jälkeen tulokset. Johtava syy oli ”yhteisö” eli ihmiset tunsivat kuuluvansa yhteisöön ja halusivat panostaa sen elinvoimaan. Toinen oli ”henkilökohtainen kasvu” , joka tuo mieleen Maslowin korkeimman tason, itsensä toteuttamisen. Kolmanneksi nousi ”keskeinen tuki”, mikä viittaa siihen, että monet tällaiset työntekijät ovat ”asiantuntijoita”, kuten sosiologit sanovat: asioista tietäviä ihmisiä, jotka nauttivat tietojensa jakamisesta. Mielenkiintoisella tavalla maine ei noussut kovinkaan korkealle Oramin selvityksen motiivien joukossa. Mistä ihmiset ottavat ajan? Siitä etteivät he tee jotain muuta eli luopumalla asioista, joista eivät koe saavansa sosiaalisia ja emotionaalisia palkintoja.

Elämme maailmassa, jossa ruoka, turva ja muut Maslowin perustarpeet tyydytetään siten, ettemme enää raada pellolla aamusta iltaan. Alamme huomata, että meillä kognitiivinen ylijäämä”, kuten sosiologit sanovat, siis energiaa ja tietoa, jota työmme ei täysin hyödynnä. Samalla meillä on emotionaalisia ja älyllisiä tarpeita, joita työ ei täysin tyydytä. Saamme arvostamallamme alalla tekemästämme ”ilmaisesta työstä” kunnioitusta, huomiota, ilmaiskeinon ja yleisön.

Sanalla sanoen olemme usein onnellisempia, kun teemme palkatta meitä miellyttäviä asioita, kuin tehdessämme palkkatyötä. Meidän on edelleenkin syötävä, mutta kuten Maslow osoitti, elämään kuuluu myös muutakin. Tilaisuus vaikuttaa tavalla, joka on sekä luova että arvostettu, on täsmälleen sellaista tyydytystä jonka Maslow asetti kaikkien muiden pyrkimysten yläpuolelle ja jota palkkatyö hyvin harvoin antaa. Ei siis ihme että tietoverkko räjähti vapaaehtoistyön vaikutuksesta: sen asiosta ihmiset olivat onnellisia luovuudestaan, osallistuessaan, vaikuttaessaan ja saadessaan tunnustusta jonkin asiantuntijana. Tällaisen ei-rahallisen tuotantotalouden mahdollisuus on yhteiskunnassamme satojen vuosien ajan odottaen sen täysin toteuttavien sosiaalisten järjestelmien ja työkalujen ilmaantumista. Verkko antoi nämä työkalut ja yhtäkkiä syntyivät ilmaisen vaihdon markkinat.


 - pelontorjunta | Kommentoi



 ”Me teemme mitä me tahdomme” (NSA - Osa 1)
10.01.2014 17:12 | pelontorjunta

NSA (National Security Agency, Kansallinen turvallisuusvirasto) on maailman suurin signaalitiedusteluorganisaatio. Organisaation keskeisin tehtävä on vastata Yhdysvaltain signaalitiedustelusta (SIGINT). NSA on myös maailman suurin teollisuusvakoilua harjoittava organisaatio. Esimerkiksi operaatio "Black Pearl" puitteissa NSA vakoilee Brasilian valtion omistamaa öljy-yhtiö Petrobrasia ja kiinalaista telejättiä Huaweitea.NSA:n keräämistä vakoilutiedoista hyötyy mm. ruotsalainen Ericsson ja Yhdysvaltojen telealan yritykset. Tiedot perustuvat Edward Snowdenin paljastusasiakirjoihin.

Lähde: (svt.se 7.12.2013)

Mikään muu organisaatio ei harjoita niin mielivaltaista, laajaa ja perusteetonta tietoliikenteen salakuuntelua kuin NSA. NSA:n suorittama tietoliikenteen vakoilu (arjen elektroninen valvonta) on niin mittavaa, että se horjuttaa väistämättä vallan tasapainoa ja vaikuttaa kaikkialla maailmassa kansalaisten maailmankuvaan ja käsitykseen yksityisyyden suojasta.Ilman amerikkalaisten teknologiayritysten ja eurooppalaisten tiedustelupalveluiden vahvaa myötävaikutusta, NSA:n harjoitama globaali verkkovakoilu ei olisi mahdollista.

 

Historia

 

NSA:n edeltäjänä toimi AFSA (Armed Forces Security Agency), joka perustettiin 20.5.1949. Sen tarkoituksena oli koordinoida viranomaisten välistä sähköistä viestintää ja erityisesti Yhdysvaltain asevoimien yksiköiden välistä tiedonvaihtoa.Eri virastojen välisen kilpailun johdosta tehtävästä muodostui kuitenkin erittäin vaikea, koska AFSA:lta puuttui koordinointimekanismi. CIA:n johtaja Walter Bedell Smith esitti 10.12.1951 AFSA:n korvaamista tiedustelupalvelulla. Ehdotus hyväksyttiin 13.6.1952. Yhdysvaltain presidentti Harry S. Trumanin myöntämillä oikeuksilla NSA muodostettiin 24.10.1952. Virallinen perustamispäivä on 4.11.1952.

Erityisesti 1960- ja 1970-luvuilla tehdyt vakoilutoimet keskittyivät erityisesti Yhdysvaltain hallinnon toimia kritisoiviin ihmisiin. NSA seurasi Vietnamin sotaan kriittisesti suhtautuvien kansalaisaktivistien ja toimittajien tekemisiä. NSA:n vakoiluohjelma koodinimeltään Minaret alkoi vuonna 1967 ja päättyi vuonna 1973. Vakoiluohjelman puitteissa NSA salakuunteli mm. ihmisoikeusaktivistien puhelimia. Salakuuntelun kohteina olivat mm. kansalaisaktivistit kuten ammattinyrkkeilijä Muhammad Ali, ihmisoikeustaistelija Martin Luther King, New York Timesin journalisti Tom Wicker, Washintong Postin kolumnisti Art Buchwald sekä kaksi senaattoria: Frank Church ja Howard Baker.

Lähde: (hs.fi 26.9.2013, Edward Snowden paljastusasiakirjat)
 

Digitaallinen vallankumous ja NSA:n tunkeutuminen internetiin

 

NSA koki olevansa kriisissä 1990-luvun lopulla, kun se havaitsi, että viestintä digitalisoitui ja ilman näitä tietoja NSA oli sokea. NSA ryhtyi palkkaamaan ISP-palveluntarjoajien henkilökunnasta asiantuntijoita itselleen ja hankkimaan omistuksia digitaaliseen viestintään ja tiedonlouhintaan keskittyneistä korkean teknologian organisaatioista.

Useimmat teknologiayritykset ovat huomattavasti halukkaampia yhteistyöhön NSA:n kanssa, kuin kertovat julkiuuteen. Yleisöllä oli käsitys, että esimerkiksi Skypen VoIP-puhelut ovat tavanomaisia turvallisempia, koska ne eivät ole perinteisiä puheluita ja siirtyvät IP-verkossa.

Vuonna 2008 käynnistyi kuitenkin Skypen salainen ohjelma, koodinimi oli Project Chess (Project Shakki). Projekti perustettiin tutkimaan oikeudellisia ja teknisiä kysymyksiä, joiden perusteella Skypen viestintäpalvelujen salakuuntelu olisi Yhdysvaltain lainvalvonta- ja turvallisuusviranomaisille tavanomaista helpompaa. Presidentti George W. Bush toimeenpani muutoksia vuoden 2001 WTC terrori-iskun jälkeen, jotka mahdollistivat kaiken tietoliikenteen valvonnan NSA:lle.

Vuonna 2013 NSA:n budjetti oli 10.45 miljardia dollaria, josta kasvua vuodesta 2012 oli 3 %. NSA:n palveluksessa oli 22 995 siviilihenkilöä, joista vammaisia henkilöitä 1 853. Tiedot ilmenevät FOIA (Freedom of Information Act) lainsäädännön perusteella annettuun vastauskirjeeseen. FOIA lainsäädännössä säädetään yleisesti yksityishenkilöiden oikeuksista saada tietoja liittovaltioiden virastojen asiakirjoista.

Lähde: (Vastauskirje Mr. Zachary M. Lassiterin tietopyyntöön, FOIA case: 72040 18.6.2013)

Yhdysvaltojen tiedusteluvirastojen 1452-sivuisesta talousarviosta ja 178-sivuisesta budjetin yhteenvedosta ilmeni, että NSA:n henkilömäärä oli vuonna 2013 oli 21 575 henkilöä eli 1420 henkilöä vähemmän kuin edellä mainitussa vastauskirjeessä Mr. Lassiterille.

Lähteet: (theguardian.com 29.8.2013, washingtonpost.com 29.8.2013)

Lisäksi NSA:lla oli yli 80 strategista yhteistyökumppania, jotka edustivat maailman suurimpia tietokoneiden, käyttöjärjestelmien ja sovellusten valmistajia sekä Internet-palveluiden, televiestinnän, ja verkkoinfrastruktuurin palveluntarjoajia.

Tiedot ilmenivät 1452-sivuisesta talousarviosta ja 178-sivuisesta budjetin yhteenvedosta (Edward Snowden paljastusasiakirjat 2013).

Lähteet: (theguardian.com 29.8.2013, washingtonpost.com 29.8.2013)

NSA:n johtaja Keith Alexander ilmoitti tietokoneturvallisuuskokouksessa New Yorkissa torstaina 8.8.2013, että NSA tulee leikkaamaan rajusti työntekijöiden määrää, automatisoimaan mahdollisimman paljon toimintojaan ja supistamaan tietojärjestelmiä ylläpitävien ihmisten määrästä noin 90 prosenttia.

NSA:lla oli kaikkiaan noin 1000 järjestelmänvalvojaa. Samalla karsitaan salaisiin tietoihin oikeuttavia käyttövaltuuksia. Keith Alexanderin mukaan tietovuotojen riski vähenee, jos nykyistä pienempi joukko henkilöitä käsittelee tietojärjestelmiä.

Lähteet: (daily-times.com 8.8.2013, rt.com 9.8.2013, lasvegassun.com 8.8.2013)

NSA on seulonut maailmanlaajuisesti yhden kuukauden aikana noin 124,8 miljardia puhelua ja tekstiviestiä sekä 97,1 miljardia sähköpostia (Edward Snowden paljastusasiakirjat 2013).

NSA:n johtajat


Ralph J. Canine 1952 - 1956

John A. Samford 1956 - 1960

Laurence H. Frost 1960 - 1962

Gordon A Blake 1962 - 1965

Marshall S. Carter 1965 - 1969

Noel A. M. Gaylor 1969 - 1972

Samuel C. Phillips 1972 - 1973

Lew Allen Jr. 1973 - 1977

Bobby Ray Inman 1977 - 1981

Lincoln D. Faurer 1981 - 1985

William E. Odom 1985 - 1988

William O. Studeman 1988 - 1992

John M. McConnell 1992 - 1996

Kenneth A. Minihan 1996 - 1999

Michael Hayden 1999 - 2005

Keith B. Alexander 2005 -


NSA on globaali toimija

 

Signaalitiedustelun avulla NSA kerää, analysoi ja välittää tiedustelutietoja terrorismin torjumiseksi ja sotilasoperaatioiden tukemiseksi sekä salakuuntelee verkkoliikennettä. NSA pelkää, että internetistä muodostuu Yhdysvaltoja uhkaavien rikollisten ja terroristien turvasatama. Se otti internetin globaaliin valvontaansa ja ryhtyi kehittämään suurella rahalla tietoliikenneverkon vakoiluohjelmia (seuranta- ja analysointiohjelmia). Tavoitteena oli Yhdysvaltojen ehdoton kyberkontrolli ja -johtajuus.

Salakuunteluohjelmien toiminnan mahdollistavat NSA:n kumppaneina toimivat yhdysvaltalaiset kansalliset teleoperaattorit, eri maissa toimivat kansalliset teleoperaattorit, yhdysvaltalaiset yritykset sekä muut yritykset ympäri maailmaa. Laaja kumppanuusverkosto mahdollistaa NSA:n pääsyn myös kansallisvaltioiden tietoliikennejärjestelmiin ja niiden tietoliikenteen ohjauksen NSA:n tietojenkäsittelykeskuksiin.

Salakuuntelun lisäksi NSA:n vastuulla on myös kansallisesti tärkeiden tietojärjestelmien ja turvaluokiteltujen tietojen turvaaminen, salausalgoritmien kehittäminen ja salattujen viestien purkaminen. Yhdysvaltain lainsäädännön perusteella NSA voi salakuunnella viestiliikennettä Yhdysvaltain ulkopuolella ja Yhdysvaltoihin tulevaa viestiliikennettä.

NSA on kiinnostunut keskeisten poliittisten vaikuttajien puhelinnumeroista ja sähköpostiosoitteista. Valtioiden päämiesten salaiset puhelinnumerot tulevat NSA:lle pääsääntöisesti Valkoisen talon ja Pentagonin virkamiehiltä. Osa salakuunneltavista puhelinnumeroista on saatavissa myös julkisista lähteistä.

Eräs nimeämätön amerikkalainen virkamies oli luovuttanut NSA:lle 200 puhelinnumeroa, johon sisältyi 35 keskeisen vaikuttajan puhelinnumerot. NSA liitti numerot rutiininomaisesti seurattavien listalle. Tiettävästi mitään merkittävää tietoa NSA ei ole onnistunut päämiesten puhelimia salakuuntelemalla hankkimaan.

 

NSA:n tietojenkäsittelykeskus

 

NSA:n uusi tietojenkäsittelykeskus Utah Data Center valmistui syyskuussa 2013. Se sijaitsee Utahissa, Utah järven ja Ison Suolajärven välissä.

Data Center on mitoitettu käsittelemään erittäin suuria tietomääriä. Se pystyy käsittelemään kaikki sähköisen viestinnän muodot kuten mm. valokuvat, videot, pikaviestit, sähköpostiviestit, puhelut, internet-haut ja some viestinnän.

Kooltaan rakennus on 1,5 miljoonaa neliömetriä, josta noin 10 0000 neliömetriä on tietojenkäsittelylaitteille varattua tilaa ja yli 900 000 neliömetriä teknistä tukea ja hallinnolliset tilaa. Laitoksen energiatarve on noin 65 megawattia ja kustannus noin 40 miljoonaa dollaria vuodessa.

 

NSA rikkoo säännönmukaisesti Yhdysvaltain lainsäädäntöä

 

Yhdysvallat keskittyy siihen miten hallitukselle epämiellyttävät ihmisoikeusrikosten paljastajat saadaan kiinni. Ei siihen, miten itse rikosten tekijät saadaan kiinni. Yhdysvalloilla ei ole minkäänlaisia aikomuksia supistaa salakuuntelu- tai tarkkailuohjelmiensa määrää tai niiden laajuutta.

Vuoteen 2013 mennessä NSA on rakentanut Yhdysvaltoihin salakuunteluverkoston, jonka kattavuus oli noin 75 prosenttia maan internet-liikenteestä. Puhelinkuuntelu käynnistyy, jos Yhdysvalloista soitetaan ulkomaille tai jos ulkomailta soitetaan Yhdysvaltoihin. Lisäksi seurannassa on rutiininomaisesti kaikkien ulkomaisten tiedustelupalvelujen ja edustustojen puhelinliikenne.

Tietoliikenneverkoissa tapahtuvaa liikennettä seurataan useilla tavoilla ja valvontaohjelmilla kuten Blarney, Fairview, Oakstar, Lithium ja Stormbrew koodinimillä tunnetuilla ohjelmilla. Niiden avulla suodatetaan ja kerätään tietoja suurilta kansallisilta teleoperaattoreilta.

Yhdysvaltain koko tietoliikenneteollisuus on valjastettu tekemään yhteistyötä NSA:n kanssa kuten mm. Narus Inc, Cisco Systems Inc ja Juniper Networks Inc. Näiden valmistamia tietoliikennelaitteita on käytössä mm. Suomessa eri yrityksissä ja julkishallinnon organisaatioissa.

Tietoverkkoihin ja niiden palveluihin kohdistuvasta vakoilusta ja tarkkailusta tulee jatkossa kaiken viestinnän ja tiedonvälityksen kattavaa. NSA: n tavoitteena on tunkeutua internet-televisioiden myötä ihmisten olo- ja makuuhuoneisiin. Merkitystä ei ole sillä missä päin maailmaa internet-televisio sijaitsee. Tämän tarkkailutekniikan kehittämiseen NSA käyttää jo merkittäviä taloudellisia resursseja.

CIA:n johtaja David Petraeus kertoi Yhdysvaltojen tiedusteluyhteisöjen In-Q-Tel -sijoitusyhtiön tapaamisessa, että se aikoo käyttää uusia internetiin kytkettyjä viihdelaitteita (televisiota, tietokoneita ja muita aktiivilaitteita) vakoiluun. Petraeusin mukaan nämä kodin älykkäät laitteet tulevat muuttamaan käsitystämme salaisuuksista.

Agenttien ei tarvitse käydä salaa asentamassa kotiin mikrofoneja, koska he voivat seurata kodin laitteiden käyttöä verkon avulla. Agentit voivat seurata ja etähallita reaaliaikaisesti mm. internetiin liitettyjä tietokoneita, televisioita, autonavigaattoreita ja matkapuhelimia. Lähde: (wired.com 15.3.2012)

Foreign Intelligence Surveillance Act (FISA) on Yhdysvaltain ulkomaantiedustelun laki, joka tuli voimaan vuonna 1978. Lainsäädännön mukaan viranomaiset saavat seurata maan kautta kulkevaa ulkomaalaista viestintää. Viestinnän osapuolten seuraaminen ei edellytä rikosepäilyä.

Lakia on muutettu toistuvasti 11.9.2001 terrori-iskun jälkeen. Lain 702 §:n perusteella NSA:lla on oikeus hankkia tiedustelutietoja henkilöistä ilman FISC:n lupaa, joiden kohtuudella uskotaan olevan Yhdysvaltojen ulkopuolella. Omien kansalaisten valvontaan vaaditaan kuitenkin FISC:n lupa. Lakimuutokset sallivat maan tiedustelupalveluille mm. oikeuden paikkatietojen keräämiseen.

FISC (Foreign Intelligence Surveillance Court) on salainen tuomioistuin, joka perustettiin vuonna 1978. Erityistuomioistuin koostuu nykyisin 11 liittovaltion tuomarista (aiemmin 7), jotka nimittää Yhdysvaltain korkein oikeus. Erityistuomioistuimen päätökset ovat salaisia. Laki antaa salaiselle ulkomaantiedustelun valvontaoikeudelle oikeuden päättää salaisten tiedustelutietojen hankinnasta esim. televalvonnasta tai telekuuntelusta.

NSA:n tiedetään hankkineen tiedustelutietoja lainsäädännön vastaisesti myös Yhdysvaltain kansalaisista. NSA:n sisäisen tarkastuksen raportti kertoo organisaation syyllistyneen 2766 lakirikkomukseen, jopa perustuslain loukkauksiin vuoden aikana. Rikkomusten syynä ovat inhimillisten virheiden (analyytikkojen kirjoitusvirheet) lisäksi tahallinen piittaamattomuus ja vakoiluohjelmien toiminnalliset piirteet.

Esimerkiksi vuonna 2008 suuri määrä Yhdysvaltain sisäisiä puheluita ohjautui analysoitavaksi, kun Washington (DC) kansainvälinen suuntanumero 202 ja Egyptin kansainvälinen suuntanumero 20 sotkeutuivat ohjelmointivirheen johdosta. Lakirikkomusten osalta tilanne on jatkunut huolestuttavana jo vuodesta 2008, jolloin NSA:n toimivaltuuksia laajennettiin.

NSA:lla ei ole oikeutta tutkia Yhdysvaltojen omien kansalaisten viestiliikennettä, kun he ovat Yhdysvalloissa. Tätä rajoitusta loukataan kuitenkin rutiininomaisesti. Vuonna 2012 rikkomuksia tapahtui noin kymmenen kertaa päivässä. Lain noudattamisen valvontamahdollisuudet ovat olemattomat. Valvonta perustuu yksinomaan NSA:n omiin ilmoituksiin. Lähde: (washingtonpost.com 16.8.2013)

USA Today -sanomalehti kertoi, että toukokuussa 2006 teleoperaattorit AT & T, Verizon ja BellSouth olivat luovuttaneet miljoonien asiakkaiden kansainvälisiä ja kotimaan puhelutietoja NSA:n tietokantaan.

Yhdysvaltain ulkomaantiedustelun lakiin on sisällytetty julkaisematon sääntömuutos (porsaanreikä), joka antaa NSA:lle oikeuden tutkia valtavista tietokannoista myös Yhdysvaltain kansalaisten viestintää, kuten sähköposteja ja puheluita ilman rikosepäilyä tai oikeuden lupaa. Lähde: (theguardian.com  9.8.2013)

NSA tallentaa mm. tiedot soittajan ja vastaanottajan tilaajanumeroista, verkkotiedot, kesto, päiväys, aika, paikka, lähettäjän ja vastaanottajan IP-osoitteet ja vierailut verkkosivuilla. Lähde: (guardian.co.uk Glenn Greenwald 7.7.2013)

Lain 702 § on herättänyt paljon keskustelua sen tulkinnanvaraisuudesta. Lain kohta ei edellytä vakoilun kohteiden tunnistamista, jolloin NSA:n tietokantoihin tallentuu väistämättä myös Yhdysvaltain kansalaisten verkkoviestintään liittyviä tietoja. NSA:n analyytikot tulkitsevat vapaasti, että henkilö on ulkomailla, jos ei ole erityisiä tietoja henkilön sijainnista Yhdysvalloissa.

Yhdysvaltojen ongelmana näyttää olevan se, että NSA ylläpitää teleoperaattoreiden lisäksi tai niiden puolesta televalvontaan käytettäviä mittavia lokitietokantoja. Järjestely tarjoaa NSA:lle, CIA:lle ja FBI:lle kontrolloimattoman ympäristön myös Yhdysvaltojen kansalaisten televalvontatietojen käyttöön.

Yleensä asia on ratkaistu niin (esimerkiksi Suomessa), että tiedustelupalvelun sijaan teleoperaattorit ylläpitävät itse televalvontaan käytettäviä lokitietokantoja ja luovuttavat niistä tietoja viranomaisille vain oikeuden päätöksellä. Tässäkin järjestelmässä on heikkoutensa. Esimerkiksi hyvä veli -verkosto, johon tukeutuen voi tietoja saada ”ystävän” avustuksella myös oikeudettomasti.

 

Rakkaustiedustelu

 

Valvonnan ja järjestelmien hallinnolliset puutteet muodostuivat liian suureksi houkutukseksi myös NSA:n työntekijöille. Työntekijät käyttivät vakoiluohjelmia myös mm. puolisoiden ja perheenjäsenten rakkausasioiden vakoiluun. Lähipiirin rakkausasioiden vakoilu oli niin yleistä, että sitä kutsuttuun NSA:n sisällä termillä "LOVEINT" (rakkaustiedustelutieto).

NSA rankaisi luvatonta tiedustelua tehneitä työntekijöitä mm. hallinnollisin toimenpitein. Joissakin tapauksissa työntekijä oli itse kertonut rikkomuksestaan mm. turvaluokitusten uudistuksiin liittyvien valheenpaljastuskokeiden yhteydessä. Lähde: (wsj.com 23.8.2013 Edward Snowden paljastusasiakirjat 2013)

 

NSA ostaa palveluita alihankkijoilta

 

Organisaation päämajan tuntumassa Marylandin Fort Meaden alueella sijaitsee useita NSA alihankkijoiden yrityksiä. NSA on ulkoistanut merkittävän osan operatiivista toiminnoistaan alihankkijoille.

Alihankkijoiden käytön on katsottu olevan kallista ja vaarantavan kansallisen turvallisuuden. Yhdysvaltojen huippusalaisia tietoja pääsee käsittelemään noin 1,4 miljoonaa henkilöä, joista noin kolmannes on alihankkijoiden henkilöstöä.

Eräs keskeisin alihankkija on Narus. Naruksen kaupallisen STA 6400 semanttisen tietoliikenneanalysaattorin avulla kaikkea internet-protokollaa käyttävää tietoliikennettä voidaan salakuunnella. Kaikki sähköpostiliikenne liitetiedostoineen voidaan rekonstruoida ja liitää oikeisiin asiayhteyksiin.

Yhtiön tietoliikenneanaly saattorit analysoivat noin 60 - 80 prosenttia Yhdysvaltain verkon läpi kulkevasta tietoliikennedatasta. Yksi Narusin järjestelmä pystyy analysoimaan yli 100 miljardia sähköpostia päivässä.

Tietoliikenneoperaattorit ja internet-palveluntarjoajat ovat ympäri maailmaa asentaneet STA 6400 tietoliikenneanalysaattoreita tietoliikennekeskuksiinsa mm. Brasil Telecom. STA 6400:n avulla on mahdollista estää, seurata, analysoida ja tallentaa kaikenlaista mm. sähköposti-, pikaviesti-, televisio- tai VOIP-liikennettä.

Tietoliikenteen analysointiin ja hallinnointiin tarkoitettujen ohjelmistojen kauppaa, käyttötarkoitusta ja käyttötapaa on mahdotonta valvoa. Esimerkiksi Narus tarjoaa asiakkailleen software development kit-sovelluksen tietoliikenneohjelman modifiointiin. Ohjelmien toimittajilla ei ole aavistustakaan. Eikä haluakaan tietää mihin asiakkaat ohjelmiaan käyttävät.

NSA:lla on myös yrityksiä, joiden kautta se pyrkii edistämään sähköisen viestinnän analysointiin, salakuunteluun ja suojausten purkuun liittyvän teknologian kehittämistä sekä ostamaan sille keskeistä teknologiaa kehittäviä yrityksiä. Tavoitteena on turvata kyberjohtajuus vaikuttamalla tuotannossa olevien ja kehitettävien teknologisten ratkaisujen laadullisiin ominaisuuksiin.

NSA ja Yhdysvalloissa toimiva pääomasijoituksia tekevä Nokian Innovent yrittäjäinnovaation liiketoimintayksikkö yhdistivät voimansa avaamalla voittoa tuottamattoman Chesapeake Innovation Center (CIC) yrityshautomon. Nokiaa motivoivana taustavoimana oli mm. Tetra-verkkoihin liittyvät kansainväliset kilpailuasetelmat.

CIC aloitti toimintansa Yhdysvalloissa Marylandissa kesällä 2003. CIC oli ensimmäinen yrityshautomo, jonka tavoitteena oli tukea Yhdysvaltojen sisäistä turvallisuutta edistävien pienten korkeaa teknologiaa edustavien yritysten menestymismahdollisuuksia.

NSA osallistuu yrityshautomon toiminnan rahoittamiseen ja tekee yhteistyötä sisäistä turvallisuutta edistäviä innovaatioita ja korkean teknologian tuotteita tarjoavien yritysten kanssa. NSA on kiinnostunut hankkimaan myös vähemmistöosuuksia pienistä yrityksistä. NSA:n intressi tukea CIC toimintaa perustuu sen omiin tiedustelun teknologiatarpeisiin.

CIC tarjoaa mm. start-up yrityksille liiketoiminnan käynnistämiseen liittyviä palveluita, joilla voidaan nopeuttaa kasvua yrityksen elinkaaren alkuvaiheessa. Sillä oli heti alkuvaiheessa tarjota yrityksille toimitiloja kaikkiaan noin 24 000 neliömetriä.

Lähteet: (lightreading.com 4.8.2003, washingtontechnology.com 4.8.2003, tetrawatch.net 3.3.2006)

CIC:n suomalaistaustaisia kansanväisiä kumppaneita ovat mm.

  • Elektrobit Oyj

  • Environics Oy

  • Mirasys Oy

  • Nethawk Oyj

  • Rapal Oy

  • Sec Control Oy

Lähde: (cic-tech.org/member-companies 9.12.2013)

 

Microsoft tekee tiivistä yhteistyötä NSA:n kanssa

 

Useimmissa Microsoftin tarjoamissa palveluissa NSA pyrkii keräämään käyttäjien tiedot ennen salausta. Esimerkiksi Prism-ohjelman puitteissa tapahtuva vakoilu edellyttää NSA:lta salausten kiertämistä, koska vakoiluohjelmassa tiedot on kerättävä jo ennen salausta. NSA pääsee käsiksi Outlook.com-palvelun sähköposteihin ja ennen niiden salaamista,

Tiettyjen Microsoftin tarjoamien palveluiden kuten Microsoftin SkyDrive-pilvipalvelun osalta tämä ei ole kuitenkaan mahdollista, koska asiakkaiden tietoja säilytetään palvelimella salatussa muodossa. SkyDrive-pilvipalvelulla oli yli 250 miljoonaa käyttäjää eri puolilla maailmaa. Näiden palveluiden osalta Microsoft joutuu kehittämään yhteistyössä FBI:n kanssa ratkaisuja, joiden avulla NSA:lle tarjoutuu mahdollisuus päästä käyttäjien salattuihin viesteihin kiertoteitä. Tätä tehtävää varten FBI:ssä toimii erityinen Ditu-tiimi (Data Intercept Technology Unit).

Microsoft on yksinkertaisesti luovuttanut salausavaimet NSA:lle salauksen purkamiseksi. Näin ollen salaus suojaa asiakkaiden tietoja ainoastaan satunnaisilta hakkereilta, ei Yhdysvaltojen vakoilulta.

NSA pääsee lukemaan mm. käyttäjien salattuja sähköpostiviestejä ja Outlook.com portaalin salattuja pikaviestejä. NSA:lla on pääsy myös Sky Drive -pilvipalvelun tiedostoihin ja Skype-videopuheluihin. Kysymys ei ole vähäisestä asiasta. Esimerkiksi Skype-palveluilla oli maailmanlaajuisesti vuonna 2012 noin 663 miljoonaa käyttäjää ja kuukausittain noin 124 miljoonaa käyttäjää.

Lähde: (guardian.co.uk 11.7.2013, Edward Snowden paljastusasiakirjat 2013)

Microsoft tarjosi käyttäjille ilmaisen Hotmail -sähköpostipalvelun vuodesta1995. Se nousi nopeasti maailman käytetyimmäksi sähköpostipalveluksi. Vuonna 2011 Microsoft osti Skypen sijoittajaryhmältä 8,5 miljardilla dollarilla eli lähes kuudella miljardilla eurolla. Skype-palvelu on perustettu vuonna 2003. Suosituin Skypen palvelu oli ilmaiset puhelupalvelut. Vuonna 2013 Microsoft yhdisti Windows Live Messenger ja Skype palvelut yhdeksi kokonaisuudeksi. Microsoft halusi yhdistää sadat miljoonat eri palveluiden käyttäjät Skype-palvelun käyttäjiksi. Samalla poistui Hotmail-sähköpostipalvelu.

 

Yhdysvaltain hallitus painostaa teleyrityksiä luovuttamaan tietoja

 

Case ”Lavabit”

Lavabit-sähköpostipalvelun perustaja ja omistaja Ladar Levison ei suostunut Yhdysvaltain hallituksen vaatimukseen saattaa 350 000 asiakkaansa verkkoviestintä NSA:n seurantaan. Levison päätyi sulkemaan painostuksen edessä sähköpostipalvelun.

Ladar Levison kirjoitti yhtiön verkkosivuilla ”Oli pakko tehdä vaikea päätös. Osallisuus Amerikan kansaan kohdistuvissa rikoksissa tai uhrata kymmenen vuoden kova työ ja sulkea Lavabit”. Edward Snowdenin uskottiin käyttäneen Lavabit-sähköpostipalvelua verkkoviestinnässään. Lähde: (theguardian.com 9.8.2013)

Case ”Qwest Communications”

Useissa Yhdysvaltojen osavaltioissa teletoimintaa harjoittanut Qwest Communications menetti hallituksen tuottoisat sopimukset kieltäytyessään yhteistyöstä NSA:n kanssa. Se katsoi, että tietojen luovuttaminen NSA:lle, FBI:lle, CIA:lle ja DEA:lle vaaransi sen 14 miljoonan asiakkaan yksityiseen suojan sekä oli Yhdysvaltain lainsäädännön vastaista. Kieltäytymisen seurauksena yhtiön johtaja Joe Nacchio sai vastatakseen mm. sisäpiirikauppoja koskeviin rikossyytteisiin.

Yhdysvaltain käräjätuomari Anna Taylor antoi 17.8.2006 Detroitissa Michiganissa päätöksen, että hallituksen kotimaan puheluliikenteen salakuunteluohjelma on perustuslain vastainen, loukkaa yksityisyyden suojaa ja määräsi sen päättymään välittömästi. Oikeusministeri Alberto Gonzales totesi kuitenkin käräjätuomarin päätöksen olevan Bushin hallinnon vastainen. Valituksen seurauksena vetoomustuomioistuin kumosi Käräjätuomari Anna Taylorin päätöksen.

Qwest Communicationsin johtaja Joe Nacchio tuomittiin vuonna 2007 kuudeksi vuodeksi vankeuteen. Tuomari totesi, että Nacchio osoitti teollaan "kaikenkattavaa ahneutta". Nacchio tuomittiin menettämään 52 000 000 dollarin rikoshyödyn ja maksamaan 19 miljoonan dollarin sakon.

Qwest Communications –yhtiö sulautui myöhemmin 1.4.2011 CenturyLink –yhtiöön. CenturyLink oli tuolloin Yhdysvaltojen kolmanneksi suurin teleyhtiö.

Lähteet: (cnn.com 17.8.2006. sec.gov/litigation/complaints/comp18936.pdf kantelu, centurylink.com tiedote 1.4.2011)


( Päivitetty: 10.01.2014 17:45 )

 - pelontorjunta | Kommentoi



 "Me teemme mitä me tahdomme" (NSA - Osa 2)
10.01.2014 17:25 | pelontorjunta

Kuinka Edward J. Snowdenista tuli ”petturi”

Entinen CIA:n työntekijä Edward J. Snowden paljasti alkuvuodesta 2013 Hongkongissa lehdistölle luottamuksellisia asiakirjoja NSA:n salakuuntelujärjestelmästä. Hän oli saanut asiakirjat käsiinsä työskenneltyään vajaat kolme kuukautta yksityisessä Booz Allen Hamilton –konsulttiyhtiössä.

Snowdenin ensimmäinen suora yhteydenotto Washington Postiin tapahtui 16.5.2013. Washington Post julkisti ensimmäisenä Snowdenin paljastukset 6.6.2013 ja 20 minuuttia myöhemmin Guardian. Snowden toimi ensin koodinimellä "Verax", mutta tuli myöhemmin julkisuuteen omalla nimellään.

Booz Allen Hamiltonilla oli noin 25 000 työntekijää eri puolilla maailmaa sijaitsevissa tytäryhtiöissä, myös Suomessa. Osalla yhtiön työntekijöistä oli pääsy Yhdysvaltain kansallisen turvallisuuden perusteella salaiseksi luokiteltuihin tietoihin. NSA lukeutui yhtiön tärkeimpiin asiakkaisiin. Snowden asui Havaijilla ja työskenteli yhtiön Havaijin-tiimissä.

Yritysjärjestelyiden seurauksena Suomessa sijaitsevan yhtiön nimi muuttui Booz & Company Oy:ksi ja irtaantui Booz Allen Hamiltonista. Booz & Company yhtiön omistajaksi tuli Ruotsin Booz & Company Ab. Yhtiöllä oli työntekijöitä Suomessa alle kymmenen henkilöä.

FBI aloitti torstaina 13.6.2013 rikostutkinnan Edward Snowdenia vastaan. Yhdysvallat ilmoitti tekevänsä kaikkensa, että Snowden saadaan oikeuteen vastaamaan paljastuksistaan. FBI:n mukaan paljastukset olivat aiheuttaneet "merkittävää haittaa kansakunnallemme ja turvallisuudellemme".

 

Euroopassa Edward Snowden ei ole petturi

 

EU:n sotilasesikunnan tiedustelupäällikön Georgij Alafuzoff totesi, että Edward Snowdenia on vaikea leimata petturiksi. Alafuzoff totesi Yle Uutisten haastattelussa myös, että on yhtä vaikea todeta, että tiedusteluorganisaatiossa töissä oleva henkilö voisi jakaa vapaasti kaiken sen, minkä tietoonsa saa,

Alafuzoff ei uskonut, että Snowdenin paljastuksilla olisi mitään vakavia vaikutuksia tiedustelutoiminnan operatiiviselle tekemiselle. Alafuzoffin mukaan tiedusteluorganisaatioiden tärkein tehtävä on turvallisuuden tuottaminen koko olemassa olevalle tiedusteluyhteisölle.

Tiedusteluyhteisö tarvitsee toisiaan, eikä se tule toimeen ilman toisten tukea, tietoa ja resursseja. Tiedustelutoimintaa tapahtuu myös "oman" organisaation ja "oman" väen sisällä.

Alafuzoffin mukaan vain häviävän pieni osa maailman väestöstä on todella valvonnan alla. He ovat joko rikollisuuteen taipuvaisia tai julkisuuden henkilöitä. Alafuzoff kommentoi tietovuotoa yhdessä Ilkka Salmen kanssa SuomiAreenassa Porissa järjestetyssä tilaisuudessa.

Lähde: (yle.fi 18.7.2013)


NSA murtautuu tietojärjestelmiin

Edward Snowdenin paljastusten mukaan NSA on tarkkaillut tietokoneita Hongkongissa ja Kiinassa vuodesta 2009. Kiinnostuksen kohteina ovat olleet mm. viranomaisten, liikeyritysten ja opiskelijoiden tietokoneet. Snowdenin mukaan NSA teki neljän vuoden aikana yli 61 000 hyökkäystä tietojärjestelmiin eri puolille maailmaa. Yksinomaan Kiinassa ja Hong Kongissa tietomurtoja oli satoja.

Yksittäisten tietokoneiden lisäksi NSA murtautuu runkoverkkojen solmupisteisiiin kuten internetin reitittimiin. NSA pääsi kiinni helposti Ciscon reitittimiin asennettujen takaporttien avulla. Menettelyllä voidaan salakuunnella satojatuhansia tietokoneita tarvitsematta murtautua jokaiseen tietokoneeseen erikseen.

 

Eurooppa on NSA:n keskeinen vakoilukohde

 

Yhdysvallat salakuuntelee Eurooppaa EU:n tietoverkon ja EU-virastoihin asentamiensa salakuuntelulaitteiden avulla. Vakoilu tapahtuu pääsääntöisesti Brysselissä Justus Lipsus -rakennuksessa, Washingtonissa ja New Yorkissa. NSA:lla on myös rajoittamaton pääsy EU:n sisäiseen sähköpostiviestintään ja tietoverkossa säilytettäviin ja jaettaviin asiakirjoihin. Lähteet: (spiegel.de 29.6.2013)

Syyskuussa 2010 Yhdysvallat vakoili ainakin 38 eri lähetystöä, kuten EU: n edustustoja, Ranskan, Italian ja Kreikan suurlähetystöjä, sekä useita muita Yhdysvaltain liittolaisia kuten Japania, Meksikoa, Etelä-Koreaa, Intiaa ja Turkkia.

Erään Yhdysvaltojen vakoiluopraation koodinimi oli "Dropmire", joka perustui fax-viestiliikenteen salakuuntelun. Salakuuntelulaitteet oli asennettu EU:n lähetystöjen kaupallisesti saatavilla oleviin Cryptofax - laitteisiin (salakirjoittava fax-laite).

Salakuuntelun tavoitteena on kerätä mm. EU: n Washington suurlähetystöstä sisäpiirin tietoa politiikan erimielisyyksien globaaleista kysymyksistä ja muista eripuraa jäsenvaltioiden välillä aiheuttavista asioista.

Toinen Yhdysvaltain vakoiluoperaation koodinimi oli "Poseidon", jonka kohteena oli EU:n ja YK:n välinen yhteistyö. Operaatiossa vakoilu tapahtui kopioimalla kiintolevyjen sisältö, jonka mahdollistivat peiteoperaatiot, joiden avulla tietokoneeseen aiheutettiin häiriö ja vikatilanteita.

Kolmas Yhdysvaltain vakoiluvakoiluoperaation koodinimi oli "Blackfoot", jonka kohteena olivat Ranskan ja YK:n väliset operaatiot. Ranskan Washingtonin suurlähetystössä tapahtuvan vakoiluoperaation koodinimi oli "Wabash". Italian Washingtonin suurlähetystön vakoiluoperaatioiden koodinimet olivat "Bruneau" ja "Hemlock".

Yhdysvallat harjoittaa salakuuntelua myös Naton päämajassa Brysselissä. Naton päämajasta käsin se salakuunteli mm. EU:n päämajan puhelimia etäylläpito-ohjelmiston avulla.

 

NSA:n toiminta Saksaa, Espanjaa ja Ranskaa vastaan

 

Yhdysvallat on määritellyt Saksan yhtä tärkeäksi tiedustelukohteeksi kuin Kiinan. NSA tallensi kuukausittain yksinomaan Saksassa puoli miljardia puhelutietoa, sähköpostia ja tekstiviestiä. Keskivertopäivänä NSA tutki 20 miljoonaa saksalaista puhelinyhteyttä ja 10 miljoonaa verkkotiedostoa. Kiireisenä päivänä määrä nousi 60 miljoonaan.

Lähde: (guardian.co.uk 29.6.2013, Edward Snowden paljastusasiakirjat 2013)

Espanjan pääministeri Mariano Rajoy päätti kutsua Yhdysvaltain suurlähettiläs James Costosin puhutteluun puhelutietojen tallennusten johdosta. Puhelutietojen tallentaminen paljastui Edward Snowdenin kopioimista NSA:n asiakirjoista. Operaatio tapahtui 10.12.2012 ja 8.1.2013 välisenä aikana. NSA ei tallentanut puheluiden sisältöä, vaan mm. soittajan ja vastaanottajan puhelinnumerot, puhelun keston, matkapuhelimien IMEI-koodit ja sarjanumerot, sijaintitiedot, tukiasematiedot ja niiden sijainnit. Espanja ilmoitti paheksuvansa tapahtunutta, mutta ilmoitti, ettei sillä ollut aikomusta liittyä Saksan ja Ranskan ehdottamaan vakoilun pelisääntöjä pohtivaan ryhmään.

Lähteet: (elmundo.es 28.10.2013, elpais.com 28.10.2013)

Ranskan presidentti Francois Hollande keskusteli Yhdysvaltain presidentti Barack Obaman kanssa maanantaina 21.10.2013 NSA:n Ranskassa harjoittamasta vakoilusta. Hollande paheksui syvästi Yhdysvaltain Ranskan kansalaisiin kohdistamaa vakoilua.

Edward Snowdenin paljastamien asiakirjojen perusteella NSA oli tallentanut tietoja US-985D vakoiluohjelman puitteissa yksinomaan 10.12.2012 – 8.1.2013 välisenä aikana noin 70,3 miljoonasta Ranskassa soitetusta puhelusta. Vakoilun kohteena oli ollut myös Ranskan politiikan ja liike-elämän keskeisiä vaikuttajia.

NSA oli tallentanut automaattisesti tietyistä numeroista soitetut puhelut ja lähetetyt tekstiviestit. Valkoinen talo myönsi, että Ranskalla oli syytä olla huolissaan vakoilusta. Valkoisen talon mukaan Yhdysvallat arvioi uudelleen tiedustelutoimintaansa tasapainottaakseen turvallisuustarpeet ja ihmisten yksityisyydensuojan.

Lähteet: (lemonde.fr 21.10.2013, Ylen aamu-tv uutislähetykset 23.10.2013)

 

Liittokansleri Angela Merkelin urkinta

 

Saksan hallitus kertoi keskiviikkona 23.10.2013, että sillä oli hallussaan tiedustelutietoja, joiden mukaan NSA oli salakuunnellut vuosikausia liittokansleri Angela Merkelin puheluita. Puhelinkeskustelussaan Yhdysvaltain presidentti Barack Obaman kanssa 23.10.2013 Merkel vaati Yhdysvalloilta selvitystä asiasta.

Merkelin käytössä ollut Nokia 6210 matkapuhelin oli salakuuntelun kohteena lokakuusta 2009 heinäkuuhun 2013. NSA:n salakuunneltavien puhelinnumeroiden listalla Merkelin puhelinnumero oli jo vuodesta 2002. Lähde: (spiegel.de 26.10.2013) Saksan tiedusteluviranomaiset pitivät Nokian puhelinmallia turvattomana, koska sillä oli mahdollista salata vain puhelut ja tekstiviestit. Sähköpostiviestien salausmahdollisuus puuttui. Merkelin puhelin vaihdettiin kanadalaiseen Blackberryyn, johon asennettiin ulkopuolista turvateknologiaa.

Merkel varoitti Yhdysvaltoja pettämästä Saksan luottamusta. Merkel reagoi voimakkaasti presidentti Obamalle, että politiikan huipulla olevien henkilöiden salakuuntelua on mahdotonta hyväksyä ja tällaiset käytännöt on lopetettava välittömästi.

Presidentti Obama totesi, että Yhdysvallat ei kuuntele Merkelin puheluita nyt ja tulevaisuudessa. Menneisyyteen presidentti Obama ei ottanut kantaa. Lähteet: (spiegel.de 24.10.2013, bbc.co.uk 24.10.2013, theguardian.com 24.10.2013, tagesspiegel.de 24.10.2013)

Saksan hallituskorttelin puhelimien salakuuntelu tapahtui Yhdysvaltain Berliinin-lähetystössä NSA:n alaisen erikoispalvelun SCS:n toimesta. SCS (Special Collection Service) suorittaa erittäin salaisia salakuunteluoperaatioita vaikeasti salakuunneltavissa tiloissa, kuten teleoperaattoreiden tietoliikennekeskuksissa, ulkomaisissa lähetystöissä ja kohdevaltioiden laitoksissa. SCS on perustettu 1970-luvun lopulla. Sen pääkonttori sijaitsee Marylandin Beltsvillessa.

SCS toimii Yhdysvaltain lähetystöistä käsin salaisesti. Sen henkilöstöä ei ilmoiteta isäntämaan viranomaisille. Vuonna 2001 SCS:n uskottiin avustaneen 27 satelliittiohjatun salakuuntelulaiteen asentamisessa Kiinan presidentti Jiang Zemin uuteen Boeing 767-300ER lentokoneeseen. Kiinalaiset onnistuivat kuitenkin löytämään salakuuntelulaitteet ennen koneen käyttöönottoa.

Lähde: (theguardian.com 26.10.2013)

 

NSA salakuunteli Dimitri Medvedevin satelliittipuheluita

 

NSA salakuunteli vuonna 2009 G20 kokouksen yhteydessä Venäjän silloisen presidentin Dimitri Medvedevin satelliittipuheluita Moskovaan. Ensimmäinen viesti kaapattiin heti tunnin kuluttua Dimitri Medvedevin ja Barack Obaman tapaamisesta. Salakuuntelu tapahtui Yhdysvaltojen ja Britannian suurimmassa signaalitiedustelukeskuksessa RAF (Royal Air Force) Menwith Hill asemalla lähellä Harrogatea, North Yorkshiressa, jossa työskentelee satoja NSA:n analyytikoita yhdessä GCHQ:n asiantuntijoiden kanssa.

Yhdysvallat vuokrasi signaalitiedustelukeskukselle noin 227 hehtaarin tontin vuonna 1954. NSA on ollut signaalitiedustelukeskuksen operaattori vuodesta 1966.

Lähde: (guardian.co.uk 16.6.2013, Edward Snowden paljastusasiakirjat 2013)

 

Applen iPhonessa NSA:n vakoiluohjelma

 

NSA:n vuonna 2008 käynnistämän koodinimellä Dropoutjeep tunnetun hankkeen tavoitteena oli saada Applen iPhone puhelinpäätteet hallintaansa. NSA kehitti puhelimeen takaportin, jonka avulla sillä on mahdollisuus kuunnella iPhonen ääniviestejä, lukea tekstiviestejä sekä kytkeä puhelimen mikrofoni ja kamera päälle. NSA pystyy myös siirtämään iPhonesta tiedostoja tai lataamaan niitä ja toteamaan puhelimen sijainnin.

NSA:lla on erillinen osasto TAO (Tailored Access Operations) sisäisesti tunnettu lyhenteellä ANT (Ad-vanced Network Technology), jonka tehtävänä on asentaa uusiin laitteisiin kuten tietokoneisiin ja matka-puhelimiin vakoiluohjelmia ennen kuin myyntipakkaukset päätyvät niiden tilaajille.

NSA pyrkii sijoittamaan myös haitallista koodia Bios-ohjelmaan, joka käynnistyy ensimmäisenä tietokoneen emolevyltä. Kiintolevyn tai käyttöjärjestelmän vaihto ei poista tällaista vakoiluohjelmaa. Lähde: (derspiegel.de 30.12.2013)

 

NSA Etelä-Amerikassa sekä YK:n salakuuntelu

 

NSA on mm. vuosien ajan järjestelmällisesti salakuunnellut Brasilian tietoliikenneverkkoa ja tallentanut sähköpostiliikennettä sekä puheluita miljoonista brasilialaisista.  

Lähde: (oglobo.globo.com 6.7.2013)

Kesällä 2012 NSA onnistui murtamaan YK:n sisäisen videokonferenssijärjestelmän salauksen. Eräässä tapauksessa NSA havaitsi vastaavasta salakuuntelusta myös Kiinan tiedustelupalvelun.

Tämän lisäksi se murtamaan EU:n Yhdysvaltojen edustustojen käyttämän VPN (virtual private network) -yhteyden, jonka kautta voi esimerkiksi etäkäyttää yksityistä verkkoa. Kolmen viikon aikana se oli purkanut jo 12 458 salattua viestiä.

NSA salakuunteli EU:n pääedustustoa syksyllä 2012 ennen sen muuttoa uusiin tiloihin New Yorkissa. New Yorkin toimitiloista käytettiin koodinimeä Apalachee ja Washingtonin toimitiloista koodinimeä Magothy.. Salakuuntelu jatkui myös muuton jälkeen.

Lähde: (spiegel.de 25.8.2013 Edward Snowden paljastusasiakirjat 2013)
 

NSA aktiivinen Kiinassa

 

NSA murtautui suurten kiinalaisten matkapuhelinoperaattoreiden asiakkaiden tekstiviesteihin ja Tsinghuanin yliopiston palvelimille mm. tammikuussa 2013. Tsinghuanin yliopistoa pidetään Kiinassa keskeisenä koulutuksen ja tutkimuksen instituuttina, joka tekee tutkimusta mm. seuraavan sukupolven web-teknologioiden parissa.

Tekstiviesti (SMS) on Manner-Kiinan suosituimpia viestintämuotoja. Kiinalaiset lähettivät 900 miljardia tekstiviestiä vuonna 2012. China Mobile on maailman suurin matkapuhelinoperaattori. Sillä oli vuonna 2013 noin 735 miljoonaa tilaajaa.

China Unicom on Kiinan toiseksi suurin matkapuhelinoperaattori. Sillä oli vuonna 2013 noin 258 miljoonaa käyttäjää. Kolmanneksi suurin oli China Telecom, jolla oli samaan aikaan 172 miljoonaa käyttäjää.

Matkapuhelinverkkokomponenttien valmistajista Huawei, Datang ja ZTE ovat merkittävästi vähentäneet Kiinan ulkopuolisia komponenttitoimituksia, koska Yhdysvalloista hankittuihin verkkokomponentteihin liittyy suuri tietomurtoriski. Yhdysvallat on puolestaan syyttänyt erityisesti Huaweita verkkovakoilusta.

NSA murtautui vuonna 2009 Pacnet-verkko-operaattorin tietojärjestelmiin. Pacnet on Aasian johtava verkko-operaattori ja viestintäpalvelujen tarjoaja. Hong Kongissa pääkonttoriaan pitävä Pacnet omistaa ja operoi yli 46 000 kilometrin mittaisen valokuitukaapeliverkoston, joka yhdistää Euroopan, Aasian ja Tyynenmeren alueen toisiinsa.

Kiina katsoo, että ulkomaiset verkkokomponentit ovat vakava uhka kansalliselle turvallisuudelle. China Unicom päätti kaikessa hiljaisuudessa korvata Ciscon reitittimet Wuxin laitteilla.

 

NSA vaihtaa tiedustelutietoja Israelin ja Norjan kanssa

 

Tiedustelutietojen vaihtaminen perustuu Yhdysvaltojen ja Israelin väliseen sopimukseen. Sopimus ei aseta sen osapuolille mitään oikeudellisesti sitovia käyttörajoituksia.

NSA jakaa Israelille rutiininomaisesti tiedustelutietoja ilman, että se poistaisi ensin raakatiedosta Yhdysvaltain kansalaisten viestintään liittyvät tiedot mm. puhelu- ja sähköpostiviestintään liittyvät tiedot.

Lähde: (theguardian.com 11.9.2013 Edward Snowden paljastusasiakirjat 2013)

NSA tallensi noin 33 (33 186 042) miljoonaa Norjassa soitettua matkapuhelua vuodenvaihteessa 2012 – 2013. Kuuntelu kesti noin 30 päivän ajan. Yhdysvaltain Norjan-suurlähetystön mukaan kyse oli tavanomaisesta toiminnasta.

USA:n lähetystö kertoi keräävänsä tiedustelutietoja myös ulkomailla samoin kuin kaikki muutkin maat tekevät. Lausumasta voidaan vetää johtopäätös, että USA:n lähetystö harjoittaa vastaavaa toimintaa myös Suomessa. Soitetuista matkapuheluista oli tallennettu metatiedot eli puhelun osapuolet (A- ja B-tilaajat), puheluiden kesto ja puhelimien paikkatiedot sekä puhelimien sarjanumerot.

Norjan signaalitiedustelu E-palvelu tallentaa tietoliikenteen metatietoja ja jakaa tiedot kumppaneiden kuten NSA:n kanssa. Sen sijaan E-palvelu ei ole tietoinen, että NSA tallentaisi norjalaisten puheluita Norjassa. Norjan E-palvelun johtaja kenraaliluutnantti Kjell Grandhagen vahvisti Edward Snowdenin paljastaman asiakirjan tiedot ja kertoi tiistaina 19.11.2013 pidetyssä lehdistötilaisuudessa, että NSA tallensi vain 30 päivän ajan yli 33 miljoonan puhelun metatiedot (lähdekoodi US-987F).

Kjell Grandhagen korosti, että metatietokokoelmassa ei ole kyse NSA:n hankkimista Norjaa koskevista tiedustelutiedoista, eikä metatietojen tallennus tapahtunut Norjassa. Hän totesi, että Snowdenin paljastamat asiakirjat eivät kertoneet asiasta koko totuutta. Grandhagen mukaan keräysoperaatiossa oli kyse erillisestä Norja-kokoelmasta, jonka tavoitteena oli tukea Norjan sotatoimia ulkomailla, ja torjua kansainvälistä terrorismia. Hän totesi, että puhelutietojen kerääminen ei ole vain kuukauden operaatio, vaan jatkuu nyt ja tulevaisuudessa. Tallennusmäärät voivat hänen mukaan vaikuttaa suurilta, mutta ovat todellisuudessa pieniä suhteutettuna kansainvälisen tietoliikenteen lukuihin.

Lähteet: (dagbladet.no 19.11.2013, vg.no 19.11.2013)


Verkkovakoiluohjelmat

Muscular

Muscular on NSA:n ja GCHQ:n yhteisen vakoiluoperaation koodinimi, joka kopioi Googlen ja Yahoon tietokonekeskuksia yhdistävien kuituoptisten kaapeleiden kautta näiden sisäisistä verkoista miljoonia tiedostoja päivittäin tietovarastoon Marylandin Fort Meadessa. Yhden kuukauden aikana tiedostoja kopioitiin 180 miljoonaa. Viestintälinkit yhdistävät Suomessa ja eri puolilla maailmaa sijaitsevat Googlen ja Yahoon datakeskukset toisiinsa.

Muscular mahdollistaa valokaapelista kerättyjen tietojen siirtämisen NSA tai GCHQ kaapeliliittimiin. Musculariin liittyvä työkalu nimeltään Incensor, joka tarjoaa tiedustelutietoa muista lähteistä. Google ilmoitti, ettei yhtiö ei ole tietoinen mahdollisesta vakoilusta. Yahoo ilmoitti puolestaan, ettei se ole antanut NSA:lle pääsyä tiukasti suojattuun verkkoonsa. Lähde: (washingtonpost.com 30.10.2013)


Prism

Prism on Yhdysvaltain elektronisen verkkovakoiluohjelma, joka tunnetaan virallisesti nimellä PRISM/US-984XN. Prism-ohjelman nimi juontuu sanasta prisma, jota käytetään valokaapelilissa jakamaan valoa. Valo siirtää tietoa valokuidussa. Prisma jakaa tietoliikennevirrat eri osoitteisiin. NSA:n ja GCHQ:n analyytikkojen lisäksi myös FBI ja CIA saavat rutiininomaisesti Prism-salakuunteluohjelman puitteissa hankitut tiedot käyttöönsä.

Prism-ohjelma alkoi syksyllä 2007 presidentti Bushin hallinnon aikana ja laajeni presidentti Obaman aikana. Vuonna 2011 Prism-vakoiluohjelman piiriin kuuluvat seuraavat maanosat:

  • Kanada

  • Pohjois-Amerikka

  • Etelä-Amerikka

  • Eurooppa

  • Afrikka

  • Aasia


Prism-vakoiluohjelma seuraa keskeisten teleoperaattoreiden ja internet-palveluntarjoajien asiakkaiden sähköistä viestiliikennettä ja tiedonvälitystä suorien palvelinyhteyksien kautta. Microsoft oli ensimmäinen ISP-palveluntarjoaja (internet service provider), joka liittyi NSA:n Prism-ohjelmaan 11.9.2007.

Yahoo tuli mukaan 12.3.2008, Google 14.1.2009, Facebook 3.6.2009, PalTalk 12.7.2009, YouTube 24.9.2010, Skype 2.6.2011, AOL 31.3.2011 ja Apple lokakuussa 2012.

Lokakuussa 2011 FISC oli todennut lainvastaiseksi tietojen keräämisen Yhdysvaltain sisäisestä viestiliikenteestä. Päätöksen seurauksena ISP-palveluntarjoajat joutuivat toteuttamaan järjestelmiinsä kalliita muutoksia.

NSA maksoi yhtiöille muutostöistä miljoonia dollareita.  Korvauksia saivat mm. Yahoo, Google ja Microsoft.  Facebook kiisti saaneensa koskaan korvauksia. Lähde: (theguardian.com 23.8.2013)

Prism -vakoiluohjelma ei yksin pysty tarjoamaan NSA:lle kaiken kattavaa pääsyä verkkoviestintään. Ulkopuolelle jää suuri määrä puheluita muuta verkkoviestintää. Tämän johdosta NSA on joutunut rakentamaan ja ylläpitämään myös muita globaaliin kansainväliseen tietoliikenteeseen kohdistuvia vakoiluohjelmia.

ThinThread

ThinThread oli NSA:n 1990-luvulla kehittämä viestintäverkkojen vakoiluohjelma, johon oli sisäänrakennettu myös Yhdysvaltain kansalaisia koskeva yksityisyyden suoja. ThinThread pystyi lajittelemaan suuria määriä tietoja löytämään niistä uhkia paremmin kuin uusi vakoiluohjelma.

ThinThread pystyi myös nopeasti erottamaan ja salaamaan Yhdysvaltojen sisäisen viestinnän ja varmistamaan omien kansalaisten yksityisyyden suojan. ThinThreadin korvasi myöhemmin Trailblazer -vakoiluohjelma.

Trailblazer

Science Applications International Corporation solmi vuonna 2002 sopimuksen Trailblazer vakoiluohjelman kehittämiseksi. Sopimuksen arvo oli 280 000 000 dollaria.

Trailblazer –vakoiluohjelman tarkoituksena oli parantaa NSA:n viestintäverkkojen kuten internetin analysointikykyä. Ohjelma ei kunnioittanut Yhdysvaltain kansalaisia koskevaa yksityisyyden suojaa, kuten sitä edeltänyt vakoiluohjelma teki. Ajan myötä NSA:n työntekijät kuitenkin huolestuivat epäonnistuneesta hankinnasta ja lainvastaisesta kotimaan vakoilusta.

Työntekijöiden mielestä aiempi ThinThread oli uutta vakoiluohjelmaa parempi. Pian osoittautui, että Trailblazer oli huonosti toteutettu, eikä täyttänyt sille asetettuja tavoitteita. Tietokanta oli huonosti suunniteltu ja sen tuottama tieto oli analyytikoille lähes hyödytöntä. Ohjelma tuotti analyytikoille virheellisiä johtolankoja ja ne johtivat tutkimukset useissa tapauksissa umpikujaan.

Ohjelma oli tullut maksamaan NSA:lle jo yli miljardi dollaria. Toteutuneet kustannukset ylittivät budjetin useilla sadoilla miljoonilla dollareilla ja sen kehittäminen viivästyi sovitusta aikataulusta. Tilanne aiheutti NSA:n sisällä tyytymättömyyttä. Lopulta tieto NSA:n epäonnistuneesta ja kalliista hankkeesta vuoti medialle.

Vuonna 2005 presidentti George W. Bush määräsi FBI tutkimaan, kuka oli paljastanut tietoja NSA sähköisestä Trailblazer -vakoiluohjelmasta medialle. Sittemmin NSA:n virkailija Thomas Drake tuomittiin 10.6.2011 rikkomuksesta (tietokoneen luvaton käyttö) yhden vuoden koeajalle. Kotietsinnän yhteydessä hänen kodistaan oli löytynyt viisi asiakirjaa, jotka puolustuksen mukaan olivat turvaluokittelemattomia (unclassified) ja joista kaksi koski Turbulence –ohjelmaa.

Vuonna 2006 NSA päätti lopulta luopua Trailblazer -vakoiluohjelmasta. Tämän jälkeen käynnistyi uusi projekti, jota kutsuttiin nimellä Turbulence (Turbulenssi).

Turbulence

Turbulence projekti alkoi jo vuoden 2005 puolella. Aiemmat kokemukset huomioiden NSA kehitti ensin ohjelmasta ”halpaversion” testikäyttöön. Uuteen vakoiluohjelmaan haluttiin sisällyttää myös kyber-sodankäynnin ja kohteen häirintään liittyviä ominaisuuksia, kuten haittaohjelmia, joita voitiin asentaa tietokoneisiin. Turbulence –vakoiluohjelma koostuu yhdeksästä keskeisestä ohjelmasta, joista keskeisimpiä ovat :

 

  • Turmoil

  • Tutelage

  • Traffic Thief (tietokanta).

Yhdysvaltain kongressi arvosteli hanketta jo vuonna 2007. Se katsoi, että Turbulence -vakoiluohjelmalla oli samoja ongelmia kuin sen edeltäjällä Trailblazerilla. Ohjelma oli tullut maksamaan NSA:lle jo yli 2 miljardia dollaria. Ohjelman testaus ei sujunut odotusten mukaisesti, eikä teknologia tuottanut tavoiteltuja tuloksia.

Ohjelman eri osat eivät toimineet saumattomasti yhdessä, joka teki koko ohjelmasta analyytikoille lähes hyödyttömän. Ongelmat johtivat sittemmin hankkeen toteutuksen viivästymiseen ja valmistumismääräaikojen pitkittymiseen sovituista. Samalla myös kustannukset nousivat.

Paine tuottaa nopeasti valmista johti keskeneräisen teknologian käyttöönottoon. Riskinä oli, että ohjelma vahingoittaa tietoliikenneverkkoja ja siihen kytkettyjä tietokonejärjestelmiä.

Xkeyscore

XKeyscore oli vuonna 2013 NSA:n laajin televiestintään liittyvä vakoiluohjelma (DNI Digital Network Intelligence), jonka avulla kerättiin tiedustelutietoa ulkomaalaisten henkilöiden verkkoasioinnista eri puolilla maailmaa.  XKeyscore vakoiluohjelma kattoi yhdessä Prism-ohjelman kanssa lähes kaiken mitä tavallinen käyttäjä internetissä teki.

Vakoiluohjelman puitteissa tiedusteluanalyytikoilla oli mahdollisuus etsiä tietoja yli 700 palvelimen sisältämistä laajoista tietokannoista ympäri maailmaa ilman oikeusistuimen ennakkolupaa. XKeyscore vakoiluohjelma keräsi internetistä tiedustelutietoa päivittäin yli 20 teratavua, joista kertyi niin suuri tietomäärä, että sitä oli mahdollista säilyttää vain noin kolmesta viiteen päivään. Metatietoja voitiin säilyttää noin 30 päivän ajan.

Ajoittain vakoiluohjelman keräämän tiedustelutiedon määrä nousi niin suureksi, että se oli mahdollista tallentaa vain 24 tunnin ajaksi. Tämän ongelman NSA ratkaisi toteuttamalla monitasoisia järjestelmiä, joihin analyytikot pystyivät itse tallentamaan mielenkiintoiseksi katsomiaan tietoaineistoja. Yksi tällainen järjestelmä oli nimeltään Pinwale, johon pystyi tallentamaan tiedusteluaineistoa enintään viideksi vuodeksi.

NSA:n lisäksi vakoiluohjelmassa olivat mukana Australian Defence Signals Directorate ja Uuden-Seelannin hallituksen Communications Security Bureau, joiden signaalitiedusteluasemien keräämiin tietoihin vakoiluohjelma pääasiassa rakentui. Neljä signaalitiedusteluasemaa sijaitsee Australiassa ja yksi Uudessa-Seelannissa.
 

  • Pine Gap lähellä Alice Springsiä

  • Shoal Bay lähellä Darwinia

  • ADSCS Geraldton

  • HMAS Harman Canberran ulkopuolella

  • GCSB Waihopai Uudessa-Seelannissa.

Saksan tiedustelupalvelut BND ja BFV käyttivät myös XKeyscorea. BND:tä pidetäänkin NSA:n kaikkein tuotteliaimpana tiedonkeruun kumppanina. Lähteet: (theguardian.com 31.7.2013, theverge.com 31.7.2013, huffingtonpost.com 31.7.2013)

Amerikkalaisten ongelmana näytti olevan se, että NSA ylläpitää teleoperaattoreiden lisäksi tai niiden puolesta televalvontaan käytettäviä mittavia lokitietokantoja. Järjestely tarjoaa NSA:lle, CIA:lle ja FBI:lle kontrolloimattoman ympäristön myös Yhdysvaltojen kansalaisten televalvontatietojen käyttöön.

Yleensä asia on ratkaistu niin (esimerkiksi Suomessa), että tiedustelupalvelun sijaan teleoperaattorit ylläpitävät itse televalvontaan käytettäviä lokitietokantoja ja luovuttavat niistä tietoja viranomaisille vain oikeuden päätöksellä. Tässäkin järjestelmässä on heikkoutensa. Esimerkiksi hyvä veli -verkosto, johon tukeutuen voi tietoja saada ”ystävän” avustuksella myös oikeudettomasti.

NSA:n vastuulla on myös kansallisesti tärkeiden tietojärjestelmien ja turvaluokiteltujen tietojen turvaaminen, salausalgoritmien kehittäminen ja salattujen viestien purkaminen. Yhdysvaltain lainsäädännön perusteella NSA voi salakuunnella viestiliikennettä Yhdysvaltain ulkopuolella ja Yhdysvaltoihin tulevaa viestiliikennettä.
 


 - pelontorjunta | Kommentoi



 Kursk eli kuinka länsi auttoi Stalinia voittamaan sodan
16.03.2011 09:19 | pelontorjunta

 

Historiantutkimus tuskin ansaitsee eksaktin tieteen arvoa vaan se on luokiteltava pikemminkin yhdessä esimerkiksi taloustieteen kanssa ns. pseudotieteiksi. Sillä näyttää olevan esim. taloustieteen tavoin taipumus vetää puoleensa hyvin vajavaisia kykyjä päinvastoin kuin esimerkiksi eksaktimmat tieteet (matematiikka, fysiikka, kemia, luonnontieteet, lääketiede jne). Pahin kaikesta lienee sotahistoria. Jos tähän epäeksaktiin ”tieteen” alaan yhdistyy vielä politiikka, ideologia kuten esimerkiksi marxismi-leninismi kaikkine selityksineen ”historiallisesta vääjäämättömyydestä” alkaa palikat olla kasassa jotta voimme ymmärtää miten toisen maailmansodan eräitä taisteluja ja ”käännekohtia” sekä niiden seurauksia selitetään väärin.

Stalinin Neuvostoliiton pseudotodellisuuden käsittämiseen tarvitaan suorastaan yliluonnollisia kykyjä. On kiinnostavaa että juuri Neuvostoliiton luonteen ymmärtämiseksi luotu oma erityinen ”tieteenala” nimeltään sovjetologia (tai kremlogia) epäonnistui ehkä kaikkein surkeimmin analysoimasta ja ennakoimasta koko valtion luhistumista noin neljä vuosikymmentä toisen maailmansodan jälkeen. Tarinaa oli helpompi uskoa sillä todellisuus oli aivan uskomaton.

 

Hitlerin Saksan ja Stalinin Neuvostoliiton voimasuhteet

 

Virallisen historiankirjoituksen mukaan Hitler aloitti hyökkäyksen Neuvostoliittoon kesäkuun 21.päivänä ja sota yllätti Neuvostoliiton ja sen johtajat totaalisesti. Todellisuudessa Neuvostoliitto oli kuukausi kuukaudelta lisännyt sotilaallisia valmiuksia aloittaa OMAN HYÖKKÄKSENSÄ Saksaan (sekä Romaniaan, Unkariin ja Suomeen) hieman myöhempänä ajankohtana. Historioitsijat ovat spekuloineet tästä eteenkin Neuvostoliiton hajoamisen jälkeen eikä yhteistä näkemystä asiasta löydy. Ainoa asia joka on varma liittyy siihen että offensiivivalmistelut olivat pitkällä ja että Neuvostoliitto ei edes tuntenut puolustusstrategiaa. Marxilaisen luokkasotadoktriinin mukaisesti taistelut alkaisivat aina vihollisen maaperällä.

Sodan puhjettua aloitti Stalinin lopulta hyvin menestyksellinen operaation historiankirjoittamisessa. Vuoden 1941 lopulla hän väitti mm. Saksan kärsineen ” neljän ja puolen miljoonan sotilaan tappiot” kaatuneina ja kadonneina. Samalla hän aloitti sittemmin vakiintuneeksi tavaksi muodostuneen väitteensä ”Neuvostoliiton loppumattomista resursseista”. Suorastaan hämmästyttävällä tavalla hän sai lähes koko maailman uskomaan tähän väitteeseen. Sodan lopputuloksen vuoksi Stalinin väitteet suorastaan kanonisoitiin.

Historiantutkimuksen kannalta Stalin väite Neuvostoliiton ”loppumattomista resursseista” voidaan kumota lopulta aika selvillä tilastollisilla tosiasioilla. Ne näet osoittavat että Stalinilla oli lopultakin vain kaksinkertainen määrä ”tykinruokaa” uhrattavana Hitlerin Suur-Saksaan verrattuna. Stalinin aikana väestötilastot, kuten tilastot yleensäkin kirjoitettiin vastaamaan Stalinin määrittelemää todellisuutta. Ikävien tosiasioiden tuojat joko ammuttiin ja vangittiin. Niinpä 1930-luvun suuren väestölaskennan surullinen tulos: 160 miljoonaa asukasta muutettiin vastaamaan paremmin pseudotodellisuutta.

Nykyisin riippumattomat uskottavat tutkimukset arvioivat Neuvostoliiton väkiluvuksi sodan puhjettua (1939) noin 167-170 miljoonaa asukasta. Hitlerin Suur-Saksan väkiluku Itävallan, Sudeettialueen sekä muiden Kolmannen Valtakunnan ulkopuolisten saksalaisalueiden liitosten myötä oli runsaasti yli 80 miljoonan. Kolmannen Valtakunnan ulkopuolella asui nimittäin noin 10 miljoonaa etnistä saksalaista. Näiden ulkosaksalaisten miesten ylivoimainen enemmistö palveli Suur-Saksan asevoimissa (kuten vaikkapa Waffen SS:ssä) siinä kuin Saksan ja Itävallan miehetkin.

Ensimmäinen suuri harha johon historioitsijat ovat juuri langenneet itärintaman tapahtumia analysoidessaan liittyy väestösuhteeseen sekä siihen että Stalinilla ei suinkaan ollut ”loppumattomia resursseja”. Stalin ei saanut menettää taistelukentillä enempää kuin kaksinkertaisen määrän miehiä Hitleriin verrattuna. Lisäksi Hitlerillä oli takana mm. Tsekin ja Ranskan teollisuustyöntekijät sekä miljoonat sotavangit. Stalinilla oli vajaan 170 miljoonan väestö josta isovenäläisten määrä ei ollut kovinkaan paljon suurempi kuin ns. etniset saksalaiset Euroopassa.

Neuvostoliiton diktaattorille väestön kirjavuus muodosti ongelman. Niinpä hänen apparaattinsa löi aikaisessa vaiheessa mystisen käsitteen nimeltään ”neuvostokansa”. Kun Hitler sitten hyökkäsi ja valtasi muutamassa kuukaudessa lähes koko läntisen historiallisen Venäjän romahti koko myytti ”neuvostokansasta” kasaan. Suuri osa, todennäköisesti enemmistö läntisten provinssien väestöstä otti saksalaiset vastaan vapauttajina. Osoittautui ettei sellaista eläintä kuin ”neuvostokansalainen” ollut olemassakaan. Ei varsinkaan läntisissä provinsseissa. Näissä provinsseissa alkoi todellisuudessa eräänlainen sisällissotaa muistuttava tilanne: eri kansallisuudet aloittivat selvittelemään välejään. Uhriksi joutuivat eteenkin juutalaiset jotka olivatkin olleet hanakoita bolsheviikkien liittolaisia paitsi sisällissodan vuosina 1918-22, puhdistuksen vuosina 1936-38 mutta myös Puolan itäosien sekä Baltian miehityksen aikaan 1939-41. Sodan jälkeen tästä kiusallisesta tosiasiasta ei haluttu puhua Ukrainassa, Valko-Venäjällä, Puolan itäosissa, Baltiassa eikä Venäjän läntisissä osissa.

Teollisen ja taloudellisen kapasiteetin osalta Stalinilla ei ollut juuri mitään yliotetta Saksaan verrattuna, öljyä lukuun ottamatta. Sen minkä hän määrässä voitti (eteenkin sodan alkuvaiheessa 1939-41) sen hän laadussa hävisi aina. Neuvostoliitolla oli hieman ennen Operaatio Barbarossaa käytössään tykistö, panssarikalusto sekä lentovoimat jotka määrällisesti olivat ehkä jopa kaksi kertaa suuremmat kuin koko muulla maailmalla yhteensä. Sen laatu sekä ennen kaikkea kaluston käyttäjien osaaminen oli taas toinen juttu.

Sodan alkuvaiheessa Suur-Saksan asetuotanto oli itse asiassa yllättävän matalalla tasolla joka ei kyllä viitannut minkäänlaisiin pyrkimyksiin maailmanvalloituksesta. Itse asiassa Saksan asetuotanto pääsi täyteen vauhtiin vasta siinä vaiheessa kun se alkoi menettää valtaamiaan alueita. Neuvostoliitto kykeni myös vuosi sen jälkeen kun sen teollisuus oli mobilisoitu läntisistä provinsseista itään lisäämään sotatuotantoaan. Mutta määrällisesti näytti Suur-Saksa kykenevän kasvattamaan tuotantoaan Neuvostoliittoa nopeammin. Päinvastoin kuin mitä Stalin väitti Saksa ei suinkaan ollut heikkenemässä vuosina 1942 ja 1943 vaan vahvistumassa. Kurskin taistelun aikoihin kesällä 1943 oli Saksan asevoimilla idässä sen siihen asti tehokkaimmat ja tulivoimaisimmat yksiköt. Vaikka Neuvostoliiton asevoimien kalusto ja sotilaiden osaaminen oli parantunut sodan alkuvaiheeseen verrattuna on omituista kuinka historioitsijat eivät havaitse Saksan asevoimien tulivoiman ja yleisen teknisen tason huomattavaa nousua esimerkiksi vuosiin 1940-41 verrattuna.

 

Talvi 1942-43 ja sen vaietut taistelut

 

Stalinistinen sotahistoria ei tunne talven 1942-43 taistelujen osalta mitään muuta kuin Stalingradin taistelun. Kaikki ennen vuotta 1991 kirjoitetut historiankirjat eivät lännessäkään tunteneet tuon talven osalta muuta kuin sen tutun kertomuksen jossa Saksan asevoimat kärsivät valtavan tappion Stalingradissa. Harvat kriittiset tutkijat vaivautuivat miettimään miksi ne muut 2,5 miljoonaa saksalaista ja noin 4 miljoonaa puna-armeijan sotilasta olisi tuon talven seisoneet toimettomina samanaikaan kun Volgan rannalla käytiin taistelua elämästä ja kuolemasta.

Vasta viimeisen kahden vuosikymmenen aikana on paljastunut että tuo talvi lienee ollut koko toisen maailmansodan verisin kautta koko itärintaman (Leningradin aluetta lukuunottamatta). Kaikkiaan neljä suurta puna-armeijan ”planetaarista” offensiivia: Mars, Jupiter, Uranus ja Saturnus suoritettiin tuon talven aikana. Stalingradin taistelu oli vain osa Operaatio Uranusta. Stalingradissa Stalin saavutti selkeän voiton.

Syy miksi kaikki muut operaatiot, mukaan lukien Uranuksen jälkimmäinen puolisko häipyivät historian hämärään tai niistä kirjoitettiin lopulta aika vähän johtui niiden lopputuloksesta. Niissä saksalaiset saavuttivat ankarissa olosuhteissa joko torjuntavoitot tai kuten Harkovin osalta suorastaan musertavan vastahyökkäyksen kautta saavutetun täydellisen voiton.

Samaan aikaan kun saksalaiset kärsivät Stalingradissa tappion, kärsi puna-armeijan marsalkka Zhukov valtavan tappion ns. Rhzevin taisteluissa rintaman pohjoisella sivustalla. Vasta 1990-luvulla paljastuneet tiedot viittaavat selvästi siihen, että Rhzev, ei suinkaan Stalingrad, oli puna-armeijan talven suuroperaatioiden keskeisin kohde. Sinne kohdistettiin suuremmat joukot kuin Stalingradin ympäristöön. Toistuvilla massahyökkäyksillä tapatti Zukov kymmeniä tuhansia omia sotilaitaan saavuttamatta mitään sotilaallista ratkaisua. Rhzevin lisäksi Stalinin tavoitteena oli saada todellinen jättipotti: tuhota myös koko Saksan eteläinen armeijaryhmä. Tämä ei onnistunut koska Saksan asevoimat kykenivät reagoimaan riittävän ajoissa tähän uhkaan ja koska puna-armeija taisteli hyvin kaavamaisella tavalla kuten aiemminkin. Itse asiassa on luultavaa että kenraali Pauluksen heikko reagointikyky ja muutaman oleellisen tärkeän tulivoimaisen saksalaisen panssariyhtymän (mm. SS Leibstandarte divisioona) siirtäminen länteen ja Välimeren suuntaan saattoi ratkaista Saksan 6.armeijan kohtalon Volgalla.

Talven 1942-43 verilöyly oli jo niin pyörryttävä että Stalin ensimmäisen kerran kuunteli ylimpiä rintamakomentajiaan ja suostui keväällä 1943 siihen että puna-armeija asettuu puolustusasemiin. Oli pakko sillä hän oli mielettömillä jatkuvilla rintamahyökkäyksillään ajanut puna-armeijan konkurssitilaan ja menettänyt suurimman osan panssarikalustoaan. Saksan osalta tilanne oli toinen: heillä oli keväällä 1943 enemmän panssarikalustoa kuin syksyllä 1942 ja mikä merkittävämpää: se oli tulivoimaisempaa ja tasokkaampaa kuin koskaan aiemmin.

 

Saksan kasvava voima ja tulivoimaiset uudet panssariyhtymät

 

Sotilaallisia voimasuhteita mitataan määrällisesti usein vain pääyhtymien kuten divisioonien määrillä. Saksan koko asevoimien miesmäärä kasvoi vuodesta 1942 vuoteen 1942 noin 10%:lla kun taas Neuvostoliiton asevoimien sotilaiden määrä (virallisen tiedon mukaan) kasvoi vain 5%:lla. Stalinin uusi tykinruoka näytti myös heikommalta kuin aiempi aines. Niitä oli mm. teini-ikäiset pojat (14-16 vuotiaat), vanhat miehet (jopa 60-vuotiaat), naiset (noin miljoona sotilasta), vähemmistökansallisuudet (helpommin alttiita antautumaan, haluttomia sotaan kuten esim. muslimit) sekä toipilaat (jotka länsimaisten määrityksien mukaan eivät olisi kelvanneet edes huoltotehtäviin).

Saksan sotilaiden lukumäärän kasvun myötä asevoimien tulivoima kasvoi myös uusien panssarivaunujen Tiger I, Panther ja modernisoitu Pzkw IV kautta. Mutta tässä ei vielä kaikki. Sodan alkuvaiheen jälkeen kasvoi panssareita vielä nopeammin ns. rynnäkkötykkien, panssarintuhoajavaunujen sekä telalavettisten tykkien tuotanto. Jo vuonna 1942 oli eräillä saksalaisilla yksiköillä asettaa jalkaväen tueksi painopistesuunnille omat rynnäkkötykkiyksikkönsä. Näin saksalaiset divisioonat ja armeijakunnat eivät aina olleet riippuvaisia ilmatuesta kohdatessaan puna-armeijan bunkkeriasemia sekä raskaita panssarivaunuja.

Vuonna 1943 kehitys johti jo siihen että yhä suurempi osa ja eteenkin kaikkein uusimmasta kalustosta annettiin ensin – ei tavallisille panssaridivisioonille – vaan erillisille ns. Abteilungen yksiköille sekä ns. eliittidivisioonille joita olivat mm. Wehrmahctin Grossdeutschland-divisioona sekä lukuisat SS Leibstandarte-divisioonan kaltaiset Waffen SS:n panssaridivisioonat. Tällaisten tulivoimaisten yksikköjen etuna oli vielä verraton liikkuvuus, sillä sen sotilaat liikkuivat usein panssaroiduilla kuljetusvaunuilla ja sen kenttätykit olivat telalavettisia. Sen sijaan Saksan tavalliset jalkaväkidivisioonat muuttuivat yhä enemmän ns. bulkkidivisiooniksi. Saksalaisen operatiivinen voima lepäisi yhä enemmän siis näissä eliittijoukoissa. Ne tekivät tuhoisat vastaiskut ja ne vastasivat kiivaissa vastarintatilanteissa siitä että vihollinen ei tehnyt suurta läpimurtoa. Esim. Rhzevin taistelussa Grossdeutschlandin kaltaisella valioyksiköllä oli jopa ratkaisevan tärkeä merkitys. Tällaisen superdivisioonan puuttuminen (SS Leibstandarte) saattoi olla ainakin tärkeä osasyy miksi Pauluksen armeija antautui Stalingradissa. Taktiikkakartalla nämä superdivisioonat esitettiin usein vain moottoroituina divisioonina mutta todellisuudessa niiden sotilaallinen suorituskyky vastasi helposti vähintäin puna-armeijan panssariarmeijakuntaa.

 

Osapuolten menetykset ennen Kurskin taistelua

 

Neuvostoliittolainen pseudotodellisuus muokkasi sodan tappiotilastot vastaamaan sitä propagandaväitettä jonka mukaan imperiumi kärsi sodan alussa raskaita tappioita koska ”isänmaa yllätettiin” mutta että sodan kuluessa puna-armeija taisteli kuukausi kuukaudelta yhä paremmin, tehokkaammin, menestyksellisemmin ja pienemmin tappioin. Tämä Stalinin teesi upposi myös länsimaisiin historioitsijoihin siitä yksinkertaisesta syystä että puna-armeija marssi toukokuussa 1945 Berliiniin. Mutta väite puna-armeijan sotilaallisesta suorituskyvyn merkittävästä paranemisesta on aika kyseenalainen mikäli luotamme jopa neuvostoliittolaisiin hyvin epäilyttäviin omiin tappiotilastoihinkin. Krivosheevin mukaan vuoden 1941 aikana (21.6-31.12) neuvostosotilaita kaatui tai katosi 2 993 803. Valtava tappio mutta ei pidä missään tapauksessa paikkaansa sillä joulukuun loppuun mennessä saksalaiset ilmoittivat saaneensa pelkästään sotavankeja noin miljoona enemmän.

Virallinen neuvostoliittolainen sotahistoria antaa vuodelle 1942 tappiolukemat (kaatuneet ja kadonneet) jotka Krivosheev on laskenut lähes täsmälleen yhtä suuriksi kuin vuoden 1941 tappiot – 2 993 536 sotilasta. Laskelmissa on kuitenkin se omituinen piirre että ne painottuvat tammi-syyskuulle kun taas taistelujen kiihdyttyä loka-joulukuussa neuvostoliittolaisten tappiot itse asiassa mystisellä tavalla taas pienenevät. Vuoden 1943 ensimmäisen vuosipuoliskon tilastojen mukaan Neuvostoliitto olisi menettänyt omissa virallisissa laskelmissaan 781 575 sotilasta kaatuneina ja kadonneina.

Neuvostoliiton tappiot 1941-43 (virallinen neuvostoliittolainen ”totuus”)

1941: …...................... 2 993 803

1942: …...................... 2 993 536

1943 ennen Kurskia.......... 781 575

1943 heinä-syyskuu.......... 694 465

Virallisen neuvostoliittolaisen laskelman mukaan Stalin oli menettänyt 6 768 914 sotilasta kaatuneina ja kadonneina ennen Kurskin taistelujen alkua. Syyskuun loppuun mennessä tappioiksi ilmoitetaan 7 463 379 sotilasta.

Saksalla puolestaan oli erittäin tarkat ja luotettavat tilastot omista tappioistaan itärintamalla aivan kuten länsiliittoutuneilla ja mm. suomalaisilla omista tappioistaan. Näiden tilastojen mukaan Saksa oli menettänyt vuoden 1943 elokuun loppuun mennessä itärintamalla 559 260 kaatunutta ja 356 939 kadonnutta sotilasta eli yhteensä 916 199 sotilasta. Tämä siis Kurskin ja muiden heinä-elokuussa käytyjen taistelujen jälkeen.

Vaikka luottaisimme sellaisenaan neuvostoliittolaisiin hyvin kyseenalaisiin tilastoihin päädymme tulokseen jonka mukaan Neuvostoliitto oli menettänyt itärintamalla 7-8 kertaa enemmän sotilaita syksyyn 1943 mennessä kuin Saksa. Suur-Saksan ja Neuvostoliiton väestösuhde puolestaan oli vain 1:2. Stalin menetti siis 3-4 kertaa enemmän sotilaitaan kuin olisi ollut suotavaa. Tätä taustaa vasten oli ymmärrettävää miksi hän vaatimalla vaati länsiliittoutuneilta ”uusia rintamia” vaikka niitä jo oli olemassa ja miksi hänen armeijassaan oli rintamataistelijoina yhä enemmän nuoria poikia, vanhoja ukkoja, naisia sekä vankileirien miehiä.

Toki Saksa oli kärsinyt tappioita myös länsirintamalla vuoden 1943 kevääseen mennessä. Ne olivat kuitenkin rajoittuneet vuoden 1940 Ranskan sotaretkeen sekä Pohjois-Afrikan taisteluihin. Ja niiden osuus oli kuitenkin vain n. 12-13% itärintaman sen hetkisistä tappioista. Näistä menetyksistä merkittävin oli ilman muuta Tunisiassa keväällä 1943 tapahtunut joukkoantautuminen ja eteenkin siellä vangiksi joutuneet panssarimiehistöt ja tuhoutuneet uudet panssarit. Saksan asevoimien miesvahvuus oli kuitenkin noussut kahdessa vuodessa noin kahdella miljoonalla, panssarikaluston määrä oli kasvussa ja taso aivan toista luokkaa kuin vuonna 1941. Hitlerin sotilaallinen voima keväällä 1943 oli kaikkea muuta kuin hiipumassa.

 

Kurskin taistelu

 

Itse Kurskin taistelu on abstraktinen käsite. Ei ollut olemassa mitään erityistä yksittäistä paikkaa missä taistelut käytiin. Saksalaiset tiesivät sen miten pahasti puna-armeija oli saanut selkäänsä edellisinä kuukausina ja että puna-armeijan oli rakennettava uudestaan hyökkäysvoimansa. Tähän Stalinilla oli hyvät mahdollisuudet sillä vuonna 1943 hän alkoi saada kiihtyvällä tahdilla sotilasmateriaalia ja muuta sodankäynnin kannalta merkittävää täydennystä länsiliittoutuneilta. Samaan aikaan Saksan asemat heikkenivät Pohjois-Afrikassa joka johti lopulta keväällä saksalaisten antautumiseen Tunisiassa (74 000 saksalaista). Nämä sotilaat eivät lisäksi olleet Pauluksen 6.armeijan tapaisia bulkkidivisioonia vaan motorisoituja ja panssaroituja yksikköjä sekä Luftwaffen hyvin koulutettua henkilöstöä. Samalla antautui Italian Afrikassa ollut armeija, maan parhaiten varustettu asevoima.

Hitler ja hänen kenraalinsa tiesivät keväällä että nyt oli lyhyt aika käyttää sotilaalliseen suureen voittoon idässä ennen kuin länsiliittoutuneiden panos alkaisi täydellä voimalla vaikuttaa sotatapahtumiin myös siellä. Saksan asevoimat suunnittelivat sotilaallisen operaation jossa kahdella kaukana toisistaan erillä olleilla pihtiliikkeellä ajetaan puna-armeijan joukot ansaan. Puna-armeijan ylin johto tiesi sen minkä kaikki ammattisotilaat missä hyökkäys tapahtuisi. Saksalaiset tiesivät myös ettei yllätysmomenttia ollut. Nyt ratkaisisi ennen kaikkea aseet ja niitä käyttävien sotilaiden osaamistaso.

Puna-armeijan puolustuksellinen ja vastahyökkäyksellinen painopiste oli Kurskin pullistuman pohjoisella sektorilla jossa heitä vastassa oli Walther Modelin johtamat saksalaiset. Sinne marsalkka Zukov oli suunnitellut voimakkaan vastahyökkäyksen. Saksalaisten todellinen päähyökkäys ei kuitenkaan tapahtuisi pohjoisessa Modelin lohkolla vaan noin 200 kilometriä etelämpänä. Sinne oli koottu Erich von Mansteinin johtamat saksalaisten päävoimat. Ja nimenomaan tälle sektorille keskitettiin saksalaisten ns. superyksiköiden selvä enemmistö – neljä Waffen SS:n erittäin tulivoimaista panssaroitua ja motorisoitua valiodivisioonaa sekä Wehrmachtin tulivoimainen Grossdeutschland-divisioona. Niitä tukivat lukuisat Tiger I ja Panther-panssarivaunuilla varustetut Abteilungen-yksiköt.

Huolimatta siitä että Modelilla oli vastassa kaikkein suurimmat puna-armeijan yksiköt, miinoitettu ja linnoitettu kenttäasema sekä hyökkäyksestä täysin tietoinen vihollinen, onnistui Model tunkeutumaan keskimäärin 15 kilometriä puolustuslinjan läpi. Seurasi odotettu puna-armeijan vastahyökkäys joka pysäytti Modelin hyökkäyksen täysin ja pakotti hänet suojaamaan uhatut sivustat pelättävissä olevan saarrostuksen vuoksi. Model erittäin kokeneena ammattisotilaana oli jo edellisenä talvena torjunut vastaavat vieläkin voimakkaammat hyökkäykset Rhzevin rintamalohkolla. Oli täysin selvää että hänellä ei ollut tässä tilanteessa selvällä alivoimalla mitään mahdollisuutta eteenpäin, mutta hän oli puolustussodankäynnin mestari.

Historiankirjoitus pysähtyy usein juuri tähän vaiheeseen ja esittää Kurskin taisteluna jossa Model kärsi tappion. Todellisuudessa oli tapahtumassa jotain aivan päinvastaista. Kaukana etelässä murskasivat von Mansteinin tulivoimaiset joukot koko puna-armeijan puolustuksen niin totaalisesti että rintamaan syntyi suuri aukko josta saksalaisten panssarikiilat aloittivat tunkeutumisen syvälle neuvostoliittolaisten selustaan. Saksalaiset ottivat ensimmäisenä päivänä myös ilmaherruuden.

Von Mansteinin tavoitteena oli Voronez. Nykyisen käytettävissä olevan tiedon perusteella näytti siltä että vastarinnan murskanneiden läpimurtautuneiden saksalaisten ja Voronezin välillä ei ollut enää varteenotettavaa lujaa puolustusta. Voronezin joutuminen saksalaisten haltuun olisi ajanut pohjoisessa Modelia ahdistelleet Zukovin armeijaryhmät kaaokseen, sulkeneet perääntymistiet, katkoneet huolto- ja täydennysreitit - romahduttaneet neuvostopuolustuksen totaalisesti.

Saksalaisten suunniteltu pihtiliike oli olosuhteiden pakosta muuttunut eräänlaiseksi vasara-alasin operaatioksi. Zukov uhkasi Modelia joka rajuun puolustustaisteluun tottuneena tiesi von Mansteinin läpimurron merkityksen etelässä. Neuvostoliittolaiset jäivät alasimen (Model) ja vasaran (von Manstein) väliin. Näytti siltä että kaksi vuotta sotimista saksalaisia vastaan ei ollut opettanut sen paremmin Stalinia kuin Zukoviakaan yhtään. Saksalaisten liikkuvien motorisoitujen valiodivisioonien tulivoima ja operatiivinen tehokkuus tuli ikävänä yllätyksenä puna-armeijalle. Oli syntymässä jälleen kesän 1941 kaltainen neuvostoliittolainen katastrofi.

 

Hitler keskeyttää hyökkäyksen

 

Kesken taistelun kriittisen vaiheen 12.heinäkuuta 1943 tuli Erich von Mansteinille varsin epämiellyttävä viesti Saksan valtakunnanjohtajalta Adolf Hitleriltä. Johtaja kutsui Mansteinin päämajaansa neuvotteluihin. Erikoista tässä oli se että vastaavaa kutsua ei tullut operaation toisen johtajalle Modelille.

Neuvotteluissa Hitler vaati hyökkäyksen pysäyttämistä. Syyksi hän ilmoitti tapahtumat Välimerellä. Erich von Mansteinin mukaan:

”Neuvottelu 13. heinäkuuta alkoi Hitlerin ilmoituksella, että tilanne Sisiliassa, minne länsivallat olivat 10. heinäkuuta tehneet maihinnousun, oli muuttunut vakavaksi. Italialaiset eivät taistelleet ylipäänsä lainkaan. --

Minä puolestani ilmoitin, että - mitä eteläiseen armeijaryhmään tulee - taistelu on nyt tullut ratkaisukohtaan. Viime päivinä vastustajan taisteluun heittämistä, lähes kaikista operatiivisista reserveistä saavutettujen torjuntamenestysten jälkeen voitto on ilmeisen lähellä. Taistelun keskeyttäminen tässä vaiheessa merkitsisi todennäköisesti voitosta luopumista!

Jos 9. armeija [Model] ainakin toistaiseksi sitoisi vastassaan olevat vihollisjoukot ja aloittaisi ehkä myöhemmin hyökkäyksen uudelleen, niin me yrittäisimme aluksi lyödä lopullisesti armeijoittemme kanssa parhaillaan taistelevat ja jo huomattavasti heikentyneet vihollisryhmät. Sen jälkeen armeijaryhmä aloittaisi - kuten jo 12. heinäkuuta OKH:lle ilmoitettiin - uudelleen etenemisen pohjoiseen ja ylittäisi kahdella armeijakunnalla Psjolin Obojanin itäpuolelta pakottaakseen sitten, länteen kaartaen, Kurskin mutkan länsiosassa olevat vastustajan joukot taistelemaan käännetyssä rintamassa. Jotta tämä operaatio voitaisiin hyökkäävästi varmistaa pohjoiseen ja itään, 24. panssariarmeijakunta täytyisi nyt heti alistaa armeijaosasto Kempfille.”

Hitler ei suostunut jatkamaan hyökkäystä. Mitkään saksalaislähteet eivät heinäkuun puolivälissä 1943 viittaa siihen että Modelin joukot pohjoisessa olisivat olleet romahtamassa. Model taisteli Rhzevissä huomattavasti kovemmasta ahdinkotilanteesta torjuntavoittoon. Kurskin taistelujen tässä vaiheessa saksalaisilla oli myös ilmaherruus. Puna-armeijan panssaritappiot niin pohjoisessa kuin varsinkin etelässä olivat valtavat – virallistenkin neuvostolähteiden mukaan kuusi kertaa suuremmat kuin saksalaisten, todellisuudessa vieläkin suuremmat. Lisäksi saksalaiset korjasivat huoltoa tarvitsevat hyökkäysvaununsa nopeammin kuin puna-armeija.

Miksi Hitler keskeytti hyökkäyksen joka kaikesta päätellen näytti johtavan saksalaiset menestykseen ja aiheuttavan Zukoville jälleen kerran nöyryyttävän tappion?

 

Hitler pelkäsi länsiliittoutuneita enemmän kuin puna-armeijaa

 

Toisen maailmansodan historiasta kirjoittavat saksalaiset ammattisotilaat näyttävät tuon tuostakin vapauttavan itsensä vastuusta. Yleinen trendi näyttää olevan se että Stalinia eivät koske esim. ilmastolliset ongelmat kuten saksalaisia. Liejusta ja talvesta ei ollut ongelmia puna-armeijalla, vain saksalaisille. Vielä useammin he näyttävät sälyttävän kaikki epäonnistumiset Hitlerin syyksi. Kaikki epäonnistumiset johtuivat siitä että Hitler, tämä keskinkertainen korpraali munasi kaiken. Sen sijaan saksalaisten onnistuneet operaatiot olivat aina kenraalien ansiota.

Hitler ensimmäisen maailmansodan rintamaveteraanina näytti puolestaan luottavan saksalaiseen sotilaaseen ja hänen kestokykyynsä ja tehokkuuteensa enemmän kuin hänen kenraalinsa. Toisaalta hän ei suinkaan ollut niin joustamaton kuin yleensä väitetään. Hän hyväksyi perääntymiset jos hän katsoi sen välttämättömäksi. Hitlerin mielestä hänen kenraalinsa eivät ymmärtäneet sodan taloudellisista tekijöistä (esim. raaka-ainevarannot) mitään.

On myös merkillepantavaa miten Hitler koko sodan aikana reagoi herkästi ja ennakoivasti uhkiin oli ne sitten todellisia tai kuviteltuja. Hän reagoi Ranskan ja Britannian haluun sotkeutua Suomen talvisotaan miehittämällä nopeasti Tanskan ja Norjan keväällä 1940. Hän siirsi Dieppen brittien maihinnoususpektaakkelin seurauksena välittömästi merkittäviä saksalaisia panssariosastoja (mm. Waffen SS:n Leibstandarten) länteen syksyllä 1942. Tämä valiodivisioona oli siten poissa Stalingradin suunnalta. Hän siirsi Britannian Välimeren operaatioiden pelossa Kreetan saarelle erään parhaimmista jalkaväkidivisioonistaan. Siellä tämä yksikkö olikin sitten melkein koko sodan ajan. Hän siirsi Pohjois-Afrikkaan lisää tulivoimaisia panssariyksikköjä amerikkalaisten noustessa loppuvuodesta 1942 maihin.

Keväällä 1943 Tunisiassa tapahtuneen saksalais-italialaisen joukkoantautumisen jälkeen Hitler seurasi herkeämättä länsiliittoutuneiden toimija. Heinäkuun alkupuolella sotilaallinen ja poliittinen tilanne Italiassa kehittyi siihen suuntaan että Hitler halusi sinne lisää saksalaisia joukkoja sillä hän – täysin oikein – arvioi että italialaiset eivät torjuisi länsiliittoutuneiden maihinnousua niemimaalle vaan ”juoksisivat karkuun”. Hän halusi lisää saksalaisia joukkoja ei vain Italiaan vaan myös Balkanille sillä hän pelkäsi länsiliittoutuneiden nousevan maihin ja pyrkivän ottamaan tai tuhoamaan Romanian öljykentät. Hän halusi sinne saksalaisia sotavoimia ja panssarikalustoa. Ja niitä oli otettavissa vain itärintamalta.

Tämä Hitlerin herkkyys reagoida länsiliittoutuneiden toimiin – kuviteltuihin tai todellisiin – kertoi siitä että hän arvosti näiden sotilaallista osaamistasoa aivan eri tavalla kuin puna-armeijan vastaavaa. Siksi hän oli valmis keskeyttämään hyökkäyksen Kurskin rintamalla. Hänen arvionsa lähti siitä että Saksan sotavoimat heikentyneenäkin hyvän taistelumoraalinsa ja osaamisensa ansiosta aiheuttavat Stalinin asevoimille torjuntataisteluissa niin suuret tappiot että puna-armeijan tykinruoka loppuu aikaisemmin kuin Saksan jolloin Saksa saa idässä vähintäin tasapelitilanteen. Tappiotilastot syksyyn 1943 asti (ja sen jälkeenkin) tukivat Hitlerin näkemystä. Neuvostoliitto ei edes sodan loppuvaiheessa päässyt lähellekään 1:2 tappiosuhdetta. Saksan johtajan näkemys jonka mukaan länsiliittoutuneet olivat sotivana osapuolena huomattavasti tasokkaampi kuin lukumääräisesti suuri Neuvostoliiton asevoima perustui faktoihin.

Heinäkuun puolivälissä Hitler näki miten pitkä matka Stalinilla oli Saksan valtakunnan rajoille asti. Sota tulisi maksamaan Neuvostoliitolle vielä vähintäin yhtä paljon sotilaita ja panssareita mitä verilöyly tähänkin asti oli tullut maksamaan. Ja loppukesään 1943 mennessä tuo hinta oli ollut Stalinin joukoille aivan hirveä. Neuvostoliiton omien kyseenalaistenkin virallisten tilastojen mukaan pelkästään vuosi 1943 olisi aiheuttanut 7,5 miljoonan sotilaan kokonaistappiot.

 

Miksi Kursk oli käännekohta?

 

Yleisen stalinistisen Suuren Isänmaallisen Sodan mytologian mukaan Stalingrad oli sodan käännekohta. Tämä on perustavissa vain siten että Saksa ei olisi kestänyt 90 000 sotilaan antautumista. Väite ontuu kun muistamme suurvaltojen väestösuhteen (1:2) ja sen että tuossa vaiheessa Stalin oli menettänyt ainakin 4,5 miljoonaa miestä pelkästään sotavankeina. Vielä horjuvampi on Stalingradin merkitys jos huomioidaan että puna-armeija kärsi samanaikaisesti tolkuttomissa verisissä hyökkäyksissä hirveät tappiot Rhzevistä aina Mustalle Merelle asti. Samat puna-armeijan divisioonat jotka julistettiin voittajaksi Stalingraidissa tuhoutuivat itse parin seuraavan kuukauden päästä. Verilöyly pyörrytti jopa Stalinia, mikä kertoi jo paljon talven 1942-43 taisteluista.

Kurskin operaatio (tai saksalaisittain Operaatio Zitadelle) ei suinkaan ollut mikään valtava tuhoamistaistelu joka päättyi lopulta puna-armeijan voittoon. Itse taistelujen tappiosaldot jopa panssareissa eivät eronneet edellisen talven suuroperaatioista. Karl-Heinz Frieserin mukaan puna-armeija menetti Operaatio Zitadellen keskeyttämiseen (16.7.43) mennessä 1 956 tuhoutunutta tai vallattua panssarivaunua ja rynnäkkötykkiä kun taas saksalaisten tappiot olisivat olleet 323. Taisteluissa kaatuneiden tai vangiksi otettujen määrä oli kymmeniä tuhansia eikä se missään suhteessa ollut poikkeuksellisen raju tai verinen. Sitä suurempia ja verisempiä taisteluja oli käyty itärintamalla ja tultaisiin käymään myöhemminkin.

Mutta yhdessä suhteessa Kursk oli käännekohta. Se oli viimeinen saksalaisten suurista kesäoffensiiveista itärintamalla. Italian tapahtuminen vuoksi sekä länsiliittoutuneiden kiihtyvän ilmasodan takia aloitti Hitler sotavoimien ohentamisen itärintamalta. Joukkoja ja kalustoa siirrettiin Italiaan, Balkanille ja länteen. Syksyllä 1943 jo peräti 65% Luftwaffen päivähävittäjistä taisteli pelkästään USA:n 8. Ilma-armeijaa vastaan (strategiset pommitukset). Zitadelle oli siten viimeinen operaatio idässä jossa Luftwaffella oli vielä ilmaherruus. Sen jälkeen sitä ei enää ollut. Kurskin jälkeen 25-30% itärintaman raskaista panssarivoimista (Abteilungen) siirrettiin etelään tai länteen.

Tämä kaikki tapahtui aikana jolloin länsiliittoutuneiden apu Stalinille (lend-lease) kasvoi kasvamistaan. Vuoden 1943 kesän jälkeen puna-armeija alkoi saada lisääntyvässä määrin sellaista kuljetuskalustoa että se, marsalkka Zukovin mukaan ”kykeni luomaan strategisia reservejä” ja ylipäätänsä ”jatkamaan sotaa”. Averell Harrimanin mukaan Stalin oli todennut Teheranin neuvotteluissa että ilman USA:n teollista kapasiteettia sotaa ei voitaisi voittaa. Länsiliittoutuneet tekivät puna-armeijasta liikkuvan sotavoiman.

 

Legenda, todellisuus ja lopputulos

 

Sodan aikana ja sen jälkeen Neuvostoliitossa alkoi huolellinen epämiellyttävien muistojen häivyttäminen. Rhez ja talven 1942-43 veriset epäonnistumiset katosivat yleisestä käsityksestä. Zukovilla siihen oli varmasti hyvät henkilökohtaiset syynsä. Jäi vain Stalingrad. Kursk selitettiin loistavana puna-armeijan voittona. Luotiin aivan poskettomia myyttejä valtavasta Prokhorovkan taistelusta tuhansine tankkeineen jossa saksalaiset tuhottiin. ”Tigers are burning”-kaltaiset läntiset kirjat osoittivat kuinka Stalinin legendat ja fantasiat läpäisivät jopa läntisen tajunnan. Kestostalinistit uskoivat siltä seisomalta kaikki nämä tarinat. Jopa saksalaiset (lukuun ottamatta asioista perillä olevia) uskoivat teoriat Stalingradin tai Kurskin käänteentekevyydestä.

Paljon tehtiin työtä länsiliittoutuneiden panoksen vähättelyssä. Esitettiin väitteitä jonka mukaan ”Neuvostoliitto lähes yksin löi Saksan”. Lend-leasen merkitystä vähäteltiin mm. sillä että se olisi ollut vain muutama prosentti Neuvostoliiton sotatuotannosta. Tosiasiassa – kuten Zukov tiedustelupalvelun haastattelussa mainitsi – Neuvostoliitto ei olisi kyennyt ilman tuota apua jatkamaan sotaa, liikuttamaan joukkojaan nopeasti ja luomaan strategisia reservejä. Veturit, kuljetuskalusto, radioteknologia ym. tuli lähes yksinomaan länsiavun myötä. Tässä sodassa hyvin ratkaisevaa oli se kenellä oli ilmaherruus. Saksan tappio idässä johtui suurelta osin Luftwaffen tappiosta lännessä; kun USA ja Britannia kykenivät sitomaan ja tuhoamaan Saksan ilma-aseen. Näin Saksa menetti ilmaherruuden myös idässä. Saksan panssaritappioista peräti 35% tuli taisteluissa länsiliittoutuneita vastaan vaikka maasodan päärintama oli aina idässä. Tämä viittaa länsiliittoutuneiden huomattavasti tehokkaampaan sodankäyntiin Neuvostoliittoon verrattuna.

Puolueettomat silminnäkijäkertomukset, kuvat ja ei-propagandistiset filmit osoittavat että puna-armeija erosi monessakin suhteessa länsiliittoutuneiden vastaavista sotavoimista. Se oli nukkavieru ja haiseva ryysyläisten armeija joka ruokki itsensä ryöstämällä ruokaa. Se teloitti omia sotilaitaan sitä tiheämmällä aikataululla mitä pitemmälle sota ehti. Se raiskasi naisia ikään ja kansallisuuteen katsomatta. Kaikki tämä kertoo jostain muusta kuin henkisesti ryhdikkäästä ja kurinalaisesta sotavoimasta. Sen tappiot esim. sodan loppuvaiheessa saksalaisia vastaan olivat hirveät. Kuukausikohtaisten panssarikalustotappioiden huippu saavutettiinkin vasta alkuvuonna 1945. Jos puna-armeijan sotilaat olivat jotain oppineet ei se näyttänyt ilmenevän taistelukentällä parantuneina suorituksina. Pelkästään Itä-Preussin valtaaminen maksoi puna-armeijalle sen omien kyseenalaisten tappiotilastojenkin mukaan yli 3 500 panssarivaunua ja rynnäkkötykkiä.

Sodan lopputulosta ei kannattaisi välittömästi arvioida taistelujen tauottua, sillä sodalla on pitkät varjot. Vuonna 1945 näytti siltä kuin Neuvostoliitto olisi hyvinkin ollut sodan suurin voittaja. Mutta vuoden 1991 jälkeen tätä harhakuvaa on jo vaikeampi ylläpitää. Luultavampaa on arvioida että molemmat diktatuurit – Stalinin ja Lenin luoma Neuvostoliitto sekä Hitlerin Saksa hävisivät sodan. Sama koski tietysti myös brittien imperiumia.

Neuvostoliitto ei koskaan toipunut verilöylystä koska se kiisti tosiasiat eikä tehnyt analyysin pohjalta tarvittavia johtopäätöksiä. Hitlerin sotakoneen aiheuttama tuho ja ehkä vielä enemmän Stalinin halukkuus toistuvilla älyttömillä rintamahyökkäyksillä tapattaa omia sotilaitaan aiheutti seuraukset jotka johtivat myöhemmin imperiumin luhistumiseen. Tuho kohdistui ennen kaikkea maan kehittyneimpään osaan ja iski eniten maan ”läntiseen” väestöön ja vähemmän esim. Keski-Aasian primitiivisiin muslimikansoihin.

Sota loi demografisen ongelman ja pulan työvoimasta, siirsi teollisuuden alueille joka maksimoi tehottomuutta. Prosessi jähmetti keskusvallan, tukahdutti kriittisyyden ja kanonisoi vallitsevan ”totuuden”. Avaruuden valloittaminen ja ohjukset on nähtävä modernina Potemkinin kulisseina, samanalaisina kuin ne ”sosialismin saavutuksen” kulissit jotka hämäsivät 1930-luvun lännen hyödylliset idiootit. Kylmän sodan kamppailu USA:n kanssa vain joudutti romahdusta. Senkin taustalla pilkisti illuusio ”omin voimin” voitetusta maailmansodasta. Koko imperiumi, sen mahtavuus ja vakaus oli rakennettu valheille.

Stalin oli yhdessä suhteessa aivan omaa luokkaansa. Hän osasi marxilaisena tarinan kertomisen taidon. Sen hän aloitti jo varhain. Hänellä oli verraton kyky ei ainoastaan luoda pilvilinnoja vaan houkutella ihmiset vielä asumaan niissä. Häkellyttävällä tavalla niin monet ja niin monissa maissa uskovat yhä näihin legendoihin. Se taas ei anna kovinkaan hyvää kuvaa historiantutkimuksesta yleensä eikä sotahistoriantutkimuksesta erityisesti. Eikä ihmisten kyvystä ottaa asioista selvää ja harrastaa loogista ajattelua.

 


( Päivitetty: 27.08.2013 15:29 )

 - pelontorjunta | Kommentit (1)Kommentoi



 Trayvon Martin - totuus jolta suljettiin silmät
14.02.2012 14:13 | pelontorjunta

Amerikan Yhdysvaltoja on kuohuttanut vuoden 2012 keväästä saakka tapaus jossa valkoihoinen latino ns. korttelivahti ampui aseettoman 17-vuotiaan afroamerikkalaisen pojan. Se ja oikeuden päätös vapauttaa korttelivahti George Zimmerman murhasyytteestä aiheutti maassa mielenosoituksia maan asehallintalakia sekä erityisesti Floridan ns. stand-your-ground käytäntöä kohtaan. Yleisesti ajateltiin että Zimmerman ei olisi koskaan ampunut Trayvon Martinia jos tämä olisi ollut valkoinen.

Se kuva mikä tapauksesta välittyy valtamedian kautta on kiistatta hämmentävä. Zimmermania ei aluksi edes pidätetty vaan pidättäminen tapahtui vasta noin kuukautta myöhemmin kun tapaus nostettiin julkisuuteen. Media alkoi tehdä vertailuja vuonna 1955 Mississipissä lynkatun Emmett Tillin ja Floridan Sanfordissa ammutun Trayvon Martinin välillä. ”Modernin ajan lynkkaus” oli usein esitetty vertaus. Martin esitettiin tavallisena mustana nuorena poikana joka oli ollut vain ostamassa virvoitusjuomaa ja karamelleja kun hänet ampui ”liipasinhullu korttelivahti”. Ei ihme että USA:ssa ja maan rajojen ulkopuolella asiaa hämmästeltiin. Kuinka mustan presidentin aikakautena kun ”rasismi on jo historiaa” voisi tapahtua vielä jotain tällaista?

 

Median valtavirran antama kuva

 

Hyvän käsityksen siitä miten USA:n poliittisesti korrekti valtamedia esitti yleisölle tapauksen on esim. New York Timesin toimittajan Charles Blowin kuvaus:

”Pojan veri oli valunut sateesta märälle nurmikolle sinapinvärisen osakehuoneiston takana. Sen aiheutti mies joka vastoin hätäkeskuksen neuvoa seurasi häntä. Tuo mies kuljetti 9 millimetrin käsiasetta. Poika kantoi pussillista karkkeja.”

Median antama kuva Trayvon Martinista viittasi iloiseen ja mukavaan 17-vuotiaaseen lukiolaispoikaan joka oli kuin kuka tahansa samanikäinen nuorukainen missä tahansa läntisessä maailmassa. Hupparia käyttävä, koulua käyvä. Uutisointi välitti kuvan siitä että ainoa asia millä tavalla Trayvon erosi useimmista samanikäisistä oli hänen ihonvärinsä josta oli tullut siten kohtalokas syy traagiselle tapahtumaketjulle. Trayvon Martin joutui profilointikäytännön uhriksi.

Valtamedian antama kuva korttelivahti George Zimmermanista oli aivan toisenlainen. Median mukaan Zimmermanilla oli väkivaltarikostausta. Hänet oli pidätetty kahdeksan vuotta aiemmin, 21-vuotiaana, hyökkäyksestä virantoimituksessa ollutta poliisia vastaan. Tämä oli pidättänyt Zimmermanin rattijuopumuksesta. Lisäksi hänen tyttöystävänsä oli nostanut kanteen perheväkivallasta tätä kohtaan - väkivalta tiettävästi oli ollut molemminpuolista, sillä heillä oli molemmilla lähestymiskielto toisiaan kohtaan.

Hyvin monissa medioissa käytettiin valokuvia tragedian osapuolista joissa Zimmerman esiintyi tuimana puolilatinona totisine ilmeineen kun taas Martin oli silmiinpistävän lapsenomaisen näköinen poika iloisine kasvoineen, poika jolla oli ”elämä edessä”. Ei ollut epäilystäkään että sympatiat siirtyivät jo kuvien perusteella ammutun Trayvon Martinin puolelle. Myöhemmin paljastuikin sitten että useimmin esitetyt kuvat Trayvonista olivat ajalta jolloin tämä oli vasta 12-14-vuotias poika.

 

Mitä valtamedia ei kertonut Trayvon Martinista

 

Jos valtamedia ja sen version karvoineen päivineen nielevä ns. suuri yleisö päättäisi länsimaissa olisi häkki heilunut George Zimmermanille. Onneksi meillä on vielä olemassa länsimainen oikeusjärjestelmä jossa ”asiat ensin tutkinaan ennen kuin hutkitaan”. Floridan tuomarit ottivat tapauksen käsittelyyn ja havaitsivat varsin pian että median välittämä kuva Trayvon Martinista oli alusta alkaen täyttä satua.

Oikeusjärjestelmä ottaessaan tapaukset käsittelyyn käy läpi osapuolten taustat haastatteluin, dokumentein mutta nykyisin myös hyödyntämällä mm. sosiaalisesta mediasta, internetistä sekä mobiililaitteiden tekstiviesteistä löytyvän aineiston. He kävivät läpi mm. Martinin tiedot oppilaitoksista sekä hänen ja hänen tyttöystävän välistä keskustelua 21.11.2011, kolme kuukautta ennen traagisia tapahtumia.

Niistä välittyi aivan toisenlainen kuva nuoresta Trayvon Martinista. Ennen kuin Trayvon kertoi tyttöystävälleen Dee-Deelle olevansa väsynyt ja kipeä, ”Bae” (lyhennys ”babe”) eli hänen tyttöystävänsä kysyi miksi hän ”tappelee” (eli harrastaa taistelulajia)

 

Martin: koska se nekru juoruili musta

Ystävä: kulta sä tappelet aina. Sut pidätetään ja erotetaan (koulusta) kohta.

Martin: me tapeltiin koulun jälkeen mestassa jossa meitä ei nähty

Ystävä: Joo, no hyvä

Martin: hävisin eka erän mut voitin tokan ja kolmannen

Ystävä: siis kolmen erän tappelumatsi

Martin: mua ei huijata … se joutuu vielä kohtaamaan mut

Ystävä: ei jukra, lopeta... sut erotetaan vielä (koulusta)

Martin: musta se ei vuotanut verta vielä tarpeeks … vain nenästä

Trayvon Martinin sosiaalisesta mediasta löytyvien tietojen mukaan hän harrasti taistelulajia jonka englanninkielinen nimi on ”mixed martial arts”, lyhenne MMA. Seuraavana päivänä Martin lähetti ystävälleen viestin jossa ”tyyppi sai iskuja sisään eka erässä kun mä jouduin maahan enkä mä voinu tehdä mitään”. Hänen ystävänsä valitti kuinka Martin on ”aina tappelemassa”. Hän oli myös jotenkin sadisti, koska – kuten Martin itse oli maininnut – hänen tappelukaverinsa ei ollut vuotanut vielä tarpeeksi verta.

Yksi ja todennäköisesti tärkein todistaja Zimmerman-Martin tapahtumasta 26.2.2012 kertoi nähneensä ”mustan miehen mustassa hupparissa toisen henkilön päällä joka oli joko valkoinen ja latino ja jolla oli punainen villapusero. Tämä oli huutanut apua kun musta henkilö oli takonut iskuja ”mixed martial tyylisellä tavalla”.

Trayvon Martin ei ollut mikään viaton poika kuten median valtavirta antoi ymmärtää. Poliisin tutkimusten mukaan hän oli 180 cm pitkä ja painoi 72 kg. Kun kuuluisa ammatti nyrkkeiljä Tommy ”Hitman” Hearns voitti välisarjan maailmanmestaruuden 21-vuotiaana oli hänellä pituutta 185 cm ja painoa 68 kg (ottelupäivänä).

On totta että Trayvon Martinilla ei ollut rikosrekisteriä mutta tämä johtui yksinkertaisesti vain siitä että hänen oppilaitoksensa ei halunnut raportoida hänen kiistattomia rikkeitään poliisille. Tarkoituksena oli näin edistää se ettei eteenkin mustien nuorten miesten rikokset, kuten varkaudet keskettäisi opintoja. Varastettuja tavaroita viedään poliisiasemille ja ne jäävät tiedostoihin vain löydettyinä tavaroina. Kyseessä voi olla paitsi poliittinen korrektius mutta myös yksinkertaisesti vain hyötyä taloudellisesti siitä että oppilaitoksen oppilaskiintiöt pysyvät mahdollisimman täysinä koska laitokset saavat paljon tukea juuri oppilasmääriin perustuen.

Ennen pakollista muuttoaan Orlandoon 21. helmikuuta 2012 oli Martin ollut poissa koulusta jo 53 päivää kouluvuoden aikana ja ollut erotettuna kolme kertaa, viimeksi huumetarvikkeiden hallussapidon takia mutta myös mm. naisten jalokivien omistamisen takia. Hänen hallustaan oli myös löydetty ruuvimeisseli joka tyypiltään luokiteltiin sellaiseksi jota yleensä murtovarkaat käyttävät. Välittömästi Martinin kuoleman jälkeen poliisit tarkastivat hänen vaatteensa ja tavaransa ja havaitsivat 12 erityyppistä arvoesinettä jotka viittasivat siihen että ne eivät missään tapauksessa olleet hänen omiaan.

Kun George Zimmerman ensi kerran teki havainnon Trayvon Martinista hän viestitti:

”Tämä kaveri ei näytä ollenkaan hyvältä. Tai hän on huumeiden vaikutuksen alaisena tai jotain sinne päin.”

Olisiko Zimmerman voinut olla väärässä? Poikahan osti vain karkkeja ja virvoitusjuomaa. Martinin ostokset - Skittles ja jäätee - eivät ole kuitenkaan niin viattomia ostoksia kuin ensikuulemalta voisi olettaa. Ne ovat nimittäin kaksi komponenttia kolmesta. Kun niihin sekoitetaan vielä kolmas aines - kodeiini- tai prometatsiinipitoista yskänlääkettä, saadaan mieto huimausaine nimeltään Purple Drank (tai Lean).

Purple Drank - tai Lean - on mieto hallusinogeeni, ja sen vaikutukset ovat samankaltaiset kuin mietojen kannabistuotteiden. Se valmistetaan täysin laillisista raaka-aineista, ja se on antagonisti energiajuomille. Sen hallussapito tiettävästi ei ole rikollista, ja se on varsinkin hiphoppareiden suosiossa. Vaikka Purple Drank luokitellaan miedoksi huumeeksi sillä on todettu kuitenkin olevan aggressiivisuutta lisääviä vaikutuksia. On hyvin mahdollista, että Martin - joka oli jäänyt kiinni kannabiksen käytöstä aiemmin - oli matkalla valmistamaan Purple Drankia. Tutkijat nimittäin löysivät noin 40 minuutin aukon jona aikana Martin teki jotain mistä ei aluksi ollut tietoa.

 

Trayvon Martinen perhe-elämä

 

Julkisuudessa kerrottiin epämääräisesti ettei Martinin perhe-elämä ei ollut aivan tavallista. Hänen vanhempansa olivat eronneet. Marraskuun 22.päivänä 2011, päivä MMA-ottelun jälkeen Martin kertoi ystävälleen kuinka hänen äitinsä ”heitti hänet ulos” ja että hänen täytyy muuttaa isänsä luokse. Kun hänen kaverinsa kysyi syytä niin Trayvon vastasi: ”no kytät erottivat mut koulusta”. ”Sinä hulttio”, kaveri jatkoi. ”Eikä, mä oon gangsta”, jatkoi Trayvon Martin.

Joulukuun 21.päivänä 2011 Martin kertoi ystävlleen, ”hitto jouduin vaikeuksiin jonkun paskan takia jota mä en edes tee”. Hänen äitinsä, Sybrina Fulton, oli tyrmistynyt. ”Pakkaa vaatteesi nyt”, hän tekstitti Trayvonille. ”Rakastan sinua mutta sinun on parasta olla nyt isäsi luona”.

Martin asui äitinsä kanssa vain ajoittain ja vietti vielä vähemmän aikaa isänsä kanssa, joka tuolloin asui siskonsa luona Miamin alueella. Tammikuuta 6.päivänä 2012 Martin joutui vaikeuksiin koulussa uudelleen. Kun kysyttiin syytä hän kertoi ystävälleen, "koska mä katsoin tappelumatsia ja toinen ope sanoi että mä löin niitä". Hänen ystävänsä sanoi: "Sanoinhan että olet liemessä sen paskan kanssa." Tällä kertaa Trayvonin äiti oli heittänyt hänet ulos talosta "tappelun" vuoksi ja hän oli muuttanut tätinsä ja setänsä luokse asumaan.

Lukuisat sosiaalisen median viestit ja puhelimen viestit ja todistajalausunnot osoittivat että hän oli yhä enemmän kiinnostunut ”ruohosta” ja niinpä häntä kutsuttiin netissä ”pilviveikoksi” (”weedhead”). Mutta uusimmat postitukset ja kuvat kertoivat vielä vaarallisemmasta uudesta harrastuksesta, aseista. Eräässä kuvassa hän poseerasi aseen, ehkä omistamansa kanssa.

Helmikuun 21.päivänä 2012 Trayvon Martin meni bussilla isänsä ja tämän uuden tyttöystävän Brandyn luo asumaan Orlandoon. Hän saattoi matkustaa koska hänen koulunsa oli erottanut hänet juuri (kolmannen kerran) marihuanan takia. Ojennuksella ei ollut juuri vaikutusta häneen. ” Kätkin ruohon niiltä”, tekstitti hän ystävälleen koska pelkäsi että hänet ratsataan bussissa. ”Hankin ruohoa kun saan rahaa perjantaina”, tekstitti hän seuraavana päivänä.

Surullisia oli ne tekstit joita hänen äitinsä toisaalta ja isänsä toisaalta hänelle lähettivät. Molemmat halusivat hänen käyttäytyvän paremmin. Äiti rukoili hänen puolestaan ja toivon Trayvonin tekemän myös niin. Mutta asiat olivat etenemässä huonoon suuntaan.

Näiden tekstien välillä hän viestitti ystävälleen:

”U wanna share a .380?"

sekä....

"U got heat??"

 

Trayvon Martinilla oli hanke ystävänsä kanssa hankkia ase.

 

Mitä kohtalokkaana iltana tapahtui?

 

Vaikka Trayvon Martinin elämän viimeisestä minuutista ei tiedä kukaan muu kuin George Zimmerman, tiedetään sitä edeltävästä ajasta, siis ennen klo 19.14 itse asiassa aika paljon. Kohtalokkaana helmikuun 26.päivänä 2012 tapahtumat etenivät seuraavasti:

Kello 18:21

Trayvon Martin näkyy turvakamerassa saapumassa lähikauppaan. Valtamedian mukaan ”avulias ja tavallinen” Trayvon ostaa Skittles-karamelleja ja Arizona-jääteetä, jotka on tarkoitettu hänen isänsä uuden naisystävän Brandy Greenin pojalle Chadille. Tämä ei todennäköisemmin pidä kuitenkaan paikkaansa. Trayvonille oli jotain muuta mielessä.

Kello 18:22

Trayvon, hupparin huppu päällä valitsee paikallisen 7-Eleven valintamyymälän hyllyistä Sḱittlesin ja Arizona vesimelooni-hedelmämehu cocktailin. Nämä ovat siis kaksi ainesosaa jotka tarvitaan Purple Drank-nimisen huumaavan juoman valmistukseen. Martinin Facebook-viestien perusteella hän on käyttänyt Purple Drankia jo ainakin kesäkuusta 2011 lähtien. Kesäkuun 27.päivänä 2011 hän oli kysynyt ystävältään netissä: ”tiedätkö yhteyksiä kodeiiniin [sen hankkijaan]”. ("unow a connect for codien?") . Hän kertoo ystävälleen aineen laittavan ”tulta persiiseen”. ("some fire ass lean."). Hän myös mainitsee käyttäneensä sitä aiemmin ja haluavan ”tehdä sitä lisää”.

Kello 18:23

Trayvon maksaa ostoksensa. Hän näyttää myös videokamerassa viittaavan johonkin myyntitiskin takaiseen muuhun tuotteeseen mutta myyjä näyttää estävän sen valinnan. Trayvon kääntyy tiskiltä poispäin dollarisetelinippu kädessään.

Kello 18:24

Trayvon lähtee kaupasta mutta videokamera ei näytä hänen kulkevan suoraan Brandyn kotiin. Miksi?

Kello 18:25

Kolme huppupäistä nuorta miestä saapuu myymälään kasvot osittain hupun peitossa ja muuten piilossa. Myyjä vaikuttaa hermostuneelta. Yksi heistä, joka myöhemmin paljastuu Curly-nimiseksi kaveriksi, ottaa päästä hattunsa, ravistelee pitkiä kiharia hiuksiaan. Hän on joko valkoinen tai kuten Zimmerman, ”valkoinen latino”.

Kello 18:27

Curly näyttää pitävän samanlaiset dollariniput kädessään joiden kanssa Trayvon poistui aiemmin kaupasta. Hän ostaa kaksi edullista sikaria heti ja kolmannen myöhemmin.

Kello 18:28

Curly on ensimmäinen kolmesta jotka poistuvat. Kaksi muuta poistuvat minuuttia myöhemmin.

Kello 18:29

Trayvon, kääntyillen kävellessään, voidaan havaita lähialueiden ikkunoista monen silminnäkijän mukaan kun hän on menossa Twin Lakesia ja Brandyn taloa kohti.

Kello 19:09

Zimmerman soittaa poliisille katsellessaan Trayvonia lähellä aidaton asuinalueen kerhohuonetta noin 700 metrin päässä kaupasta. Trayvon Martinin tyttöystävän Dee-Deen mukaan Trayvon olisi maininnut laittaneensa hupun päähän vesisateen vuoksi. Tosiasiassa, kuten videokamera osoittaa, hänellä oli huppu päässä jopa olleessaan kaupan sisällä. Koska matka kaupasta Brandyn asunnolle oli lyhyt olisi Trayvonin pitänyt joutua alle 10 minuutissa kaupasta asunnolle – viimeistään klo 18:35. Mitä hän teki tuon noin 40 minuutin aikana?

Jotkut taustatiedot voivat selittää syyn. Aikaisemmin helmikuussa 2011 Trayvon oli jäänyt kiinni koulussa marihuanan jäämien ja marihuanapiipun hallussapidosta. Se oli väliaikainen erottaminen sen kouluvuoden aikana ja tällä kertaa kymmeneksi päiväksi. Hän oli myös käynyt aineella kauppaa. Eräs internetissä ollut kavereista tekstittä tästä:

”Damn were u at a nigger need a plant."

Trayvon Martin oli katuslangin mukaan ”sätkien perään”. On hyvin mahdollista että Curly osti yhden noista savukkeista alaikäiselle Trayvonille ja otti videolla näkyvät dollarit maksua vastaan. Trayvon odotti 5 minuuttia kaupan ulkopuolella eikä lähtenyt ennen kuin Curly tuli ulos. 40 minuuttia ennen kuin Zimmerman havaitsi hänet Trayvon olisi voinut raaputtaa tupakan pois savukkeesta ja korvannut sen marihuanalla ja polttanut sätkän.

”Tämä kaveri ei näytä ollenkaan hyvältä”, Zimmerman kertoo poliisille. ”Tai sitten hän huumeiden tai muun aineen vaikutuksen alaisena. Sataa ja hän vain kävelee ympäriinsä, katsellen.” Trayvon oli käyttänyt huumeita, se tiedetään. Ruumiinavauksen yhteydessä hänen verestään ja virtsastaan löytyi marihuanan psykoaktiivisia ainesosia.

Trayvon Martinin asiat eivät näyttäneen olleen kovinkaan hyvin järjestyksessä. ”Hän vain tuijottaa katselee kaikkia noita taloja”, kertoo Zimmerman poliiseille. Lokakuun 21.päivänä 2011 hän sai toisen koulusta erottamisen. Koulun turvallisuusvartija näki Trayvonin kirjoittavan ”WTF” , käytävän kaappiin. Avatessaan Martinin laukun vartija löysi 12 erityyppistä jalokivituotetta, kellon, sekä murtotyökalun.

Zimmerman teki ennakkovaroituksen poliisille raportoidessaan Trayvonista. Retreat at Twin Lakesin alue oli kokenut useita ryöstöjä aivan viime aikoina. Tekijät olivat olleen nuoria miehiä, useimmiten mustia. Ei siksi ihme että alueella olevissa kylteissä lukee:

"We report all suspicious persons & activities to the Sanford Police Department.”

Jos Trayvon Martin ei sovi tuohon ”epäiltävien henkilöiden ja toimintojen” kategoriaan niin kuka sitten?

Kello 19:10

"Hän tulee minua kohti", kertoo Zimmerman Trayvonista, joka kävelee nyt hänen ajoneuvoaan kohti. Vasta nyt Zimmerman tekee ensimmäisen todistettavan havainnon hänestä "mustana mieshenkilönä." Zimmerman jatkaa: "Hän tulee tutkimaan minua. Hänellä on jotain käsissään." Zimmerman kuulostaa hermostuneelta: "Voisitteko hankki poliisin tänne."

Kello 19:11

Ennen kuin Trayvon ohittaa hänen autonsa sanoo Zimmerman: "Hitto hän juoksee. Hän on menossa kohti takaovea" . Tuo takaovi on samalla suunnalla kuin Brandyn asunto. Kysymys kuuluu nyt miksi Trayvon juoksi.

Kello 19:12

Kysyttyään keskuksesta neuvoja, Zimmerman sitoutuu olemaan seuraamatta Trayvonia ja hänen raskas kiihtynyt hengityksensä loppuu. "Hän juoksee", kertoo Zimmerman. Vaikka Trayvon olisi juossut hitaasti olisi hän ehtinyt Brandyn asunnolle puolessa minuutissa.

Kello 19:13

Zimmerman ilmoittaa: " En tiedä missä tämä poika on." Hän katsoo ympärilleen löytääkseen Trayvonin mutta kääntyy sitten kohti autoaan.

Kello 19:14 - 19:16

Nämä ovat kaksi ”puuttuvaa” minuuttia. Saatuaan soiton Dee-Deeltä, Trayvon on tullut takaisin kohti Zimmermania. Lopullinen kohtaaminen tapahtuu 60 metriä Brandyn rivitalosta ja vain 25 metriä Zimmermanin ajoneuvosta. Kukaan ei jahdannut Trayvon Martinia. Vaikka hän oli säilyttänyt juoman ja karamellit itsellään ei hänellä ole marihuanasavuketta.

Ruumiinavauksen mukaan Trayvon oli siis 180 cm pitkä ja paino 72 kiloa. Hän ei ollut laiha pieni poika karkkien kanssa kuten suuri osa maailmaa luuli. Hän oli 8 cm pitempi Zimmermania ja vain 10 kiloa kevyempi.

Hänen kotinelämä on rikkonainen, hänen kouluelämänsä sekasorrossa, Trayvon Martin oli vajoamassa pahasti amerikkalaiseen urbaaniin väkivaltaiseen rikolliseen nuorisokulttuuriin.

Tämä kulttuuri, jota media on päättänyt olla näkemättä, on ollut järkyttävän tuhoisaa. Viitaten Bureau of Justice-tilastoihin on musta ekonomisti Walter Williams todennut , että "vuosina 1976-2011 oli 279 384 mustaa murhan uhreja." Näistä Williams arvioi, että "262621 murhasi muut mustat."

Trayvon päälle on kirjoitettu nyt oma tunnuslukunsa. Viimeisen vuoden ajalta hänen sosiaalisen median sivustot todistavat kasvavasta kiinnostuksesta huumeita, vapaaottelutyyliistä katutappelua ja aseita kohtaan. Samoin niistä kuultaa järkyttävän mautonta tekstiä "narttujen" hyväksikäytöstä.

Trayvon esiintyy myös kuvassa keskisormet ylhäällä sekä väkivaltaisesti ja uhkaavasti muutenkin esiintyen. Yksi YouTube-video näyttää hänet erotuomarina katutappelussa. Hänen serkkunsa oli aiemmin twiitannut hänelle: "Sä et kerro mulle heittäneesi bussikuskia", tarkoittaen, jos totta, että Trayvon oli viskannut bussikuskin ulos autosta.

Korttelivahti George Zimmerman ei siis koskaan tavannut söpöä pientä poikaa kohtalokkaana helmikuun 26.päivän iltana Sanfordissa, kuten valtavirtamedian yleisö teki. Hän näki melkoisen täyskasvuisen nuoren miehenalun, huumeisena, tatuoidun huppupäisen katutaistelijan joka käytti Facebookissa nimeä "No_Limit_Nigga."

Oikeudenistunnossa syytetyltä George Zimmermanilta kysyttiin viimeisen minuutin kohtalokkaan hetken viimeisistä vuorosanoista. Zimmerman antoi seuraavan todistuksen:

”Kun menin kohti autoani epäilyksenalainen ilmestyi pimeydestä ja kysyi 'onko sinulla ongelmia?'. Vastasin 'ei'. Silloin hän sanoi: 'nyt sinulla on ongelmia'.”

Heille molemmille siitä tuli ongelmia. Trayvon Martinille, elämässään syöksykierteessä olevalle wannabee-gangsta-huligaaninalulle, ongelma muodostui kohtalokkaaksi. Poliittisesti korrektista mediasta riippuu myös milloin se itse heittää pyyhkeen kehään ja tunnustaa olleensa väärässä eikä enää syyllistä ainakaan George Zimmermania tästä surullisesta tapahtumasarjasta. Samalla osa mediasta voisi vähitellen lopettaa tuon etovan ja täysin ala-arvoisen gangstarapkulttuurin mielistelyn. Hedelmistään puu tunnetaan.


( Päivitetty: 15.08.2013 16:59 )

 - pelontorjunta | Kommentoi



 Etelä-Afrikka – palava rengas kaulassa
09.08.2013 15:11 | pelontorjunta

Kuva: "Uusi Etelä-Afrikka". Jacob Zuma (vas. alh), lisääntyvää väkivaltaa ja köyhyyttä sekä Nelson Mandela ja Bono (oik. ylh)

Kuvittele miten reagoisit jos Suomen tasavallan presidentti Sauli Niinistö tai nykyinen pääministeri Jyrki Katainen avaisivat ja päättäisivät vaalikampanjansa laulamalla riehakkaasti laulua jonka nimi on ”Tuokaa minulle minun konekiväärini”, hilluisivat ja huojuisivat villinä puolelta toiselle hypnoottisen kuoron säestäessä tässä uhkaavassa spektaakkelissa. Ja miltä tuntuisi jos pääministerimme väitettäisiin ottaneen rahaa kampanjaansa joltakin kolmannen maailman öljyvaroilla rikastuneelta despootilta ja jos häntä syytettäisiin 783 eri tapauksista jotka liittyvät petoksiin, kiristyksiin, häikäilemättömiin veronkiertotapauksiin, syytöksiin raiskauksista ja kun samaan aikaan hänen pelottavat kannattajansa uhkailisivat ja ahdistelisivat oikeustalojen ulkopuolella tutkijoita ja tuomareita? Millä tavalla reagoisit jos tästä kaikesta huolimatta pääministerin puolue olisi vaalien varma ja ylivoimainen voittaja selvällä noin 2/3 äänienemmistöllä, syytteet hylättäisiin koska niitä ei edes haluttu tutkia ja hänen valtansa olisi näin legitimoitu?

Jos kykenet hahmottamaan tämän kaiken voivan tapahtua myös Suomessa niin silloin sinulla on aavistus siitä mitä Etelä-Afrikassa on viime vuosina tapahtunut. Paitsi, että se on jotain vielä kamalampaa. Nopeasti realisoituva katastrofi on suuri häpeä ja järkytys miljoonille rehellisille mustille ja valkoisille ihmisille Etelä-Afrikassa ja niille harvoille jotka Etelä-Afrikan ulkopuolella ovat vaivautuneet asiaa miettiä.

Se on myös tragedia koko Afrikalla joka on halunnut toivoa jo kauan. Ja se on myös julma uutinen sivistyneelle maailmalle joka ei enää tarvitse yhtään surkeasti epäonnistunutta valtiota. Kuitenkin on jokseenkin varmaa että tällaisten uutisten kertomisesta jokainen saa niskaansa syytöksen pelottelusta ja pessimismin lietsomisesta ihmisten keskuuteen. Myös on luultavaa että syytös rasismista odottaa niitä jotka tuovat esille tuon kaukaisen mutta maailmanpoliittisesti huomattavan tärkeän maan katastrofia enteilevistä tulevaisuuden näkymistä.

Miksi? Miksi kaikki Nelson Mandelan tunteelliset, herkät ja hyväuskoiset ihailijat Suomessa, Euroopassa ja kaikissa länsimaissa antoivat ”Uudelle Etelä-Afrikalle” luvan vapaasti mennä menojaan rotuerottelupolitiikan, Apartheid-järjestelmän, lakkauttamisen jälkeen? He halusivat uskoa että tämä kompleksinen ja tärkeä kansakunta oli tullut eräänalaiseksi maanpäälliseksi paratiisiksi missä kaikki kyyneleet oli pyyhitty ja kaikki ongelmat oli ratkaistu.

 

Nelson Mandela – myytti ja todellisuus

 

Vuonna 1918 syntynyt Nelson Rolihlahla Mandela , xhosa-kansan thembu-heimoon kuuluva eteläafrikkalainen poliitikko, joka toimi aiemmin myös asianajajana on epäilemättä eräs kuuluisimpia 1900-luvun poliittisia hahmoja. Etelä-Afrikassa hänet tunnetaan usein xhosankielisellä klaaninimellä Madiba tai nimellä tata, joka tarkoittaa khosaksi "isää". Hän oli keskeinen henkilö siinä prosessissa jossa Etelä-Afrikka siirtyi vuonna 1948 käyttöön otetusta apartheid-järjestelmästä pois kohti kaikkia yhteiskuntaryhmiä koskenutta demokratiaa.

Kuten lähes aina juuri tällaisten ”suurten” poliitikkojen ympärille rakennetaan ennemmin tai myöhemmin varsinainen myyttien ja uskomusten mahtava kudos. Mandela itse oli persoonana varsin kunnollinen mutta poliittisesti tehoton ja naiivi. Hänen roolinsa politiikassa oli olla keulakuva ja viikunanlehti uudelle järjestelmälle Etelä-Afrikassa. Maailma joko unohti tai sitten antoi anteeksi hänen jatkuvat ystävyyssuhteet eräiden maailman pahimpien despoottien kanssa sekä sen tekopyhän hutiloinnin joka ympäröi häntä.

Kun katsomme nyt tätä haurastuvaa vanhusta ja sitä groteskia joukkoa josta hänen seuraajansa on valittu ( Tabo Mbeki ja Jacob Zuma) olisi kiinnostavaa tietää mitä hän itse miettii kun hänen on pitänyt olla tukemassa sitä kehitystä mihin se on hänen rakkaassa maassaan johtanut. Monet hänen hyväuskoiset ystävänsä – ne jotka ovat myöntäneet Etelä-Afrikan taloudellisen, kulttuurillisen ja demokraattisen vajoamisen kohti pimeyttä - yrittävät kiemurrella irti koukusta uskottelemalla itselleen Mandela olevan jo niin huonossa kunnossa ettei hän edes tajua todellisuudesta mitään. Jos näin olisikin nyt (mitä voidaan epäillä) niin varmasti näin ei ollut 1990-luvun lopulla ja 2000-luvun alussa kun ensimmäiset uhkaavat merkit olivat jo näkyvissä.

 

Apartheid-aikakauden vaietut asiat

 

Se miksi Etelä-Afrikka siirtyi toisen maailmansodan jälkeen rotuerottelupolitiikkaan johtui vuoden 1948 vaalien suuresta käänteestä jossa kansallismieliset buurit nousivat valtaan. Tällä nationalistisella puolueella oli ollut jo kauan kauna eteenkin Britanniaa vastaan ja päätavoite oli juuri irrottaa Etelä-Afrikka brittiläisesti imperiumista. Puolueen natsisympatiat oli myös hyvin dokumentoitu ja ne olivat hyvin pitkälle juuri perua siitä kaunasta jota Britanniaa kohtaan tunnettiin buurisodan jälkeen. Buurit halusivat myös estää sodan jälkeen pelättävissä olevan siirtolaisuuden Britanniasta koska se olisi uhannut kansallismielisten poliittista asemaa.

Järjestelmä otettiin käyttöön pian kansallismielisten voitettua vaalit. Vuonna 1949 säädettiin laki, jolla kiellettiin seka-avioliitot. Pian tuli voimaan myös moraalittomuuslaki, jonka tarkoituksena oli tehdä valkoisten ja ei-valkoisten sukupuolisuhteet laittomiksi. Seuraavaksi tuli ryhmäalueiden laki, jossa määrättiin kaikille roduille omat asuinalueet, jotka valkoiset saivat milloin vain julistaa omakseen.

Rotuerottelujärjestelmään kuuluneet loukkaukset ja nöyryytykset saivat Mandelan liittymään vuonna 1944 ystävänsä Walter Sisulun aloitteesta ANC:hen. Toisen maailmansodan jälkeen Mandela ja Sisulu olivat perustamassa ANC:n nuorisojärjestöä Congress Youth Leagueta (CYL), jonka tavoitteena oli painostaa ANC:tä aktiivisempaan toimintaan rotuerottelun vastaisessa taistelussa. CYL:n mukaan käyttöön tuli ottaa lakot, boikotit ja kansalaistottelemattomuus. CYL onnistui syrjäyttämään ANC:n puheenjohtajan Alfred Xuman, joka suhtautui kyseisiin menetelmiin kielteisesti, ja otti ANC:n yleiskokouksessa vuonna 1949 hänen tilalleen James Morokan. Samassa kokouksessa Tambo, Sisulu ja Mandela nousivat ANC:n toimeenpanevaan komiteaan.

Apartheid ja ANC:n historia pääpiirteittäin on nykyisin jo tiedossa. Silloinen Etelä-Afrikan rotuerotteluhallinto piti ANC:tä terroristijärjestönä jolla oli vahvat siteen maailman kommunistisen blogin, Neuvostoliiton ja Kiinan suhteen. ANC:n terroristisuus on hieman ongelmallinen asia. On nimittäin syytä muistaa että silloisessa Etelä-Afrikassa ei ollut ANC:lle käytännön mahdollisuutta rauhallisemmalle poliittiselle toiminnalle. Pohjois-Irlannin katolisilla puolestaan oli täydet poliittiset mahdollisuudet ajaa muutenkin omaa asemaansa joten maakunnan IRA-järjestöä voi tässä mielessä pitää perustellusti terroristisena organisaationa.

Mutta rotuerottelujärjestelmän esittämälle syytökselle ANC:n kytköksistä Neuvostoliittoon, Kiinaan ja kansainväliseen kommunistiseen kumouksellisuuteen on olemassa huomattavasti paremmat perustelut. ANC:ssä oli kiistatta hyvin dokumentoitu kommunistinen militantti fragmentti. Mandela itse tuskin koskaan oli kommunisti mutta hän ja hänen organisaationsa joutui enemmän tai vähemmän Neuvostoliiton ja sen sotilaallisen orgaanin vaikutuksen piiriin. Lukuisia sen taistelijoita kouluttivat ihmiset joilla oli kytkökset kommunistiseen ryhmittymään. Stalinistisen Neuvostoliiton ja KGB:n olisi ollut muutenkin hyvin helppo soluttaa ANC. On myös merkillepantavaa että kun Neuvostoliiton järjestelmä alkoi luhistua 1980-luvun lopulla katosi monia tekijöitä jotka sitten jouduttivat nopeasti apartheid-järjestelmän purkamisen Etelä-Afrikassa. On syytä siten kysyä oliko pelkkä sattuma että apartheid-järjestelmä syntyi kylmän sodan alettua ja ANC radikalisoitui sekä toisaalta oliko apartheidin päättyminen täysin riippumaton kommunistisen Neuvostoliiton ja sen ryhmittymän luhistumisesta.

Kylmä sota, Etelä-Afrikan valtava strateginen ja geopoliittinen merkitys ja Neuvostoliiton aggressiivinen joskin usein taitavasti naamioitu halu lisätä vaikutusvaltaansa kolmannessa maailmassa oli asetelma jossa esim. johtavien länsimaiden, USA:n, Britannian, Ranskan ja Saksan oli hankala painostaa Etelä-Afrikan hallintoa. Voidaan kysyä mikä olisi ollut sen vahingon suuruus jos Etelä-Afrikka olisi jo 1960-luvulla pudonnut Neuvostoliiton syliin. Kyse ei ollut nyt mistään riisintuottajamaasta. Etelä-Afrikan Tasavallalla oli ja on yhä aivan uskomattomat raaka-ainevarannut ja geopoliittisesti äärimmäisen tärkeä asema maapallolla. Juuri siksi länsimaat eivät voineet puuttua Etelä-Afrikan tilanteeseen ja nationalistinen buurihallinto ymmärsi tilanteen erinomaisesti. Kun Neuvostoliitto putosi kuvasta ja kommunismi luhistui, ei apartheidille ollut enää tätä tärkeää perustetta olemassa. Jos länsimaita syytetään siitä että ne tukivat tietoisesti rotuerotteluhallintoa niin yhtä perustellusti voidaan väittää että Etelä-Afrikan valkoinen hallinto, ajatellen eteenkin maan korkeaa teknologista tasoa, kävi puolustustaistelua kansainvälistä kommunistista vastaan. Yksinkertaisesti Etelä-Afrikka oli aivan liian tärkeä jotta se olisi annettu militantin ANC:n kautta ja siitä riippumatta Neuvostoliiton kontrolliin.

 

Apartheidin päättyminen ja suuri unohdus

 

1990-luvun alussa Mandela vapautettiin vankeudesta ja maa siirtyi rotuerotteluaikakaudesta pois. Joskus on suorastaan vaikea edes muistaa miten maa hallitsi kerran uutisia viikosta toiseen. Nyt liberaali ja vasemmistolainen media tuskin edes mainitsee sitä. Miksi? Syy on yksinkertainen: koska ns. Uusi Etelä-Afrikka on ollut täydellinen epäonnistuminen.

Et lue valtamedian etusivuilla uutisia kauheista rikoksista. Et kuule korruptiosta joka leviää kaikkialla kuin rutto. Et kuule U2-yhteen joka paikan touhottajan ja maailmanparantajan Bonon (kuva oik ylhäällä) kritisoivat valtaapitävien korruptiosta, rikoksista ja täydellisestä piittaamattomuudesta kansan kurjistamisessa. Et kuule uutisia täysin älyttömistä sukellusvene- ja huippulentokonehankinnoista maalle jolla ei ole muuta vihollista kuin sen oma poliittinen korruptoitunut eliitti, ANC:n entinen ja nykyinen militantti yläkerros.

Löytyy toki jonkin verran uutisia AIDS:sta muttei niin paljon kuin pitäisi. Hyvin vähän on uutisia siitä, että maan hallinto itse typerillä ja taikauskoisilla näkemyksillään on kaivanut valtavan määrän hautoja omille kansalaisilleen kieltämällä uskomasta esim. tieteellisiä tosiasioita. Harvassa ovat uutiset vainoharhaisista mellakoista hallitsematonta maahanmuuttoa vastaan koska tämä kaikki sotii sitä kaunisteltua kuvaa vastaan jota Mandelan länsimaiset ihailijat ovat niin toivottoman kauan vaalineet. Ja vähän on sanomista tiedotusvälineillä siitä miten likaiset hökkelikylät tauotta leviävät kaikkialle maan kaupunkeihin.

Rappion merkkejä on muuallakin. Sähkökatkokset, eräs pysyvä merkki maan alamäestä, on säännöllinen ilmiö. Ydinvoimalaitosten kasvavat ongelmat, kouristeleva epäonnistuminen, nostaa pelkoa Afrikan omasta Tsernobylistä. Sitten on olemassa yhä paheneva vesihuolto-ongelma, kuilun partaalla oleva rautatiejärjestelmä sekä raja joka vuotaa kuin seula ja on mahdollistanut täysin kontrolloimattoman siirtolaisuuden mm. vapaassa pudotuksessa olevasta marxilaisen Robert Mugaben Zimbabwesta. Nämä uudet maahanmuuttajat ovat pääasiallinen syy miksi maan slummihökkelikylät ovat jatkaneet hillitöntä laajentumista.

Jos oli Etelä-Afrikka jakautunut moderneihin, siistiin asuinalueisiin sekä likaisiin slummeihin apartheidin aikana niin nyt tilanne on vielä paljon vakavampi. Buurihallinnon aikana rajat pidettiin taatusti valvottuina ja infrastruktuuri toimi siellä missä se ylipäätänsä oli olemassa. Nyt maa on jyrkemmin kuin koskaan jakautunut rikkaaseen pieneen valkoiseen eliittiin, rikkaaseen ja nopeasti kasvavaan mutta pieneen mustaan usein korruptiolla rikastuneeseen eliittiin sekä valtavaan enemmistöön köyhyydessä ja kurjuudessa elävistä. Viimeksi mainitusta joukosta löytyy nykyisin myös yllättävän paljon valkoista epätoivoista väestöä. Näistä media harvoin kertoo suurin otsikoin. Turistit eivät tätä köyhyyttä. Parempi ehkä näin sillä paikat joissa köyhyys, kurjuus ja toivottomuus rehoittavat valtoimenaan ovat eräitä maailman hengenvaarallisimpia paikkoja kenelle tahansa hyväuskoiselle länsimaiselle turistille.

 

Zulu-taistelija presidentiksi

 

Etelä-Afrikan matka kohti rotuerottelun kauhuista kohti tasa-arvon ja keskinäisen kunnioituksen suurta onnelaa saavutti erään huipennuksen vuonna 2009 kun maailmalla niin palvottu ja arvostettu Nelson Mandela antoi tukensa zuluheimoon kuuluvalle Jacob Zumalle, ANC:n vasemmistosiipeen kuuluneelle presidenttiehdokkaalle. Zuman fragmentti puolueessa murskasi kaikki kilpailijansa, pelolla, terrorilla, korruptoimalla mm. Muhammad Khaddafilta saamillaan valtavilla rahasummilla ne jotka oli korruptoitava jotta tie valtaan on varma. Vaalikampanja oli likainen, törkeä, brutaali esimerkki siitä miten valta Etelä-Afrikan ”vapaissa” vaaleissa otetaan. Zuman vastustajat peloteltiin ja uhkailtiin raivoisan väkivaltaisen militantin joukon johdolla ulos näyttämöltä. Zuman voitto oli tietenkin varma jo ennen äänestyspäivää tällaisessa ilmapiirissä.

Se miten länsimaiden johtajat suhtautuivat Etelä-Afrikan uuteen valtiopäämieheen antaa hyvän esimerkin Suomen tasavallan silloinen presidentti Tarja Halonen uudenvuodenpuheessaan tammikuun 1.päivänä 2011:

”Yhdistyneiden kansakuntien pääsihteerin kutsumana johdan yhdessä Etelä-Afrikan presidentti Jacob Zuman kanssa kestävän kehityksen korkean tason paneelia, jossa parikymmentä eri maista olevaa asiantuntijaa pyrkii löytämään uusia keinoja kestävän kehityksen takaamiseksi. Haastavana tehtävänä on löytää ne tavat, joilla voisimme yhdistää vakaan taloudellisen kasvun, sosiaalisen oikeudenmukaisuuden ja ekologisesti kestävän kehityksen. Myös meille annettu aikataulu on hyvin tiukka ulottuen vain tämän vuoden loppuun.”

Se miten Jacob Zuma itse on löytänyt keinot oman maansa kestävän kehityksen takaamiseksi on jo havaittavissa. Niihin kuuluu hillitön korruptio, suunnaton tehottomuus sekä täydellinen kyvyttömyys ja haluttomuus välittää ylipäätänsä mistään mitään. Mitä muuta voisi odottaa mieheltä jonka rikollinen tausta on käsittämätöntä luokkaa, jolla on neljä vaimoa: Heistä yksi, viisi lasta Zumalle synnyttänyt Kate Mantsho, teki epätoivossa itsemurhan 8. joulukuuta 2000 jättäen maailmalla viestin siitä millainen on se mies joka johtaa Etelä-Afrikan Tasavaltaa 2010-luvulla. Näin kirjoitti Kate Mantsho jäähyväiskirjeessää:

”Toivon että on totta että tapaamme vielä – mutta ei aviomiehenä ja vaimona. En haluasi kokea sitä mahdollisuutta uudestaan niiden katkerien ja kaikkein tuskallisempien 24 avioliittovuoden vuoksi jonka olen joutunut kokemaan.”

Etelä-Afrikassa tämä uutinen hiljennettiin laajalti ja maailmalla siitä tietää vielä harvempi. Tietääkö Tarja Halonen ja maamme edistykselliset ja muut ns. hyödylliset idiootit ei ole tiedossa. Mutta ne jotka tuntevat Jacob Zuman hyvin eivät ole yllättyneitä.

Zuma itse vähät välittää Katen tai muidenkaan naisten valituksista. Hänhän on joka tapauksessa zuluheimoon kuuluva mies, joka kunnioittaa heimon muinaisia sotaisia ja miehekkäitä perinteitä. Hän on maininnut ohimennen aikovansa palauttaa kuolemantuomion takaisin Etelä-Afrikkaan. Hän on julkisuudessa kehuskellut kuinka nuorena hakkasi kenen tahansa homon tai homolta vaikuttavan pojan. Hän on myös sanonut samaa sukupuolta olevien avioliiton olevan kansakunnan häpeän. Hän on kansanparannukseen perustuvan lääketieteen ystävä. Hänen mielestään lapset pitää ottaa pois sellaisilta naisilta jotka eivät ole vihitty. Zuman mielestä myös rukoukset kouluissa pitäisi tehdä pakolliseksi.

Zumalta selvästi puuttuu länsimaalainen kiillotettu ja pehmeä olemus joka oli Mandelalla ja tämän seuraajalla Mbekillä. Hänen puolueensa ANC on joskus kauhuissaan kun se valitsi hänet johtajakseen. Liian myöhään. Liian myöhään.

ANC:n äärimmäisen julma stalinistinen siipi ilmeisesti ajatteli käyttävänsä Zumaa varovaisempaa Thabo Mbekiä vastaan. He uskoivat voivansa kontrolloida Zumaa tai ehkä työntää hänet syrjään sen jälkeen kun tämä olisi tehnyt likaisen työn. Mutta Zuma on ollut ovelampi kuin miltä hän näyttää.

Ensi silmäyksellä Zuma on kuin Michelin mainoksen mies, kalju, silmälasit päässä ja leveästi hymyilevä. Vaalikampanjassaan hän käytti Nelson Mandela T-paitoja kun taas hänen kannattajansa ja apulaisensa käyttivät Zuma-paitoja. Päässään hänellä oli outo musta nahkainen lännenhattu. Mutta ennen kaikkea Jacob Zuma on zulu, heimon mies. Ja hänen ajattelunsa on primitiiviseen heimoajatteluun pohjautuva. Etelä-Afrikka, maa jolla on ollut pitkä, huomattava tieteellinen ja tekninen osaaminen (sen valkoisen eurooppalaisen väestön ja suunnattomien rikkauksien ansioista) on siis saanut johtajakseen arkaaisen sotaisen heimon ajattelumaailman sisäistäneen kouluttamattoman, sivistymättömän miehen jolla on primitiivisen kulttuurienklaavin ihmiskuva ja maailmakuva.

 

Lynkkaajat

 

Tapahtui New Brigtonissa, Port Elisabethin alueella kesäkuussa 2011. Kaksi miestä murtautui vanhan naisen kotiin. He varastivat hänen televisionsa ja sen jälkeen puukottivat hänen vuokralaisensa kuoliaaksi kun hän (mies) yritti puolustaa naista.

Niinpä seuraavana aamuna naapurit jäljittivät miehet, laittoivat heidän kaulaansa auton renkaat, valelivat ne bensiinillä ja sytyttivät sitten palamaan.

”Nämä pojat ovat aiheuttaneet ongelmia yhteisössä jo pitkään. He terrorisoivat meitä”, sanoi Port Elizabethin teollisuuskaupungin kaupunginosan eräs asukas.

”Ihmiset huusivat, tunnelma oli korkealla. Kaikki tapahtui hyvin äkkiä.”

”Näin vain renkaiden palavan heidän kauloissaan. Kun ne paloivat ihmiset huusivat kaikenlaisia solvauksia ja sitten se päättyi. Kaikki tapahtui nopeasti kuin elokuvissa.”

Port Elizabeth poliisiviranomainen Dumile Gwavun mukaan esim. vuonna 2011 parin viikon aikana alueella oli ollut kuusi vastaavankaltaista tapausta. Etelä-Afrikan poliisiviranomaisten mukaan maassa tapetaan keskimäärin 46 ihmistä joka päivä ja 5% näistä tapoista toteutetaan oman käyden oikeutta käyttäen. Siis yli 800 tai jopa lähes tuhat lynkkausta vuosittain.

Tällaisten lynkkausten yleisyys on selitetty usein johtuvan apartheid-vuosien mukana syntyneellä käytännöllä, mutta se siinä mielessä ontto selitys sillä lynkkaukset eivät ole tuntemattomia myöskään monissa muissa Afrikan maissa. Näitä on tehty myös mm. Haitissa, Intiassa, Sri Lankassa ja Brasiliassa. Etelä-Afrikassa tällaista lynkkausta apartheidin vuosina harjoitti poliittisena terrorina juuri ACN:n stalinistinen militantti siipi eikä uhrit suinkaan usein olleet ”ilmiantajia” vaan ANC:n kannalta sen poliittisia vastustajia.

 

Välinpitämättömät idealistit

 

Helen Zille, Kapkaupungin suosittu ja tehokas pormestari sekä Demokraattinen Allianssi-puolueen johtajanakin toiminut totesi juuri ennen Zuman voittamia vaaleja:

”Suljettu kätyrisysteemi johtaa vallan väärinkäyttöön ja lopulta rikolliseen valtioon”.

Sen jälkeen Zille esitti täysin loogisesti ja järkiperäisesti ne menetelmät joilla Etelä-Afrikka käännetään syöksykierteestä kohti parempaa tulevaisuutta. Sen tietää kaikki jotka ovat tutkineet historian ja havainneet miten tie helvettiin on aiemminkin kivetty – hyvillä ja pahoilla aikomuksilla.

Ehkäpä Zille on myös realisti ja ymmärtää miten surkeat mahdollisuudet demokraattisella maalla on selvitä ongelmistaan jos tällainen maa koostuu kulttuurisesti ja koulutuksellisesti täysin erilaisista väestöryhmistä. Demokratiassa enemmistö päättää. Kyseessä on siis pohjimmiltaan enemmistön tyrannia vähemmistöä ja vähemmistöjä vastaan. Enemmistön moraalikoodista riippuu pitkälle se miten vähemmistöön silloin suhtaudutaan.

Ollaan vakavien kysymysten ääressä. Onko Etelä-Afrikka ennakkotapaus siitä miten käy kun länsimaisen kulttuurien edustajat menettävät missä tahansa maassa vallan alkukantaisille heimoajatteluun nojautuville voimille? Oliko rotuerottelu kaikkine karmeuksineen sittenkin se kova hinta minkä maan oli maksettava (värillisten oli maksettava) siitä että palvelut toimivat ja maa pysyi edes jossain määrin järjestyksessä koska enemmistö silloin (n. 70%) koostui eurooppalaisiin verrattuna enemmän tai vähemmän takapajuisista afrikkalaisista heimoista? Mitä se auttaa maan valtaväestöä jos he pääsevät ”tasa-arvoiseen” asemaan valkoisten kanssa jos sen seurauksena on lisääntyvää kurjuutta, kaaosta, terroria ja mielipuolista väkivaltaa? Mikä on sellainen demokratia jonka seuraus johtaa pientä hallitsevaa klikkiä lukuun ottamatta kaikkien häviöön ja mahdolliseen tuhoon? Miksi kulttuuristen valtavien erojen muodostamaa uhkaa koko yhteisölle ei haluta tunnustaa?

Jacob Zuman aikomukset voivat olla hyviä tai pahoja tai tehottomia mutta todennäköisesti ne ovat vain typeriä ja se tiedetään jo nyt että ne ovat olleet vääriä. Ongelma ei todennäköisemmin ole vain siinä että Jacob Zuma ja hänen tapaisensa tyypit ovat päässeet rikkaassa ja tärkeässä maassa johtamaan asioita kohti täydellistä kaaosta ja anarkiaa. Ongelma on yhteinen ja se koskee hyvin paljon myös länsimaiden eliittiä, intellektuelleja, poliittisia toimijoita, mediaa – näiden sokeutta nähdä tuhon merkit tai sitten haluttomuutta tunnustaa virheensä. Länsimaisille edistyksellisille idealisteille näyttää olevan ominaista hönkiä ja kohkata kolmannen maailman sorrosta silloin kuin kohde on oikea (länsimaa, valkoiset, kapitalismi jne). Kun sorretut ovat kaataneet sortajat menettävät edistykselliset kiinnostuksensa - eteenkin kun sorretusta valtaannoustuaan on tullut monin verroin pahempi sortajia kuin edeltäjistään. Vietnamin kommunistien harjoittama sorto ja terrori ei voisi vähemmän kiinnostaa aikamme edistyksellisiä ehkä siksi että se ei oikein kuulosta "mediaseksikkäältä".

Miten ahdistavaa onkaan ajatella että tähän ei olisi ehkä tultu jos maailma olisi ollut vähän kriittisempi, vähän kiinnostuneempi, Nelson Mandelan ja Thabo Mbekin pitkien menetettyjen vuosien aikana. Silmät levällään oleva hyväuskoisuus on pettänyt nämä hupsut jälleen, kuten niin aina ennenkin. Se ei siis ollutkaan niin muodikas, hieno ja haltioitunut kertomus. Historia ei päättynyt kun Nelson Mandela päätti pitkän matkansa vapauteen. Kaikki he eivät tule elämään jälkeenpäin onnellisena.

 


( Päivitetty: 09.08.2013 18:24 )

 - pelontorjunta | Kommentoi



 Suomen evankelisluterilaisen kirkon täydellinen romahdus
29.07.2013 18:44 | pelontorjunta

Äskettäin julkaistu kirkon nelivuotiskertomus ”Haastettu kirkko” on kirkon johdon kannalta lohdutonta luettavaa. Saman ovat todenneet myös tilastoja tarkastelleet tutkijat. Etenkin etelän kaupungeissa kaikki mittarit näyttävät alaspäin ja putoaminen on nopeata. Useimpien mielestä luterilainen kirkko Suomessa on vapaassa pudotuksessa.

 

Tilastot eivät aina valehtele

 

Tilastot ovat todellakin yllättäviä. Pääkaupunkiseudulla kirkkoon kuulutaan yhä vähemmän. Helsingissä on alueita, joilla vain noin 60 prosenttia ihmisistä kuuluu kirkkoon. On laskettu, että tällä vauhdilla luterilaisesta kirkosta tulee Helsingissä vähemmistökirkko vuonna 2020.

Muutos ei koske vain Suomea, päinvastoin se on yleinen ilmiö kaikkialla länsimaissa. Tutkijat ovat laskeneet, että vanhoissa protestanttisista kirkoista eroaa vuosittain noin 1,5 prosenttia jäsenistä kirkosta ja maasta riippumatta. Tämä koskee niin Yhdysvaltojen anglikaanista kirkkoa (kuuluisan piispa Spongin kirkkoa: tuon piispan työkaudella noin miljoona eronnutta) kuin Ruotsin kirkkoa. Sama vauhti näyttää olevan menossa Suomessa – eteenkin suurissa kaupungeissa.

 

Vain yhteiskunnallinen kehityskö taustalla?

 

Hyvin usein uskonnon merkityksen romahtaminen selitetään heppoisesti vain ”maailman muuttumisena” tai ”yhteiskunnallisen kehityksen myötä”. On syytä kuitenkin epäillä että taustalla ovat huomattavasti raadollisemmat tekijät – aatteet ja niitä ajaneet ihmiset.

Jatkuvista tieteelle annetuista myönnytyksistä huolimatta ev.lut kirkko oli kyennyt säilyttämään moraalia koskevat perusarvonsa lähes koskemattomina, mutta 1960-luvulta lähtien se on joutunut tekemään kompromisseja myös niissä. Kirkon muurien sisään on astunut melkoinen lauma ihmisiä, joilla on maallisen ideologian päämäärät, mutta niitä on vaikea tunnistaa, koska ne on kääritty kristinuskolle mieluisiin humaaneihin arvoihin. Jos tämä syytös esitettäisiin julkisuudessa, vastaisivat tutkijat ja ns. ”asiantuntijat” siihen todennäköisesti, että kirkon arvomuutos on osa yhteiskunnan luonnollista muutosta, osa ”edistystä”. On kuitenkin naiivia olettaa, että vakaan instituution dramaattiset muutokset perusarvoissa olisivat pelkästään seurausta ympäröivän yhteiskunnan kehityksestä. Tarkempi tutkimus viittaa pikemminkin siihen, että muutoksen taustalla ovat aatteelliset toimijat, jotka eivät tosin aina itsekään osaa tunnistaa omien humaaneilta näyttävien maallisten pyrkimystensä ideologisista päämääriä.

Omituista on myös se että ovat kirkon uudistukset miten nopeita ja radikaaleja tahansa, ne ovat muutoksen perään vaahtoaville voimille aina liian hitaita ja vesitettyjä, mikä on tietenkin kehäpäättelymallin mukaisesti ”todiste” kirkon syvään juurtuneesta ”vanhoillisuudesta”. Vasemmistolaisella 1970-luvulla ns. edistykselliset pitivät maamme valtionkirkkoa militarismia syleilevänä kiihkoisänmaallisuuden ikuisena linnakkeena. Tosiasiassa militarismi ja nationalismi eivät enää sotien jälkeen olleet valtionkirkossa mitenkään esillä. Päinvastoin, kirkko korosti rauhantahtoisuuttaan kuten se teki jo 1900-luvun alussa. Poikkeuksen tästä kirkon yleisestä linjasta muodosti korkeintaan vain sisällissodan jälkeinen lyhyt kausi kun 1920-luvulla opiskelunsa aloittaneet Akateemisen Karjala-Seuran nationalistiset teologian opiskelijat pääsivät kiinni papin virkoihin. Heidänkään määrää ei pidä liioitella. Samanlainen ideologinen heilahdus tapahtui 1970- ja 1980-luvuilla, kun 60-lukulaiset yleisvasemmistolaiset pääsivät vaikuttamaan kirkolliseen elämään. Kuten 1930-luvun äärioikeistolaisten pappien, myös näiden uusvasemmistolaisten määrä oli vähäisempi kuin heidän vaikutuksensa.

 

Naispappeus ja jatkuva hinku ”uudistamiseen”

 

Juuri vasemmistolaisten ja liberaalien teologien vaikutuksesta kirkko hyväksyi ensin naispappeuden vuonna 1986. Sittemmin heidän tavoitteekseen on tullut koko kirkon politisointi, joka on näkynyt uusvasemmiston muotiteemojen kuten seksuaalivähemmistöjen ja ulkomaalaisten asioiden ajamisena. Tämä on luonnollisesti merkinnyt radikaalia muutosta kristinuskon perusopetuksissa ja moraalissa.

Kun nainen on protestanttisen uskon auktoriteettina pidetyn Uuden testamentin opetusten (1. Kor. 14: 34) vastaisesti päästetty papiksi, se on raivannut lisää tietä ajan henkeä peilaaville poliittisesti korrekteille Raamatun tulkinnoille. Moraalista kantaa tasa-arvoon ei tarvitse ottaa, sillä se kuuluu yhteiskunnassa alati muuttuviin maallisiin arvoihin, joilla ei pitäisi olla kirkossa sen enempää sijaa kuin muillakaan ulkoa tuoduilla arviointiperusteilla. Olennaisempaa olisi sen sijaan arvioida, kuinka kirkko itse noudattaa omia opetuksiaan. Mikäli uskonnollisen yhteisön auktoriteetit arvioivat uskontoaan muilla mittareilla kuin sen omilla pyhiksi kanonisoiduilla kirjoituksilla, kyse ei ole enää itsenäisestä uskonnosta, vaan alistumisesta ulkopuolisille voimille, joilla on vieraat päämäärät.

Vaatimus noudattaa kristillistä oppia sen teologiasta käsin on kirkon asioihin halukkaasti puuttuville ns. arvoliberaaleilla ja punavihreille kiusallinen, ja siksi he ohjaavatkin keskustelun sivuraiteelle. Siksi he väittävät perustellusti ettei kirkko itsekään noudata kirjaimellisesti Raamatun sanaa. Esimerkiksi Raamattu tuomitsee miesten pitkät hiukset ja tatuoinnit, mutta vastaavasti kirkko sallii ne. Useimmat esimerkit kirkon epäjohdonmukaisesta linjasta on tarkoituksella valikoitu Vanhasta testamentista. Koska kirkko noudattaa Raamatun opetuksia aina jossain määrin valikoiden, pitäisi tästä ”uudistajien” mielestä seurata, että sitä on sen vuoksi syytä tulkita miten tahansa ikään kuin kaikilla sen opetuksilla ja säännöillä olisi sama moraalinen painoarvo. Tällä huvittavalla silmänkääntötempulla halutaan asettaa kaikki moraaliset kysymykset samalle viivalle, mikä sopii tietysti hyvin utopistisille voimille, jotka haluavat korruptoida keskeisten kansakuntaa koossapitävien instituutioiden kuten avioliiton merkitystä.

Avoimessa yhteiskunnassa kenellä tahansa on oikeus arvostella uskontoja, mutta silloin kun kirkon palveluksessa oleva henkilö esittää moraalista kritiikkiä Raamatun sisällöstä, pitäisi sille olla painavat teologiset perusteet. Muussa tapauksessa nousee epäilys, että kritiikin esittäjä haluaa muokata Raamatun oppeja niin, että ne palvelevat jotakin tärkeää maallista päämäärää. Yleensä nuo päämäärät ovat uusvasemmiston identiteettipolitiikkaan liittyviä lempiteemoja. On esimerkiksi vaikea ymmärtää, mitä syitä homoseksuaaleilla on väen väkisin tulla mukaan itselleen vihamielisen instituution toimintaan, joka jo lähtökohtaisesti pitää heidän, jos ei taipumuksiaan, niin heidän valitsemaasa elämäntapaa tuomittavana. Mikä motiivi on tulla kirkon työntekijäksi ihmisellä, joka 60-lukulaisten radikaalien tapaan tekee yksityisestä poliittista eikä usko Raamattuun? On suorastaan historian ironiaa, että vasemmistolaiset, jotka ovat perinteisesti syyttäneet oikeistolaisia siitä, kuinka nämä käyttävät kirkkoa edistääkseen konservatiivista ideologiaa, ajavat tänään kirkon avulla omaa ideologiaansa.

Naispappeuden hyväksymisen jälkeen kirkon modernisointi on vain kiihtynyt. Yhtenä selittäjänä on naispappien poliittinen suuntautuminen – heistä suuri osa kannattaa vihreitä. Pappisliiton tekemä selvitys vuodelta 2002 vahvistaa, että vihreät ovat naispappien keskuudessa ylivoimaisesti suosituin puolue. Miehistä keskustaa kannatti kaksi kertaa niin usea kuin vihreitä. Vihreiden vaikutuksen kasvun myötä myös sen aatehistoriallinen tausta lisää vaikutustaan kirkossa. Tutkija Anu Kontulan kysely- ja haastattelututkimuksen mukaan tyypillinen ex-taistolainen äänestää vihreitä (45%) ja vasemmistoliittoa (32%).

Olisi erikoista jos nämä prosenttiluvut eivät jollain tapaa heijastuisi kirkon arvomuutoksessa ja poliittisesti korrekteissa Raamatun tulkinnoissa. Samalla jäisivät selittämättä näkemykset, joita on esittänyt mm. Helsingin naispiispa Irja Askola. Helsingin Sanomien haastattelussa Askola esittää, että evankelis-luterilaisen kirkon olisi syytä suorastaan riemulla antautua kilpailevan islaminuskon ekspansiivisille pyrkimyksille (Irja Askola: ”Muslimit eivät ole vihollisia”). Vielä Askolaa enemmän julkisuudessa viihtyvä kirkon sisäinen kumouksellinen on julkkispappi Jaakko Heinimäki, joka on kunnon internationalistin tapaan julistanut, että Jeesus ei olisi kannattanut kotia, uskontoa ja isänmaata. Vanhemman polven kirkollista mädätystä edustaa emerituspiispa Wille Riekkinen, joka haluaa sosiaalisen vallankumouksen (”piispa Wille Riekkinen toivoo vallankumousta”) ja Helsingin hiippakunnan emerituspiispa Eero Huovinen, jonka mielestä rasismi on synti, vaikka Raamatussa ei puhuta sellaisesta juuri mitään. Tiedetoimittaja Marko Hamilon arvio siitä että rasismin taustalta löytyy pikemminkin pääsääntöisesti vain huonoa käytöstä eikä niinkään varsinaista ideologista rasismia. Huovinen hyppäsi muiden uudistajien tavoin vain uuden muoti-ilmiön kelkkaan.

 

Valikoiva moniarvoisuuden hyväksyntä

 

Kirkon liberaalisiipi puhuu mielellään moniarvoisuudesta ja kirkon työntekijöiden omantunnonvapaudesta, mutta käytännössä niiden annetaan toteutua vain valikoivasti. Evankelis-luterilaisen uskon modernisointi alati muuttuvan ajan hengen mukaiseksi on merkinnyt monissa tapauksissa Raamatun sanan hylkäämistä, mikä on puolestaan aiheuttanut huomattavia vaikeuksia siihen edelleen uskoville papeille, kristillisille järjestöille ja sen konservatiivisille herätysliikkeille.

Dramaattinen muutos tapahtui 2000-luvun alussa, jolloin kirkolliskokous hyväksyi ponnen, jossa naispappeutta vastustavilta evättiin oikeus tulla vihityksi pappisvirkaan tai nimitetyksi virkoihin. Näin se kumosi sen vuoden 1986 naispappeuspäätöksen mukana tulleen toisen ponnen jolla taattiin oikeus toimia kirkon pappina myös niille jotka eivät vakaumuksensa mukaan voineet hyväksyä naispappeutta. Ne papit, jotka virkatoimissaan kannattavat edelleen perinteisiä raamatullisia arvoja, ovat saaneet rangaistuksia maallisissa tuomioistuimissa. Tapauksia on vähän, mikä kertoo paitsi siitä että monet miehet eivät enää halua hakeutua teologiseen koulutukseen juuri vakaumuksellisten ristiriitojen takia myös siitä että yhä useampi miespappi on jo hyväksynyt uuden liberaaliteologisen ”sisäisen herruuden” kirkossa.

Silloin kun kiistat ovat menneet oikeusprosesseihin asti ei ole ollut enää kyse instituution sisäisestä kurinpitotoimesta, vaan valtiovallan tasa-arvolainsäädännön soveltamisesta kirkon asioihin. Usein kyse on lain tulkinnasta ja siitä, onko päättävillä virkamiehillä intressiä soveltaa yleisiä lakeja itsenäiseen instituutioon tai tilanteeseen. Käytännössä valtiovallan tulkinta tasa-arvolainsäädännöstä vaihtelee tapauksen mukaan. Esimerkiksi valtioapua saavan Naisasialiitto Unionin ei tarvitse rekrytoinnissaan noudattaa Suomen laissa kirjattua tasa-arvolakia, koska järjestön mielestä miesjuristit ovat kyvyttömiä hoitamaan naisasiakkaiden asioita. Tässä nimenomaisessa tapauksessa valtion oikeusoppineet ja oikeuslaitos ovat olleet samaa mieltä Naisasialiiton tulkinnan kanssa, jolloin tasa-arvolaki on voitu sivuuttaa. Monien naispappeutta vastustavien miespappien tapauksessa lain kirjainta tulkittiin toisin päin, mutta poliittinen korrektius säilyi erilaisista päätöksistä huolimatta molemmissa samana.

 

Kuinka vaientaa niskuroijat eli Raamattuun pitäytyvät ”änkyrät”?

 

Evankelisluterilaisella kirkolla on ollut monia eri tapoja hiljentää moniäänisyys (eli ne jotka vastustavat liberaaliteologiaa). Tehokas tapa hiljentää moniäänisyyttä on käyttää taloudellista painostusta. Esimerkiksi Helsingin, Espoon ja Vantaan seurakuntayhtymät ovat aivan hiljattain leikanneet järjestötukia lukuisilta kristillisiltä yhdistyksiltä vain siksi, että ne vastustavat naispappeutta ja seksuaalivähemmistöjen ja heitä tukevien Raamatun vastaisia vaatimuksia. Taustatukea kirkko on saanut valtamedialta, etenkin Helsingin Sanomilta, joka on lietsonut antipatiaa niitä pappeja kohtaan, jotka ovat pysyneet uskollisina Raamatun sanalle. Perinteistä uskoa puolustavat papit lehti on patologisoinut naisvihamielisiksi, ”homofoobisiksi” ja suvaitsemattomiksi fanaatikoiksi, vaikka vielä joitain vuosikymmeniä sitten heidän käsityksensä olivat sekä valtionkirkon johdon että kansan kannattamia.

Kirkon uudistajat näyttävätkin onnistuneen varsin tehokkaasti listimään ne konservatiiviset järjestöt, joilla ei ole taloudellisia edellytyksiä (joilta puuttuu riittävästi sitoutuneita kannattajia) vastustaa nykyistä kirkon liberaaliteologista linjaa. Jäljelle on jäänyt kirkon johdon kannalta enää yksi, tosin sitäkin lujempi vastustaja, vanhoillislestadiolainen herätysliike. Juuri siksi hyökkäys eteenkin tätä herätysliikettä kohtaan on ollut kenties rajumpi kuin koskaan tätä ennen. Kirkon ongelma on siinä, että vanhoillislestadiolaisuus on perustoiminnassaan taloudellisesti lähes täysin riippumaton kirkosta (kirkko sen sijaan tarvitsee lestadiolaisten valtavaa lapsi- ja nuorisotyötä kaunistamaan omia masentavia tilastojaan). Sitä on siis lähes mahdoton painostaa taloudellisesti. Ainoat joilla on jotain menetettävää lestadiolaisen liikkeen sisällä ovat lähinnä sen kansankirkossa toimivat papit ja teologiaa opiskelevat. Juuri siksi kirkon uudistajat pyrkivätkin hajottamaan liikkeen juuri sitä kautta. Liikkeen itsensä kannalta leipäpapin urasta haaveilevan ”intellektuellin” lähtö toimii toisaalta liikettä puhdistavana ilmiönä, kuten Johannes Alarannan, Mari Leppäsen (os. Pentikäinen) ja monien muiden liiallisen viisauden humalluttaman lähtijän esimerkki on osoittanut. Vanhoillislestadiolaiset eivät anna tärkeissä opin kysymyksissä tippaakaan periksi kirkon uudistajien vaatimuksille. 

 

Kuinka kulttuurin ja instituutioiden tila otetaan haltuun?

 

Harva vasemmalle kallellaan olevista papista tuntee italialaisen kommunistin Antonio Gramscin (1891–1937) esittämän suunnitelman miten strategisiin instituutioihin pureudutaan kiinni eli miten ne vallataan. Harva heistä lienee myöskään tutustunut suoraan Frankfurtin koulukunnan ajattelijoiden teorioihin. Tekojensa ja puheenvuorojensa perusteella he kuitenkin näyttävät käytännössä toteuttavan Gramscin strategiaa, jossa kulttuurin ja instituutioiden tila otetaan haltuun ja täytetään omilla ”ainoilla oikeilla” ideoilla. Ja oikeastaan on lopulta aika yhdentekevää ovatko kirkon perusarvojen muutosta ajavat papit frankfurtilaisia tosiuskovia vai pelkkiä hyödyllisiä idiootteja. He ovat joka tapauksessa imeneet hienovaraisesti suodatetun frankfurtilaisen ideologiansa humanistisen, yhteiskuntatieteellisen ja teologisen tiedekunnan opetusohjelmista. Tämän ideologian keskeisin oppi ja metodi on kriittinen teoria, joka on kyseenalaistamaton teoreettinen lähtöoletus monissa yhteiskuntaa ja ihmistä koskevissa nykypäivän tutkimuksissa. Kriittinen teoria tarkoittaa länsimaisen kulttuurimme hellittämätöntä itsekritiikkiä ja epäilyä kulttuurimarxilaisesta näkökulmasta. Keskeisenä siinä on ajatus, että

”länsimainen sivilisaatio oli ollut imperialistinen ja tukahduttava voima ihmiskunnan historiassa – erityisesti länsimainen kristinusko. Heidän [franfurtilaisten] mielestään länsimainen sivilisaatio oli rakennettu aggressiolle, sorrolle, rasismille, orjuudelle ja seksuaaliselle tukahduttamiselle. Vuosikymmeniä myöhemmin tästä ideologiasta tuli filosofinen perusta eri ”kriittisten tutkimusten” -ohjelmien ja laitosten perustamiselle; kuten monikulttuurisuustutkimus, naistutkimus, rauhantutkimus ja LGBT [lesbo, gay, biseksuaali ja transsukupuoli] -tutkimus.”

Tässä kohtaa on korostettava, että frankfurtilaisten ideoiden edistämisessä ei ole kyse mistään salaliitosta, vaan menestyksekkäästä meemien markkinoinnista ja psykologian tajusta, jolla on voitu iskeä länsimaisen tietoisuuden heikkoihin kohtiin. Ainoastaan frankfurtilaisuuden kannattajat pyrkivät esittämään ideologiaansa kohdistetun kritiikin vainoharhaisena salaliittoteoriana, jotta kaikki vakava keskustelu sen argumenteista ja motiiveista voitaisiin jättää huomioimatta.

Teorian mukaan ei siis olisi ollenkaan olemassa mitään lännen perinteisille arvoille vihamielistä salaliittomaista verkostoa, jossa luterilaisen kirkkomme liberaalit papit olisivat osallisina. Pappimme eivät siis joitakin ilmeisiä poikkeuksia lukuun ottamatta tietoisesti edistä kulttuurivasemmistolaisuuden päämääriä. Kyse on lähinnä siitä, että länsimaisuutta itseruoskiva muodikas ”kritiikin kulttuuri” on läpäissyt koko älymystön ja sen ideat ovat läpäisseet myös teologien maailmankatsomuksen. Riippumatta siitä missä määrin teologit ovat kritiikin kulttuurin tartuttamia, he ovat joka tapauksessa altistuneet materialistisen maailmankatsomuksen virukselle, madolla ja troijalaiselle, jonka oireena on halu ”maailmanparannukseen”. Läntisen sivilisaation kannalta tässä on valitettavaa se, että kulttuurivasemmistolle aina niin hyödyllisten idioottien pyrkimys muuttaa maailmaa on käytännössä osoittautunut hyvillä aikeilla kivetyksi tieksi helvettiin. Kirkolle on taas ollut traagista, että maallisten asioiden ”parantaminen” on väistämättä vienyt huomion pois kirkon alkuperäiseltä hengelliseltä tehtävältä.

 

Vanhat taustat

 

Kuten on jo mainittu alkoi maallistuminen muissa maissa hieman ennen kuin ilmiö tavoitti Suomen. Ja niinpä Herbert Marcusen kaltaiset Frankfurtin koulukunnan ikonit alkoivat kuulua yliopisto-opiskelijoiden lukemistoon. Aikaisempi maallistuminen ilmeni lähinnä yhteiskunnallisiin ongelmiin keskittymisenä, jolloin hengelliset kysymykset alkoivat jäädä syrjään. Tätä kehitystä vastusti näkyvimmin kirkon konservatiivista oppositiota edustanut Osmo Tiililä, joka toimi Helsingin yliopiston dogmatiikan professorina 1939–1967. Tiililä vastusti voimakkaasti evankelis-luterilaisen kirkon sodan jälkeistä linjaa, jota vastaan hän protestoi näyttävästi eroamalla kirkosta vuonna 1962. Kaksi vuotta myöhemmin hän kirjoitti kohua herättäneen maallistumista ruotineen pamfletin ”Sata teesiä kirkosta” sekä mm. teoksen ”Miksi kristinuskoa ei voi, ei tarvitse eikä saa uudistaa?”

Osmo Tiililästä (1904-1972) elämäkerran kirjoittaneen dosentti Timo Junkkaalan mukaan Tiililä koki, että "pääsanoman syrjäytyminen oli kirkossa tapahtunut johtajien tukemana". Tiililän kritiikki kohdistui kirkon johdon ohella erityisesti Kotimaa- ja Kirkko ja Kaupunki -lehtiin, joiden Tiililä katsoi tietoisesti johtaneen mielipiteitä "valitettavaan suuntaan". Tiililä tiivisti kritiikkinsä kesällä 1962 ilmestyneeseen kirjaansa Kirkon kriisi: "Valitettavasti emme viime vuosikymmeninä ole saaneet kirkkoomme johtajia, jotka olisivat muistuttaneet meille kirkon työn perustasta." Kirkko oli Tiililän mukaan tullut välinpitämättömäksi Raamatun ja tunnustuksen suhteen, minkä seurauksena sen julistus oli menettänyt voimansa.

Tiililä selitti eronsa syitä:

"En eronnut kirkosta sitä vastustaakseni, vaan sitä protestillani auttaakseni - mutta luulen tekoni tuoneen vain vähän hedelmää. Olen suuresti murehtinut elämäni loppuvuodet Suomen kirkon maallistumista, joka on ollut sekä tahallisesti sallittua että johdettua. "

 

Tiililä selitti eronsa syyksi siis protestin kirkon valitsemasta linjasta. Sen sijaan hän ei toivonut muitten seuraavan perässä. Näin hän viestitti erolla eräänlaisesta "viimeisestä varoituksesta". Hän itse havaitsi siis varsin pian ettei erolla ollut mitään vaikutusta kirkon linjaan.

On todennäköistä, että maamme teologian opiskelijat alkoivat kiinnostua marxilaisista teemoista 1970-luvulla, jolloin katolisen kirkon kautta Etelä-Amerikasta Eurooppaan levisi hyvin äärivasemmistolaisia ja marxilaisia painotuksia sisältänyt ns. vapautuksen teologia. Chilen tapahtumat ja Suomessa aallonharjalla ratsastanut taistolaisuus sekä yleisvasemmistolainen trendi tekivät sitä tunnetuksi. Sen sijaan Frankfurtin koulukunnan feminismi ja seksuaalivähemmistöjen identiteettipolitiikka alkoivat nousta valtionkirkkomme nuorten pappien agendalle vasta 1980-luvun lopulla. Julkisuudessa avointa keskustelua kirkon mahdollisuudesta siunata homoavioliittoja on käyty jonkin verran, mutta vain äärimmäisen harvoin ne ovat kosketelleet kysymyksen ideologisia juuria. Keskustelu on jäänyt hyvin pintapuoliseksi. Vaikka luterilaisessa kirkossa vallitsee nykyään vasemmistolainen ja liberaali hegemonia, on sen sisältä noussut teologi ja dosentti Juha Ahvion lisäksi myös muita vastavirtaan kulkevia ajattelijoita, jotka ovat huolissaan kirkon entistä maallistuneemmaksi käyneestä linjasta. Heistä tunnetuimpia ovat piispa Seppo Häkkinen ja Suomen raamattuopiston toiminnanjohtaja Timo Junkkaala. Näin esimerkiksi piispa Häkkinen (11.3.2011) :

”Valtakirkot ja monet muut uskonnolliset yhteisöt ovat muuttuneet yhä enemmän tämänpuoleisuutta ja uskonnon ulkoisia vaikutuksia korostaviksi uskonnon funktion ja perinteisen uskonnollisen sanoman ja julistuksen kustannuksella. Ne ovat maallistuneet, sillä tämänpuoleiset asiat painottuvat transsendenttisten (käsityskyvyn ylittävän mysteerin) sijasta. Painopiste on siirtynyt Jumalasta ihmiseen.”

Tässä pohjimmiltaan myös syy kirkon rajuun jäsenkatoon. Yleishumanistisesta hyväntekeväisyyskirkosta, suvaitsevaisuuskirkosta tai uskonnollisesta palvelulaitoksesta on helppo erota. Se tekee itsestään tarpeettoman.

 

Havaintoja liberalisoiduista kirkoista

 

Entisenä sosialistina tunnettu emeritusprofessori Yrjö Ahmavaara kirjoitti Kanava-lehdessä (1 /1994) artikkelissaan ”Salliva yhteiskunta ja väkivallan biologiset juuret” että länsimaiden kristillinen kirkko on vieraantunut omista opetuksistaan ja perustehtävistään:

”James Bulgerin hautajaisissa pappi totesi: Englannin kirkko on ollut merkillisen hiljaa oikean ja väärän välisen eron opettamisesta. The Sunday Times-lehti jatkoi pääkirjoituksessaan (28.11.93) moitetta: ”Kukaan ei ole todella odottanutkaan siltä taholta opetusta henkilökohtaisen moraalin kysymyksissä enää pitkään aikaan: me tiedämme, mitä piispat ajattelevat Etelä-Afrikasta, mutta emme tiedä, mitä he ajattelevat Jumalasta.

---

Kirkolliset johtajat ovat yleensä olleet, heti seuraavana kirjallisen ja taiteellisen älymystön ja sosiologien jälkeen, muotiaatteita lammasmaisesti seuraava lauma kaikissa kehittyneissä maissa. Näihin aatteisiin kuuluu ennen muuta kristillisen perisyntiajatuksen vastainen oppi ihmisen synnynnäisestä hyvyydestä, jonka vain kapitalistinen yhteiskunta ja muu ympäristö turmelee.

Uusvasemmiston 1960-luvun jälkeen saavuttama hegemoninen valta-asema länsimaisessa kulttuurissa ja arvomaailman määrittäjänä ei ole perustunut niinkään argumenttien terävyyteen tai edes taitavaan propagandaan, vaan todennäköisesti siihen, että toisen maailmansodan jälkeen länsi oli henkisesti niin loppuun ajettu, että mikä tahansa tarpeeksi aktiivinen sisäinen kumousliike olisi nujertanut jäljelle jääneen kulttuurisen itsetietoisuuden. Historia tuntee monta vastaavaa burn-out kulttuurien ilmiötä. Kiistojen repimässä 300-luvun Roomassa uskostaan varmoilla kristityillä oli suhteellisen helppo tehtävä taivuttaa tahtonsa alle riutuneessa tilassa ollut valtakunta ja sen eliitti. Kehitys huipentui, kun myöhäisantiikin keisari Konstantinus Suuri (n. 272–337) kääntyi kuolinvuoteellaan kristinuskoon, minkä jälkeen Rooma alkoi hajota lopullisesti.

Kristinuskosta tuli keskiajalla koko Euroopan hallitseva uskonto ja se saattoi kirkkoinstituutionsa avulla ulottaa kulttuurihegemoniansa yhteiskunnan jokaiseen sopukkaan. Sittemmin maallistumisen myötä kirkko menetti suurimman osan entisestä henkisestä vallastaan, mutta tästä huolimatta sillä on edelleen tietty auktoriteettiasema yhteiskunnassamme. Tämän auktoriteettiaseman monet ”sosiaalisesti tiedostavat” papit käsittävät varsin hyvin, eivätkä he ole jättäneet käyttämättä tuota arvovaltaa edistääkseen asiaansa. Kyse ei ole yksittäistapauksista, vaan isosta joukosta yhteiskunnallisesti aktiivisia pappeja, jotka jakavat saman kulttuurimarxismilta haiskahtavan arvomaailman. Julkisissa puheenvuoroissaan nämä papit eivät juuri korosta uskoa Jumalaan, vaan vaativat sosiaalista muutosta, jolla he uskovat vähentävänsä maallista kärsimystä. Samankaltainen ilmiö on tuttu katolisessa kirkossa, vaikka siellä painostus on tullut kirjaimellisesti ulkopuolisilta. Pyhän Pius X:n pappisveljeskunnan johtaja piispa Bernard Fellayn mukaan Vatikaanin toisen kirkolliskokouksen (1962–1965) seurauksena katolisuutta alettiin määrittää ulkoa päin, kun se antautui uskoa vesittävälle ekumenialle ja sosiaalisten kysymysten ajamiselle. Fellay katsoo, että koska erityisesti juutalaiset johtajat kannattivat innokkaasti toista konsiilia, sen täytyi merkitä sitä, että se ajoi pikemminkin heidän asiaansa kuin katolilaisten.

Professori Karel Dobbelaere on todennut, että kirkon ja uskonnollisten yhteisöjen sisäinen maallistuminen (institutionaalinen sekularisaatio) on tyypillistä muun muassa monille perinteisille valtakirkoille. Uskonnollisten yhteisöjen transsendenttisuus on vähentynyt ja ne ovat mukautuneet yhä enemmän sekulaariin yhteiskuntaan. Tällöin selkeiden uskonnollisten käsitteiden ja lähteiden asemesta korostetaan arvoja ja etiikkaa, kuten sosiaalista oikeudenmukaisuutta, inhimillistä suhtautumista kaikkiin lähimmäisiin, yhteiskuntaluokkien välistä solidaarisuutta ja erityisen huomion kiinnittämistä syrjäytyneisiin sekä yhteisöllisyyttä.

Äkkipäätä kauniilta kuulostavia tavoitteita. Ongelma kirkon kannalta on vain se, ettei kristinuskon perusta kuitenkaan lepää maallisissa vaan ”tuonpuoleisissa” arvoissa. Juuri tässä piilee tuhon siemen. Martti Luther näki paljon selvemmin jaon hengellisen ja maallisen regimentin välillä. ”Maailmanparannusta” ajavat kirkon uudistajat hämärtävät tämän rajan ja ovat paradoksaalisesti rakentamassa taivasta vasemmistolaisessa hengessä tänne maanpäälle. Uusliberalismi näyttelee kai tässä teologiassa helvetin roolia.  Tämä utopia on tuttua ja sillä on ollut viimeisen parinsadan vuoden ajalta hyvin sosialistinen tausta.

 

Luterilainen kirkko ja hyödylliset idiootit

 

Luterilaista kirkon vallannut ”edistyksellinen” sukupolvi ei ole ainoastaan pannut uuteen järjestykseen kirkon perustehtäviä, vaan sen jäljiltä kristinuskon teologiaan on ilmestynyt täysin uusia tulkintoja. Eräs sellainen näyttää liittyvän siihen, että kirkko "suvaitsevaisuuden" nimissä näyttää omituisella tavalla pelaavan kilpailevien uskontojen pussiin. Jussi Halla-aho kysyi vuonna 2007 kiinnostavalla tavalla, onko kristinuskon ytimenä oleva ihmisen pelastuminen yksin uskosta korvautumassa uskolla, jossa ihminen pelastuu yksin suvaitsevaisuudesta. Kysymys nousi esiin, kun Kirkko ja Kaupunki -lehden päätoimittaja Seppo Simola hehkutti kirjoituksessaan “Kohti aitoa monikulttuurisuutta” ajatuksella, että kristinuskolta kannatusta vievät maahanmuuttajien uskonnot suovat suomalaisille mahdollisuuden harjoittaa pyhimmistä pyhintä eli suvaitsevaisuutta. Halla-aholle tämä monikulttuurillinen riemujuhla avautuu hieman toisin:

” Simolan ajattelussa on mielestäni teologisen tason ongelma. En ole uskontotieteilijä, mutta lukiopohjalta olen muistavinani, että kristinuskon kova ydin on ihmisen pelastuminen yksin uskosta. Ihminen siis pelastuu uskomalla siihen, että Jeesus on Jumalan poika, ja että hän kuoli syntiemme sovittamiseksi. (Jos olen väärässä, korjatkaa.)

Mikä on kirkon tehtävä? Kirkon tehtävä on julistaa pelastuksen sanomaa ja siten saattaa ihmiset pelastuksesta osalliseksi. Jos ihmiset omaksuvat muita uskontoja kuin kristinuskon, he eivät usko siihen, että Jeesus on Jumalan poika, tai että Jeesus kuoli syntiemme sovittamiseksi. Koska ihminen pelastuu yksin uskosta, tällainen ihminen ei kristillisen, myös evankelisluterilaisen kirkon, doktriinin mukaan pelastu.

(…)Mielenkiintoista olisi tietää, mikä on se kirkon oma perinne, jota Simola on pitämässä kirkkaana. Onko kirkolla jokin uskonnollinen sanoma, vai onko kirkon opillinen sisältö redusoitunut antautumiseen ja toisen posken kääntämiseen? Onko kirkon tärkein tehtävä avata ovia kilpaileville uskonnoille? Onko luterilaisesta kristinuskosta tullut kirjaimellisesti suvaitsevaisuususkonto, jossa ihminen pelastuu yksin suvaitsevaisuudesta? Ehkäpä tämä osuu aika lähelle totuutta.”

 

Kirkon erottaminen valtiosta – miksi uudistajat empivät?

 

Tietenkin helpoin tapa ratkaista kirkon jatkuva nöyristely yhteiskunnan muotiaatteiden edessä ja tarve miellyttää Jumalaan uskomattoman enemmistön oikkuja, olisi erottaa valtio kirkosta. Tällöin kirkon ei tarvitsisi välittää valtiovallan ideologisesta painostuksesta, vaan se voisi halutessaan alkaa noudattaa puhdasoppista Raamatun tulkintaa tai vaihtoehtoisesti antautua suoraan liberaalille itsetuholle. Joka tapauksessa kumpikin valinta olisi sen ja kirkkokansan omissa käsissä, eikä valtiovallan tasa-arvolautakunnilla olisi siihen mitään sanottavaa. Tällä hetkellä kirkon ja valtion suhde ei ole pappien päätettävissä, vaan siitä määräävät poliitikot, jotka voivat ideologisesti avoimemmin ajaa kulttuurimarxismin asiaa.

Kirkon erottaminen valtiosta olisi ainakin perinteisten marxilaisten mielestä askel oikeaan suuntaan. Rationaalisuutta ylistävä vanha luokkatietoinen vasemmisto kun on aina pitänyt uskontoa ja erityisesti lännen kristinuskoa vihollisenaan. Sen sijaan uusvasemmistoa määrittävässä kulttuurimarxismissa kirkon ero valtiosta ei ole lainkaan yksiselitteinen kysymys. Suurimpana vaarana uusvasemmisto pitää todennäköisesti sitä, että eron jälkeen kirkko voisi tukeutua pelkästään omaan oppiinsa, jolloin sen ei tarvitsisi välittää modernin yhteiskunnan ideologisista vaatimuksista, jotka ovat yhteensopivia kulttuurimarxilaisille tavoitteille. Toisaalta kirkon erottaminen valtiosta (jota kannattavat myös oikeistolaiset libertaristit) vähentäisi kirkon institutionaalista ja traditioita ylläpitävää valtaa, mikä loisi entistä enemmän tilaa arvotyhjiölle ja relativismille, jotka ovat välttämättömiä ehtoja kulttuurimarxistien havittelemalle länsimaisen sivilisaation jälkeisen utopian toteuttamiselle.

On helppo ymmärtää, miksi esimerkiksi vihreiden Tuija Brax kannattaa luterilaisen kirkon ja valtion yhteyden säilyttämistä. Brax on tyypillinen paternalisti, jonka poliittisena tavoitteena on punavihreä sosiaalivaltio, joka katsoo ehdollistetun yksilön perään kehdosta hautaan. Siispä hän kannattaa valtion viralliseksi ideologiaksi hivutetun tasa-arvofundamentalismin, positiivisen syrjinnän, poliittisen korrektiuden ja feminismin istuttamista kaikkiin instituutioihin – varsinkin niihin, jotka jo lähtökohtaisesti pyristelevät (tai pyristelivät vielä äskettäin) niitä vastaan, kuten kirkkoon.

 

Liberaalien ongelma – ”kaikki rationaalinen sortuu”

 

Viime vuosikymmenten muutokset evankelis-luterilaisen kirkossa osoittavat hyvin sen, kuinka gramscilaista ”pitkää marssia instituutioihin” voivat edistää myös valtiovallan päättäjät eivätkä vain instituution sisäiset toimijat. Kulttuurimarxismin viruksen saaneita poliitikkoja ei kiinnosta valtionkirkon harjoittama uskonnollisuus sen perinteisessä yhteisöllisessä merkityksessä, vaan he päinvastoin näkevät sen instituutiona, jonka perusarvoja korruptoimalla voidaan romuttaa ”diskriminoivaa sukupuolijärjestystä ylläpitävä avioliittoinstituutio”. Heille kirkko on ennen kaikkea ihmisoikeuskirkko, jossa tasa-arvo ja suvaitsevaisuus edustavat korkeinta Jumalan sanaa. Näillä iskusanoilla valtionkirkkoa vaaditaan esimerkiksi antamaan homoille oikeus kirkolliseen avioliittoon, koska muu olisi uuden uskon mukaan ”syrjintää” eli ”syntiä”. Jokaiselle vakavasti ajattelevalle ihmiselle pitäisi olla selvää, että avioliitto ei ole mikään peli, ”elämäntapa” tai sosiaalinen konstruktio, jolla ei olisi biologisia juuria ja jota ei määrittelisi moraali. Paradoksaalisesti avioliiton irrationaalinen puoli tekee siitä konservatismin yhtenä oppi-isänä pidetyn Joseph de Maistren (1753–1821) mukaan juuri kestävän ja järkevän instituution; aatehistorioitsija Isaiah Berlin kirjoittaa Maistren Considérations sur la France (1796) esipuheessa, että

” Otetaan esimerkiksi avioliitto instituutio. Mikä voisi olla järjettömämpää kuin että kahden ihmisen, jotka sattuvat rakastamaan toisiaan elämänsä jossain vaiheessa, pitäisi olla koko loppuelämänsä yhdessä vailla parempaa syytä kuin se, että näin on joskus ollut? Mutta mikään ei ole lyhytikäisempää ja tuhoisampaa, mikään ei muodostu niin vastenmieliseksi kuin vapaan rakkauden järjestelmä. Näin Maistre jatkaa instituutiosta toiseen, ja väittää paradoksaalisesti, että kaikki irrationaalinen kestää ja rationaalinen sortuu. Se sortuu, koska kaikki järjen rakentama on murskattavissa tomuksi järjen avulla; mikään itsekriittisin kyvyin rakennettu ei kestä samojen kykyjen hyökkäystä. Ainostaan läpitunkematon mysteeri voi koskaan hallita ihmistä ”

On suorastaan posketonta edes väittää, että jo käsitteellisesti kaoottinen homoavioliitto jotenkin vahvistaisi kristillistä avioliittoinstituutiota. Nobel-palkittu itävaltalainen taloustieteilijä Friedrich von Hayek (1899–1992) ymmärsi Maistren tapaan, että instituutiot eivät ole syntyneet tietoisen yhteiskuntasuunnittelun kautta eikä niitä voi myöskään radikaalista muuttaa ilman että niiden alkuperäinen merkitys tuhoutuisi. Vaikka Hayek ei puolustanut instituution jumalallista postulaattia kuten Maistre, hän katsoi sen perusteen olevan laskelmallisen järjen tuolla puolen. Hayekin mukaan instituutio on seurausta kulttuurievoluution spontaanista järjestyksestä, joka selittää miksi esimerkiksi ”näkymättömän käden” ohjaama markkinatalous toimii päinvastoin kuin sosialistinen suunnitelmatalous. Kulttuurimarxilaiset tietävät miten instituutiot murennetaan, mutta muiden marxilaisten tapaan hekään eivät kykene rationaalisella yhteiskuntasuunnittelullaan pystyttämään mitään kestävää. Tästä huolimatta he jaksavat haaveilla utopiastaan. Siksi laskelmoivan ”rationaalisille” kulttuurimarxilaisille homoavioliiton siunaamisesta on tullut yksi lukuisista keinoista romahduttaa eräs keskeinen yhteiskuntaa ylläpitävä instituutio, jotta ”sortavien rakenteiden” tilalle voidaan luoda ”tasa-arvoinen”, ”moniarvoinen” ja ”ihmisen vapauttava” vapauden valtakunta.

 

Papit ”yhteiskunnallisina keskustelijoina”

 

Suomessa työntekijöitä on yhä vähemmän, puhealan ammattilaisia sen sijaan enemmän kuin koskaan. Kirkon perinteisen agendan lahottamisen myötä uudistusmielisten pappien ambitiot suuntautuvat tämänpuoleisiin asioihin. Papeista on tullut entistä näkyvämmin yhteiskunnallisia keskustelijoita. Heistä eräät ovat onnistuneet tekemään siitä jopa ammatin. Enää ei ole kovin tavatonta, että entinen leipäpappi istuu ”sitoutumattoman” lehden päätoimittajana. Vastaavasti sosiaalisesti tiedostavat ihmiset ovat ryhtyneet papeiksi, koska näkevät siinä väylän vaikuttaa yhteiskunnallisesti.

Aikoinaan papit julistivat yhtä virallista totuutta kirkon tiedotusmonopolin kautta. Tänään tuota perinnettä jatkavat valtamedioiden toimittajat, jotka ovat ottaneet itselleen asenteellisella tasolla kaikkitietävän papiston roolin. Toimittajat, jotka ovat kritiikittä omaksuneet kriittisen teorian opetukset vasemmistolaisilta tiedotusopin professoreilta Pertti Hemánukselta ja Kaarle Nordenstrengiltä, ovat tulleet alalle samoin motiivein kuin papit omalleen: ”parantaakseen maailmaa”. He eivät kirjoita kertoakseen maailmasta objektiivisen totuuden, vaan ajaakseen liberaaleja ja vasemmistolaisia arvoja. Ilmiö on tuttu koko läntisessä maailmassa. Yhdysvaltain valtavirran tiedotusvälineiden hallitsemasta liberaalien poliittisesta asenteellisuudesta kirjoittanut Bernard Goldberg paljastaa, että johtavat toimittajat ovat kallellaan vasemmalle ja toimivat sen mukaan. Goldbergin mukaan poliittinen korrektius kumoaa mediassa faktat.

Vuodesta 1996 lähtien Suomen Kuvalehden päätoimittajana toiminut Tapani Ruokanen on koulutukseltaan pappi ja puoluetaustaltaan sosiaalidemokraatti. Journalistisen linjan perusteellä häntä voi kutsua kulttuurivasemmistolaiseksi. Kristillisen Sana-lehden nettihaastattelussa (2005) hän tunnustaa olevansa edelleen ”maailmanparantaja ja idealisti”, jonka maailmankuva ”näkyy kenties pääkirjoitusten kannanotoissa, lehden kolumneissa sekä juttujen aihevalinnoissa.”

Vihollisen demonisointi sopii luontevasti pappi-päätoimittajan oman lehden linjaan, jota toimittajat äärioikeisto/muukalaisviha-jutuissaan noudattavat. Sivistyneessä julkisessa keskustelussa vastapuolen demonisointia pidetään yleensä paheksuttavana. Vastaavasti akateeminen vasemmisto tarkastelee vihollisen demonisointia toiseudesta käydyn keskustelun lähtökohdista. Yhteiskunnallisen keskustelun kannalta suuri paradoksi onkin siinä, että "äärioikeiston" leimaamista ei nähdä osana toiseuden problematiikkaa.

Kulttuurimarxilaisten ideologinen puhe toiseudesta on jo pitkään ollut osa akateemista keskustelua, josta se on levittäytynyt myös mediaan. Lähtökohtana tutkijoiden ja toimittajien toiseuden määritelmälle on ajatus, että muiden ihmisten vieraus ja poikkeavuus eivät ole essentiaalisia, vaan kaiken takana on yhteisesti jaettu ihmisyys jota Raamattukin julistaa. Siksi ei voisi olla esimerkiksi aitoa suomalaisuutta, koska se erottaa meidät "muista".

Toiseuden ongelma ei luultavasti poistu koskaan, koska ihmisen identiteetti näyttää rakentuvan siten, että se vaatii aina toisen johon tehdä ero, vaikka tiedostavalla tasolla yksilö pyrkisikin sellaisesta luokittelusta eroon. Ongelmasta eroon pyristely yhteiskunnallisin ohjelmin johtaa yleensä vain suurempiin kärsimyksiin kuin mitä niiden poistamisella ajatellaan saavutettavan.

 

Kirkon hajottajien harha – ihminen ei ole suinkaan hyvä

 

Kulttuurifilosofi Oswald Spenglerin mukaan jokainen kulttuuri perustuu yhteen johtoideaan, käytännössä uskontoon. Kun usko hiipuu, on se yleensä merkki kulttuurin siirtymisestä sivilisaation vaiheeseen ja lopulta sen hajoamiseen. Kulttuuri kestää jonkin verran sen ytimessä olevan uskon kyseenlaistamista kuten 1700-luvulla Englannissa, jolloin maassa vaikutti eliitin jäseniä vilissyt satanistinen Hellfire Club, joka harjoitti mitä hirveintä haureutta ja väkivaltaa. Tällaisen poikkeusilmiön yhteiskunnallinen luonne muuttuu ratkaisevasti silloin kun sen taustalla oleva nihilismi ja pidäkkeetön hillittömyys leviävät osaksi suurten massojen arvomaailmaa. Tällöin koko kulttuuripiiristä on vaarassa tulla yksi suuri helvetintulen kerho. Tukeutumalla uskonnon antamaan moraalisen perustaan kulttuuri on voinut taistella sitä alituisesti uhkaavaa sisäistä korroosiota vastaan ja estää massoja vaipumasta vastuuttomaan itsekkyyteen. Juuri tämä todistaa uskonnon funktionaalisen hyödyn, jonka vuoksi se on säilyttänyt sitkeästi asemansa kulttuurievoluution taistelussa. Tosin materiaalisen hyvinvoinnin ja individualismin seurauksena länsimainen ihminen on alkanut elää uskossa, jossa hän katsoo voivansa olla muista riippumaton, vain omaa hyväänsä (lue: nautintoa) toteuttava ”yksilö”. Aiemmin jo siteerattu Joseph de Maistre pitää tällaista pelkästään positiivisen ihmiskuvan varaan rakennuttua ihmistä itsetuhoisena, jolla on traagiset seuraukset koko yhteiskunnalle. Isaiah Berlin kuvaa kuinka armottomasti Maistre tuomitsee itsekeskeisen, modernisoituvan ja uskonnottoman ihmisen:

”Ihminen on luonnostaan häijy, pahatapainen, pelkurimainen ja huono. --- kristinuskon sanoma alkusynnistä, perisynnistä, on psykologisesti tarkoituksenmukaisin näkemys ihmisluonnosta. Yksin jätettynä ihmiset repivät toisensa kappaleiksi. Tässä Maistre asettuu täydellisesti omaa aikaansa vastaan: hänestä ihmiset todennäköisesti tuhoavat itsensä, ellei heitä kahlehdita rautavantein ja pidetä mitä ankarimmassa kurissa. Hänestä ihmisluonto on pohjimmiltaan itsetuhoinen ja tarvitsee ennen kaikkea hillintää ja kontrollia. Ainoa luotettava, ainoa varma asia on se, joka ei ole ihmisestä syntyisin, sillä ihmisen tekemän voi ihminen yhtä lailla tuhota. ”

Ollaan Spenglerin ja Maistren näkemyksistä mitä mieltä tahansa mikään maailmanhistoriassa ei viittaa siihen että uskontojen kumoaminen johtaisi siihen että ihmiskunta siirtyy ikuiseen onneen, ei vaikka tällaiset visiot eli houreet ovat aika ajoin saaneet laajaakin kannatusta. Yksi asia on varma, ihminen ei ole pohjimmiltaan hyvä. Ainakaan hänen suureen hyvyyteensä ei kannattaisi liikoja luottaa. Ihmiskunnan nopeimman talouskasvun aikakausi oli myös kaikkien aikojen massiivisempien verilöylyjen vuosisata. Eikä 2000-luku välttämättä lupaa kovin paljon parempaa. Marxismi puolestaan lähtee siitä että on luotava ”uusi ihminen”. Ja hänestä voidaan tehdä hyvä kunhan yhteiskunnalliset esteet poistetaan.

 

Kirkon uudistajat ”intellektuelleina”

 

Jokainen kirkon uudistaja ja ”ajattelija” haluaa mielellään että häntä pidettäisiin myös intellektuellina. Intellektuellin asenteeseen liittyy erottamattomasti kapinallisuus, kriittisyys ja usko kykyyn muuttaa koko maailma oman ajattelun voimin. Aiemmista oppineista intellektuelli eroaa siten, ettei hän ole Jumalan tai hallitsijan palvelija tai tulkitsija, vaan sijainen. Intellektuelli ei sitoudu perinteeseen, edeltäviin sukupolviin eikä menneisyyden kollektiiviseen viisauteen, vaan pyrkii itsenäisesti, pelkän oman henkisen kapasiteettinsa avulla ratkaisemaan ihmiskunnan ongelmat. Edeltäjiltään, uskonnollisilta oppineilta, hän on omaksunut jyrkän moralismin, muttei muuta.

Edistysusko liittyy olennaisesti intellektuellin määritelmään: hän ei halua muuttaa pelkästään yhteiskuntaa vaan myös ihmisen. Jos hän uskoo ihmisluonnon olevan muokattavissa, hän haluaa muovata ihmisestä paremman; jos hän pitää ihmisluontoa muuttumattomana, hän haluaa kaivaa ihmisen “alkuperäisen” jalon olemuksen esiin yhteiskunnan ja valtarakenteiden turmiollisen kuonan alta. Olipa älykkö ateisti, agnostikko tai uskovainen, hänen esikuvansa on Prometheus, joka varasti jumalten tulen ja toi sen maan päälle.

Tarkasteltaessa maineikkaiden älymystösankarien elämää löydetään yleensä hämmästyttäviä muitakin piirteitä. Yksi niistä on räikeä ristiriita sanojen ja tekojen välillä. Shelley, Ibsen, Tolstoi ja monet muut rakkauttaan koko ihmiskuntaa kohtaan julistaneet intellektuellit osoittivat läheisiään kohtaan tunteettomuutta, joka meni kauas arkisen ajattelemattomuuden tuolle puolen. Varhainen sosialisti ja köyhien vapautuksen esitaistelija Shelley kuppasi perheeltään, aatetovereiltaan ja naisystäviltään hulppeita rahasummia kustantaakseen joutilaan elämänsä. Naisasiamies Ibsenille tosielämän naiset eivät olleet muuta kuin materiaalia menestysnäytelmiin. Amerikkalainen historioitsija Paul Johnson piirtää erityisen vastenmielisen muotokuvan Sartresta, joka ihannoi kirjoituksissaan poliittista väkivaltaa ja yllytti kolmannen maailman itsenäisyysliikkeitä surmaamaan valkoisia eurooppalaisia, mutta oli omassa elämässään pelkurimainen hedonisti.

Miten tämä liittyy kirkon intellektuelleihin? Intellektuellien kriittinen arviointi antaa tuloksen myös kirkon uudistajista joista löytyy hyvin äkkiä seuraavia ominaisuuksia:

- tekopyhyys (mm. valikoiva suvaitsevaisuus)

- silmiinpistäviä ja toistuvia ristiriitoja ihanteiden ja käytännön välillä

- he luottavat vain itseensä, omaan moraaliseen vaistoonsa

- vaarallinen ylemmyydentunteen syntyminen

- vieraantuneisuus käytännön elämästä

- halu säilyttää sentimentaalinen (ja väärä) kuva ihmisestä ja ihmiskunnasta

Näin on olemassa ainekset sille jatkumolle, jossa esim. Suomen liberalisoitu evankelisluterilainen kirkko johtajiensa, teologiensa ja piispojensa kautta muokkaa kirkon jolla ei ole sen paremmin sen alkuperäistä, sisintä sanomaa kuin vakavasti otettavaa uskottavuuttakaan. Syntyy kirkko jolla on kaikki itsetuhon ainekset koska se panostaa kaikkensa juuri tämänpuoleiseen, ei tuonpuoleiseen. Se on kirkko, jonka johtajat ovat lähteneet vanhan vasemmistolaisuuden jalanjäljissä luomaa utopiaa jo tänne maan päälle.

Sen sijaan että luottaisimme ollenkaan näihin Suomen kirkon ”uudistajiin” ja eteenkin heidän intellektuelleihin olisi syytä miettiä mitä esim. älymystöä tutkinut Paul Johnson totesi eräässä haastattelussaan:

”(…) Evelyn Waugh, suuri kirjailija jolla oli mitä väkevin äly ja joka osasi nöyrtyä Jumaluuden edessä. Pidän Waughia, Edmund Burkea, Samuel Johnsonia, Rudyard Kiplingiä ja muita heidän kaltaisiaan miltei anti-intellektuelleina. He pitävät vakiintuneita kirkkoja, tapoja ja yhteiskunnan käytäntöjä tärkeinä ihmiskunnan viisauden osina. Jos kirjoittaisin kirjani uudelleen, tekisin siitä dialogin näiden ajattelijoiden ja intellektuelleiksi kutsumieni välillä, enkä keskittyisi pelkästään intellektuelleihin.”

Intellektuellit, myös kirkkoa sabotoivat, jotka ihanneyhteiskunnan kaipuussaan ovat olleet valmiita heittäytymään tyrannien syliin, eivät ansaitse erityisempää arvonantoa. On alleviivattava tässä sitä että kyse ei mistään salaliitosta vaan kauan sitten kehittyneestä ajattelumallista ja ideologiasta joka vähitellen läpäisi ensin älymystön ja sen jälkeen yhä laajemmat kansankerrokset ja jolla on tietysti myös kulutusyhteiskunnan aiheuttaman ajattelutavan muutoksen vaikutukset sisällään. Mutta yhtä kriittisiä on oltava myös länsimaiselle liberalismille, jonka palvoma yksilö on ollut kyvytön näkemään maailmassa mitään itseään ja omaa mielihyväänsä korkeampaa. Esim. Aleksandr Solženitsynin kaltaiset ajattelijat näkevät materialismin ja sieluttoman kulutusyhteiskunnan ongelmat yhtä terävästi kuin intellektuellit, usein paljon terävämminkin. Mutta he eivät etsi ratkaisuja omasta ylivertaisesta älystään, yhteiskunnallisista utopioista tai pidäkkeettömästä hedonismista, vaan oman kulttuurinsa traditioista, aiempien sukupolvien asteittain kertyneestä viisaudesta. Heidän henkinen kotinsa on traditiossa, olivatpa heidän ratkaisunsa sitten säilyttäviä, uudistavia, taantumuksellisia tai radikaaleja.

Kirkon uudistajan suuri harha oli siinä, että hän kasvoi kristinuskon keskeisemmän hahmon Jeesus Nasaretilaisen varoituksista huolimatta pienestä lapsesta (kristityn esikuva) aikuiseksi. Eikä kasvu jäänyt vain siihen. Hänestä kasvoi liian viisas, kaikkitietävä. Lopulta hän tuli suuren maailmanparannusvisionsa myötä Jumalaakin viisaammaksi niin että hän päätti tehdä laittomuudesta lain ja laista laittomuuden. Hän ei koskaan tajunnut sitä minkä mm. Maistre tiesi ja varmasti ainakin alitajunnassa suomalaiset konservatiivisiksi kristityiksi leimatut yksinkertaiset ihmisetkin tietävät: kaikki irrationaalinen kestää ja rationaalinen sortuu.


( Päivitetty: 30.07.2013 15:26 )

 - pelontorjunta | Kommentit (2)Kommentoi



 Hitlerin suuri sosialistinen unelma
23.07.2013 14:24 | pelontorjunta

Huhtikuussa 1945, kun Adolf Hitler kuoli oman käden kautta Berliinissä, kukaan ei ollut paljon kiinnostunut siitä, mitä hän oli aikoinaan todella uskonut ja ajatellut. Tämä oli odotettavissa. Sota ei ole pohtimisen ja harkinnan aikaa, ja mitä Hitler oli tehnyt oli niin järkyttävää ja niin laajalti tunnettua kuolemanleireineen ja joukkohautoineen, että vähän tai ei lainkaan voitiin ja haluttiin kiinnittää huomiota kansallissosialismin ideologiaan. Sen ajatteleminen on aivan mahdotonta. Hitler, joka oli näyttänyt (oli näytetty) hyypiönä tai pellenä paljastettiin roistojoukon johtajana, ja niinpä hänestä ei haluttu juuri enempää tietääkään.

Mutta lähes 70 vuotta myöhemmin Hitleristä ja hänen ideologiastaan on paljonkin sanottavaa. Jopa roistolla voi olla syynsä ja motiivinsa. Ja niitä on eteenkin viimeisen parinkymmenen vuoden aikana alettu kaivaa esille ja vaikka ne eivät voi muuttaa tuomiota, rikastuttavat ja syventävät ne epåäilemättä sitä kuvaa jota meille on tarjottu. Hitlerin uskottujen kuten Albert Speerin julkaisemat muistelmat, hänen sota-aikaiset pöytäpuheet, poliittisen uran alkuvaiheista esille nousevat asiat sekä esim. Hermann Rauschningin ja Otto Wagenerin tarkasti dokumentoidut tai muistinvaraiset merkinnät Hitlerin näkemyksistä omalle sisäpiirilleen tai Joseph Göbbelsin henkilökohtaiset päiväkirjamerkinnät nostavat esiin kiinnostavia asioita.

Nykyisin on selvää ja hyvin perusteltua arvioida että Hitler ja hänen liittolaistensa uskoivat olevansa sosialisteja ja että muut, kuten demokraattisetkin sosialistit, olivat tästä asiasta samaa mieltä. Nimike kansallissosialismia ei ollut suinkaan mikään tekopyhä ja sattumanvarainen vaan itse asiassa tarkkaan harkittu ja looginen nimike tuolle aatteelle. Todisteet ennen vuotta 1945 olivat enemmän yksityisiä kuin julkisia, mikä on ehkä sinänsä jo. Julkisuudessa Hitler esiintyi/esitettiin aina marxilaisuuden vastustajana ja aikana jolloin Neuvostoliitto oli ainoa sosialistinen valtio maan päällä ja bolshevismin vastaisuus hänen suosionsa suuri tekijä, olisi hän ymmärrettävästi ollut haluton puhumaan mitä todella ajatteli. Hänen (väitetty ja todellinen) suuruudenhulluus olisi joka tapauksessa estänyt häntä kutsumasta itseään kenenkään opetuslapseksi. Se synnytti oudon ja ristiriitaisen allianssin nykyhistorioitsijoiden ja kuolleen diktaattorin mielen välille. Monet viimeaikaiset analyytikot ovat pilkuntarkasti kieltäytyneet tutkimasta Hitlerin syvimpiä poliittisia ja ideologisia ajatuksia. Niinpä he hyväksyvät enempiä kyselemättä kuten monet natsit 1930-luvulla iskulauseet "ristiretkestä marxilaisuutta vastaan" kuin yhteenvetona hänen näkemyksistään. Aikana, jossa fasismista on tullut haukkumasana (sille on perusteet) ei näytä olevan tarvetta todennäköisesti edes analysoida sitä syvästi.

Mitä hän todella ajatteli? Vaikka hänen tiedetään maininneen ettei hän paljasta syvimpiä ajatuksiaan kenellekään, niin jokainen ihminen joka puhuu, paljastaa samalla itsensä. Jokaisella on myös tarve edes hieman avata näkemyksiään. Hitlerilläkin oli tietty pieni sisäpiiri jolle hän avautui – tiettyyn rajaan saakka. Hänen yksityiset keskustelut, silloinkin kun ne eivät kaada hänen mainettaan kommunismin vastustajana, määrittelevät tosiasiassa hänen näkemyksensä varsin painavasti. Hermann Rauschning, danzigilainen natsi joka tunsi Hitlerin hyvin jo ennen vuotta 1933 kertoi Hitlerin yksityisesti ja syvällisesti tunnustaneen hänelle olevansa velkaa marxilaiselle perinteelle. "Olen oppinut paljon marxilaisuudesta", hän huomautti kerran, "enkä epäröi myöntää sitä". Hän oli ylpeä siitä miten paljon tietoa marxilaisista teksteistä hän oli hankkinut jo ennen ensimmäistä maailmansotaa ja myöhemmin Baijerin vankilassa vuonna 1924, epäonnistuneen Münchenin vallankaappauksen jälkeen.

Melkein samoihin aikoihin kun Hitler avautui Rauschningille (1939) kertoi hän Münchenin vallankaappauksen epäonnistumisen syistä toiselle sisäpiiriläiselle, uskotulleen Otto Wagenerille. Ongelmaksi muodostui Hitlerin mielestä Weimarin tasavallan poliitikot koska "ne eivät ole koskaan edes lukeneet Marxia" viitaten siihen, ettei kukaan joka ei ollut lukenut niin tärkeää tekijää voi ymmärtää nykymaailmaa. Hitlerin jatkoi keskustelua sanomalla että tämän ymmärtämättömyyden seurauksena Weimarin poliitikot kuvittelivat, että lokakuun vallankumous 1917 oli "venäläinen yksityinen asia", vaikka todellisuudessa se oli muuttunut koko ihmiskunnan historian! Hitler totesi Wagenerille että hänen ero kommunisteihin oli vähemmän ideologinen kuin taktinen. Saksan kommunistit jotka Hitler oli tuntenut ennen nousua valtaan, kertoi hän puolestaan Rauschningille, ajattelivat että politiikka tarkoitti puhumista ja kirjoittamista. He olivat pelkkiä pamflettien kirjoittajia, kun taas " minä olen pannut käytäntöön mitä nämä kaupustelijat ja kynän heiluttajat ovat arkana aloitelleet", lisäten paljastavasti, että "koko kansallissosialismi" perustui Marxiin.

Se on järisyttävä huomautus ja suorasukaisempi kuin mikään hänen puheistaan tai edes Mein Kampf, vaikka jopa omaelämäkerrassaan hän toteaa, että hänen oma oppi erottuu täysin marxilaisuudesta sen vuoksi, että se tunnustetaan rodun merkityksen - vaikka se helposti näyttää johdannaiselta. Asia on nimittäin niin, että Karl Marxin ja Friedrich Engelsin kirjoituksissa rotu ei suinkaan ollut näkymättömissä kuten myöhemmin tulemme havaitsemaan. Ja Hitler tiesi tämän. Hän oli lukenut Marxin tarkemmin kuin useimmat marxilaisuuden asiantuntijoina esiintyvät sillä hän oli lukenut myös ne Marxin näkemykset joista monet sosialistit tänään eivät ole edes tietoisia.

Ilman rotua, Hitler jatkoi, kansallissosialismi "ei voisi tehdä mitään muuta kuin kilpailla marxilaisuuden kanssa sen omalla kentällään". Marxismi oli internationalistinen. Proletariaatilla, kuten kuuluisa iskulause julistaa, ei ole isänmaata. Hitlerillä oli isänmaa, ja se oli hänelle kaikki kaikessa. Kansallissosialismi oli siis nimensä mukaisesti sosialismia jolla oli kansa, isänmaa. Bolshevismi ainakin väitti edustavansa kansainvälistä sosialismia, vaikka esim. Stalinin puhdistuksissa näkyi vahva etnisenkin puhdistuksen jälki.

Silti yksityisesti, ja ehkä jopa julkisesti, Hitler myönsi, että kansallissosialismi perustui Marxiin. Oppikappaleen perusta ei ole oppikappale kuten rakennuksen perustus ei ole sama kuin rakennus, ja todellakin - monin tavoin kansallissosialismi perustui marxismiin. Sillä marxismi oli teoria historiasta, eikä kuten liberalismi tai sosiaalidemokratia, pelkkä asialista lainsäädäntöehdotuksia. Se oli teoria ihmisestä ja ihmiskunnasta, ei vain Saksan. Se oli myös historiaa, huumaava visio, joka väitti ymmärtävänsä koko menneisyyden ja tulevaisuuden ihmiskunnalle. Hitlerin löytö oli että sosialismi voisi olla sekä kansallista sekä kansainvälistä. Voisi olla myös kansallinen sosialismi. Näin hänen kerrottiin puhuneen toverilleen natsi Otto Wagenerille 1930-luvun alussa. Sosialismin tulevaisuus lepää "kansan yhteisöllisyydessä", ei kansainvälisyydessä, hän väitti, ja hänen tehtävänään oli "muuntaa Saksan kansa sosialismiin ilman että tapetaan vanhaa individualismia", mikä tarkoittaa yrittäjyyden ja liikkeenjohdon yhteiskuntaluokkia joita oli vielä liberalismin aikana jäljellä. Niitä tulisi käyttää, ei tuhota. Valtio voisi hallita omistamatta, yhden puolueen johtamana, talous voitaisiin suunnitella ilman että omistavia luokkia tuhottaisiin.

Toteutus oli ratkaisevaa. Luokkasota, kuten Venäjän sisällissota oli juuri osoittanut, saattoi tarkoittaa vain sitä että saksalaiset taistelevat saksalaisia vastaan, ja Hitler uskoi että oli olemassa nopeampi ja tehokkaampi reitti. Voisi olla sosialismi ilman sisällissotaa.

Kun individualismi oli päättynyt, hän kertoi Wagenerille, tehtävänä oli "löytää ja matkustaa tietä pitkin yksilöllisyydestä sosialismiin ilman vallankumousta". Marx ja Lenin olivat Hitlerin mukaan nähneet oikean tavoitteen, mutta valinneet väärän reitin - pitkän ja turhan kivuliaan reitin - tuhoamalla porvariston ja keskiluokan, Lenin oli tehnyt Venäjästä harmaan massan, he olivat menneet "keskimäärin alaspäin", ja että kansallissosialistinen valtio voisi kohottaa elintason korkeammaksi kuin kapitalismi oli koskaan kokenut. On selvää, että Hitler ja hänen liittolaistensa tarkoittivat heidän vaatimuksensa sosialismista otettavan vakavasti. Ja he ottivat sen itse vakavasti.

Lähes 70 vuotta on Hitleriä kuvattu, jos ei konservatiivina - sanassa on liian haaleita sävyjä - niin ainakin äärimmäisenä esimerkkinä oikeistolaisesta. On erittäin kyseenalaista, olisikohänen ystävänsä tunnistaneet Hitlerissä tuon kuvauksen. Omilla ajatuksillaan hän ei antanut näkyvyyttä vasemmalle tai oikealle, ja hän ei todennäköisesti nähnyt järkeä tuossa lineaarisen politiikan teoriassa. Koska hän oli ratkaissut kaikkien aikojen arvoituksen historian osalta, kuten hän kuvitteli, kansallissosialismi olisi ainutlaatuinen. Ainekset saattoivat olla monipuolisia ja tuttuja, mutta niiden yhteenveto oli hänen.

Hitlerin mieli oli monella tapaa vanhakantaisempi: ei keskiaikainen kokonaisuutena, kuten esimerkiksi viktoriaanisilla sosialisteilla Ruskilla ja William Morrisilla, vaan itseasiassa kiehtovalla tavalla paljon syrjäisemmässä menneisyydessä sankarillisine hyveineen. On hyvin laajalti unohdettu – ja tämä on tärkeää muistaa - että paljon samaa voidaan sanoa myös Karl Marxin ja Engelsin mielestä. Näiden kahden sosialismin ikoonin kirjoituksista löytyi tästä selviä todisteita. Sosialisteilla oli suorastaan myyttinen kaipuu sankarilliseen hyveelliseen menneisyyteen jonka juuri kapitalismi ja sen mukana ahneus oli tuhonnut.

Until its complete extermination or loss of national status, this racial trash always becomes the most fanatical bearer there is of counter-revolution, and it remains that. That is because its entire existence is nothing more than a protest against a great historical revolution… The next world war will cause not only reactionary classes and dynasties, but also entire reactionary peoples, to disappear from the earth. And that too is progress.”

–Friedrich Engels (from The Magyar Struggle)

On kysymys rodusta, ennen kaikkea, ja että noin 70 vuotta on estänyt sen että kansallissosialismi ymmärrettäisiin sosialismina. Proletariaatilla ei saata olla isänmaata, kuten Lenin sanoi. Mutta silti Karl Marxin mielestä olisi ollut rotuja, jotka joutuisivat väistämättä tuhotuksi (vallankumousprosessissa) . Tämän näkymän hän julkaisi tammi-helmikuussa 1849 artikkelissaan jonka Engels nimesi "Unkarin kamppailuksi". Marxilaisen lehden Neue Rheinische Zeitungin kohta muistuttaa sosialisteja Hitlerin noususta valtaan myöhemmin. Nyt on siten mahdollista arvioida, että Auschwitzilla oli sosialistisia vaikutteita. Marxilainen historia tarvitsee ja vaatii kansanmurhan syistä implisiittisesti sen väitteen, että feodalismin täytyy antaa tilaa kapitalismille, joka puolestaan korvautuu sosialismilla. Marxilaisen teorian mukaan rodut jotka ovat jääneet kaksi askelta jälkeen kehityksestä tuhoutuisivat vallankumouksessa, sillä ne olisivat kykenemättömiä vallankumoukseen. Engels kutsui näitä rotuja nimikkeellä ”racial trash” ja ne kuuluisivat hänen mielestään historian tunkiolle. Marxin ja Engelsin julkea rasismi ja värillisten sekä myös eurooppalaisten ”alempiarvoisten rotujen” halveksunta on asia jota vasemmistolaiset eivät halua uskoa. Mutta dokumentit puhuvat puolestaan.

Tämä julma näkymä, joka sukupolvea myöhemmin oli tarkoitus toteuttaa väkevästi mm. uudella pseudo-tieteellä, eugeniikkalla, oli jo vuosisadan ajalta tuttu osa sosialistista perinnettä, vaikka ymmärrettävästi Auschwitzin vapauttamisen jälkeen ovat sosialistit olleet innokkaita unohtamaan sen. Mutta on runsaasti todisteita kirjoituksissa kuten H.G Wellsin, Jack Londonin, Havelock Ellisin, Webbsin ja monien muiden siitä, että sosialismissa ei kaihdeta radikaaleja toimenpiteitä. Ajatus etnisestä puhdistuksesta oli sisällä ortodoksisessa sosialismissa ainakin vuosisadan ajan.

“The classes and the races too weak to master the new conditions of life must give way…. They must perish in the revolutionary holocaust.”

-Karl Marx (from The People’s Paper, April 16, 1856)

 

Näin sosialistinen älymystö länsimaissa oli ensimmäiseen maailmansotaan saavuttaessa julkisesti jo sitoutunut rodun puhtauteen ja valkoisten ylivaltaan eikä vähemmän sitoutunutta väkivaltaan. Sosialismi tarjosi heille valtakirjan, ja luvan tappaa ja toteuttaa kansanmurhia. Vuonna 1933 esipuheessa On the Rocks, Bernard Shaw esitti julkisesti tyytyväisyytensä joukkotuhon periaatteesta jonka Neuvostoliitto oli jo hyväksynyt. Sosialistit voivat nyt ylpeinä todeta, että oli vihdoin löytynyt rohkeutta toimia, vaikka joistakin silti tuntui, että tällainen toiminta olisi pidettävä salassa. Vuonna 1932 Beatrice Webb huomautti teekutsuilla "erittäin huonosta tilanteen hallinnasta" kun eräiden brittiläisten Ukrainassa vierailleiden annettiin nähdä karja-autoja jotka olivat täynnä nälkää näkeviä "valtion vihollisia" paikallisella asemalla. "Naurettavaa antaa näyttää se", sanoi Webb, etevä neuvostojärjestelmän ihailija. "Englanti on aina niin tunteellinen" ja lisäsi varmuudella: "Et voi tehdä munakasta rikkomatta munia." Muutamaa vuotta myöhemmin, vuonna 1935, sosiaalidemokraattinen hallitus Ruotsissa aloitti oman rodunjalostuksen ohjelmansa pakkosterilisoimalla romaaneja, ”takapajuisia” sekä huonokuntoisia ja jatkoi ohjelmaa vielä sodan jälkeenkin.

Väite, että Hitler ei todellakaan ollut sosialistinen, koska hän toteutti kansanmurhan viittaa monumentaaliseen epäonnistumiseen historiallisen muistin ylläpitämisessä. Vain sosialistit tuona kyseisenä ajanjaksona kannattivat tai harjoittivat kansanmurhia, ainakin Euroopassa, ja poliittisen uransa ensimmäisinä vuosina Adolf Hitler oli ylpeän tietoinen siitä. Viitatessaan omalle puolueelleen, NSDAP:lle, Münchenissä elokuussa 1920 hän sitoutui sosialistien rasismille:

"Jos olemme sosialisteja, meidän on ehdottomasti oltava juutalaisvastaisia - ja päinvastoin, tässä tapauksessa materialismi ja mammona ovat ne jota pyrimme vastustamaan.”

Suurten suosionosoitusten jälkeen Hitler jatkoi:

"Miten niin sosialistina, et voisi olla antisemiitti?"

Kysymys ymmärrettiin laajalti, ja on huomattavaa, että kukaan Saksan sosialisti vuonna 1930 tai aikaisemmin ei koskaan pyrkinyt kieltämäänä Hitlerin oikeutta kutsua itseään sosialistiksi rotupolitiikassa. Aikana, jolloin sosialistinen perinne kansanmurhasta oli tuttu, tuollainen olisi kuulostanut järjettömältä. Tämä perinne, se on tärkeää havaita, oli juuri ainutlaatuinen. Euroopan vuosisadalla joka alkoi 1840-luvulta alkaen Engelsin artikkelista 1849 aina Hitlerin kuolemaan asti, jokainen joka kannatti kansanmurhaa (luokkien ja rotujen hävittämistä) kutsui itseään sosialistiksi, ja eikä poikkeuksia ole juuri löytynyt.

Ensimmäiset reaktiot kansallissosialismiin Saksan ulkopuolella on nykyisin unohdettu. Ne olivat erittäin sekavia koska fasismin nousu Euroopassa tuli vasemmistolle yllätyksenä. Sitä ei oltu marxilaisten raamatussa ennustettu ja näin hämmästys oli luonnollista. Mistä se oli tullut? Harold Nicolson, demokraattinen sosialisti ja vuoden 1935 jälkeen Englannin parlamentin jäsen, opiskeli tunnollisesti tämän asian kanssa ja päätteli viisaasti vuonna 1932 että fasismi (italialainen) oli eräänlaista puolisotilaallista sosialismia; vaikka se tuhosi vapauden, hän totesi päiväkirjassaan, "se on varmasti sosialistinen kokeilu, kun se tuhoaa yksilöllisyyttä". Moskovan näkemyksessä fasismi oli viimeinen vaihe kapitalismissa. Richard huomautti 1934 BBC:ssä, että monet opiskelijat natsi-Saksassa uskoivat "kaivavansa perustukset uudelle saksalaiselle sosialismille".

Sisällissodan puhjettua Espanjassa vuonna 1936 olivat jo monet intellektuellit lännessä varmoja, että Stalin edusti vasemmistoa ja Hitler oikeistoa. Tämä äkillinen muutos on selitettävissä vain siten että kiusallinen uusi tilanne helpoimmin sysäsi sivuun epämukavat tosiasiat ja riitasoinnut. Selitys jonka mukaan on olemassa ”poliisit ja rosvot” tai ”cowboyt ja intiaanit” - on usein riittävän tyydyttävä. Molotov-Ribbentrop-sopimusta tuskin nähtiin yrityksenä palauttaa yhtenäisyys sosialismiin. Se nähtiin vain kyynisenä lumeavioliittona.

Sodan puhkeamiseen mennessä ajatus Hitleristä minkäänlaisena sosialistina oli lähes kokonaan kuollut. Yksi outo poikkeus tästä löytyi mutta sitäkin merkittävämpi ja kiinnostavampi. Kirjallisesti sitoutuneena sosialistina heti Ranskan romahdettua vuonna 1940, kirjoitti George Orwell (”Leijona ja yksisarvinen”) katastrofin osoittaneen lopullisesti että "suunnitelmatalous on vahvempi kuin suunnittelematon talous ", vaikka hänellä ei ole epäilystäkään siitä, että Hitlerin voitto oli tragedia Ranskalle ja ihmiskunnalle. Kansallissosialistit olivat ottaneet niin paljon sosialismista piirteitä että se oli tehnyt Saksasta voimakkaan käymään sotaa. Hitler oli jo päässyt Orwellin mielestä lähelle Saksan sosialisoimisessa.

"Sisäisesti on Saksalla paljon yhteistä sosialistisen valtion kanssa."

Nämä sanat on kirjoitettu juuri ennen Hitlerin hyökkäystä Neuvostoliittoon. Orwell uskoi, että Hitler olisi jäävä historiaan "miehenä, joka teki Lontoon Cityn naurettavaksi" pakottamalla rahoittajat huomaamaan, että suunnittelu toimii ja että talouden vapaus taas ei. Hitlerin talouspolitiikka kiristi rikkaiden verotusta ja leikkasi voittomarginaaleja sekä pakotti yritykset toisensa jälkeen valtiojohtoisen talouden natsipuolueen määrittelemään viitekehykseen. Tunnettu taloustieteilijä John Maynard Keynes näki natsien toimineen täysin oikein katkaistessaan tuhoisan talouden syöksykierteen lisäämällä mm. julkista kulutuskysyntää.

Wagenerin muistelmat jossa hän tuo esille Hitlerin esittämät näkemykset piirtävät kuvan miehestä jolla oli tarjolla muiden aikakauden sosialistien tavoin visio tulevaisuudesta, joka kokoaa yhteen useita säikeitä, jotka kerran tekivät utopistisesta sosialismista vastustamattoman houkuttelevan. Siihen sekoittuu, kuten viktoriaanisen ajan sosialismissa oli tehnyt, voimakas taloudellinen radikalismi sekä romanttinen innostus kadonnutta aikaa kohtaan ennen kuin kapitalismi oli tuhonnut sankaruuden ja ennen kuin ikävä ahneus alkoi uhata perinteisiä instituutioita kuten perhettä ja heimoa.

Sosialismi, kertoi Hitler kertoi Wagenerille pian noustuaan valtaan, ei ollut uusi keksintö ihmisen hengisessä kehityksessä, ja muistutti Jeesuksesta ”sosialistina”. "Olemme ensimmäiset jotka kaivavat haudasta nämä opetukset." Jeesuksen "sosialistisuus" oli muutenkin yleinen näkemys aikansa eurooppalaisilla sosialisteilla. Hitlerin oma ihanne oli "kansojen sosialismi" eikä Marxin ja Leninin kansainvälinen sosialismi. Hän kertoi Wagenerille että ainoa ongelma aikakaudelle oli vapauttaa työvoima ja korvata pääoman valta työvoimasta työvoiman vallalla pääomasta.

Nämä ovat kiistatta sosialistisia näkemyksiä ja jos Wagener julkaisi Hitlerin näkemykset uskollisesti ne eivät jätä mitään epäilystä johtopäätökselle että Hitler oli epäsovinnainen marxilainen, joka tiesi lähteistä (Marxin kirjoituksista) ja tiesi kuinka epäsovinnainen oli se tapa jolla hän käsittelee niitä. Hän oli toisinajattelija-sosialisti. Hänen ohjelmansa oli samanaikaisesti toisaalta nostalginen ja toisaalta radikaali. Se pyrki saavuttamaan jotain, jossa kristityt olivat (Hitlerin mukaan) epäonnistuneet ja jota kommunistit ennen häntä olivat yrittäneet ja tunaroineet. "Mitä marxilaisuus, leninismi ja stalinismi epäonnistuivat saavuttaa", hän kertoi Wagenerille, "me olemme asemassa jossa sen saavutamme."

Se oli kansallissosialistinen visio. Viettelevä, samalla perinteisiä ja uusia aineksia sisältävä. Kuten kaikki sosialistiset näkemykset yleensä myös kansallissosialismi oli pohjimmiltaan moraalista, ja sen taloudelliset ja rotunäkemykset politiikassa nähtiin perustuvan universaaleihin moraalilakeihin. Aikaa myöten kansallissosialismin visiot unohdettiin sillä ne oli kiteyttänyt ja toteuttanut roisto ja klovni, jonka luomus tuhoutui sodassa. Tutkijoiden kiinnostus loppui.

Tutkimuksen kannalta tämä oli valitettavaa. Hullu ja mielipuoli joka tapauksessa kerran tarjosi tulevaisuuden vision, joka oli tehnyt viktoriaanisen ajan opin historiasta miljoonille niin jännittäväksi. Meidän aikana, kun sosialismi kokonaisuutena on kärsinyt tappion ideologiana, tuota jännitystä on epäilemättä vaikea enää vallata takaisin. Jotta voisi kokea sen uudelleen, mielikuvituksessa, voitaisiin katsoa esimerkiksi merkintää Göbbelsin päiväkirjoista. 16. kesäkuuta 1941, viisi päivää ennen kuin Hitler hyökkäsi Neuvostoliittoon, Göbbels iloitsi päiväkirjassa tulevasta voitosta bolshevismista. Ei olisi tulossa tsaarien palauttaminen valtaan, hän huomautti itselleen, kun Venäjä olisi vallattu. Mutta juutalainen bolshevismi revittäisiin juuriltaan Venäjällä ja "oikea sosialismi" - "Der Echte Sozialismus"- istutetaan paikalleen. Göbbels oli valehtelija, se on täysin varmaa, mutta kukaan ei voi milloinkaan selittää, miksi hän olisi valehdellut itselleen omassa yksityisessä päiväkirjassaan. Ja lopun elinaikansa hän uskoi, että sosialismi oli sitä mitä kansallissosialismi oli.


( Päivitetty: 24.07.2013 07:58 )

 - pelontorjunta | Kommentit (1)Kommentoi



 Uskon ja järjen vastakkainasettelu on turhaa
16.05.2013 15:23 | pelontorjunta

Richard Dawkins, Martti Luther ja Alister McGrath

 

Länsimaisella kulttuurilla, kuten varmaan sitä edeltäneillä korkeilla kulttuureilla on ollut aina omat myyttinsä. Eräs viimeisen parin sadan vuoden aikana syntynyt ja yhä erittäin sitkeässä elävä on käsitys kristinuskon ja tieteen välisestä konfliktista. Tämän ns. sodankäyntimyytin mukaan uskonnolliset vakaumukset ja tieteelliset teoriat ovat yhteen sovittamattomia, kilpailevia maailmanselityksiä. Molemmat janoavat muka toistensa kuolemaa.

Sodankäyntimyytin kannattajia saattaa löytyä erityisesti Amerikasta, uskonnollisten fundamentalistien joukosta. Jälkimmäiselle on sukua Tuomas Enbusken väite, että ”tieteellinen pasifismi” perustuu tieteelliseen päättelyyn, kun taas uskonnollinen pasifismi ”paimentolaisheimojen sienipäissään kirjoittamaan epäloogiseen myyttikokoelmaan”, siis hölynpölyyn (Helsingin Sanomat, Nyt-liite 10.5.2013).

Nokkelalta kuulostavan retoriikan alta paljastuu kuitenkin heppoista argumentointia. Enbusken ajatus tieteellisestä pasifismista on alkeellinen kategoriavirhe: tieteellinen metodi on kyllä tehokas tiedon hankkimisen keino, mutta pasifismin kaltaisiin vakaumusasioihin se antaa yhtä paljon tai vähän vastauksia kuin sarjakuvalehdet vaikkapa karjanjalostukseen.

Meidän ihmisten mieli on täynnä arvoja, uskomuksia ja vakaumuksia, jotka ovat välttämättömiä ja järkeviä, mutta joita ei voi eikä tarvitse todistaa tieteellisesti.

 

Sodankäyntimyytin synty

 

Tämä ns. sodankäyntimyytti sai alkunsa 1800-luvun loppupuolella John William Draperin ja Andrew Dickinson Whiten kirjoista. He uskoivat, että tiede tulisi evoluution lakien mukaisesti syrjäyttämään nopeasti kristinuskon.

Whiten hyökkäyksen takana oli raadollisiakin syitä sillä hän oli saamassa nimitystä rehtoriksi yliopistoon, jonka perustamista eräät tunnustukselliset yliopistot karsastivat.

Nykyisin sodankäyntimyyttiä julistaa etologi Richard Dawkins. Esimerkkinä kristinuskon tiedevihamielisyydestä hän käyttää Martti Lutherin tokaisua:

”Järki on tuhottava kaikista kristityistä”.

 

Vaikuttava ja erittäin raskauttava lausunto Lutherin kannalta. Mutta tässä on vain eräs ongelma. Martti Luther EI KOSKAAN OLE SANONUT MITÄÄN NOIN TYPERÄÄ. Siksi asia kääntyykin todella noloksi Richard Dawkinsin itsensä kannalta. Hänen olisi pitänyt tarkistaa asia, ennen kuin menee laittamaan sanoja lähes 500 vuotta sitten kuolleen maailmankuulun teologin suuhun.

Itseasiassa se mitä Martti Luther on todennut tieteestä on jotain aivan toisenlaista. Yliopiston professorina Luther suorastaan ylisti järkeä yhdeksi Jumalan suurimmista lahjoista 14.1.1536 pitämässään disputaatiossa:

”Tämän maailman asioista tärkein, korkein ja paras asia on järki. Se on jotain jumalallista.”

 

Järki oli Martti Lutherille kaikkien tieteiden äiti, vaikka sillä ei taivaaseen hänen mukaansa pääsekään. Toisaalta hän ymmärsi järjen rajoitukset selvemmin kuin naiiviin tiedeuskovaisuuteen vajonnut Dawkins.

Nykyisin sodankäyntimyytin terävimpiä kriitikoita maailmalla on englantilainen luonnontieteilijä-teologi, professori Alister E. McGrath. Professori on poikkeuksellisen avoimesti kertonut omasta kehityksestään tiedemiehenä ja totuuden etsijänä. Luonnontieteistä intohimoisesti kiinnostuneena hän väitteli tohtoriksi molekylaarisesta biokemiasta 1977 Oxfordin yliopistossa.

Sukupolvensa tavoin hän uskoi marxilaisuuteen, piti kristinuskoa lapsellisena taikauskona ja omaksui kritiikittömän käsityksen tieteen ja uskonnon välisestä sotatilasta. Perehtyminen tieteenfilosofiaan kuitenkin särki tämän mustavalkoisen asetelman ja paljasti sen dogmaattisuuden. Parhaimpien tieteellisten perinteiden mukaisesti McGrath joutui tarkistamaan käsityksiään sekä tieteestä että kristinuskosta. Hän alkoi opiskella teologiaa liittyi anglikaaniseen kirkkoon.

Nykyisin Alister McGrathia pidetään yhtenä maailman johtavista uskontofilosofeista. Hänessä yhdistää piinkova luonnontieteilijä ja oppinut teologi. McGrath hylkää sekä uskonnollisen että ateistisen fundamentalismin. Molemmat syyllistyvät kategoriavirheeseen. Uskonnollinen fundamentalismi pitää Raamattua virheellisesti luonnontieteen oppikirjana. Ateistinen fundamentalismi puolestaan pitää uskontoa jonkinlaisena epäonnistuneena luonnontieteellisenä teoriana ja rakentaa tieteestä korvikeuskonnon. Tässä on syytä korostaa ettei tiedemaailma kauttaaltaan näin ajattele vaan että tämä näkemys on nimenomaan tieteelliseen fundamentalismiin ajautuneiden yleinen näkemys. Richard Dawkins ei ole ainoa. Hän ei ole lajissaan ainoa ja suurta medianäkyvyyttä saaneena hänellä on paljon sellaisia seuraajia, suorastaan opetuslapsia, jotka sokeasti toistavat ”mestarinsa” mantroja. Useat hänen ihailijansa ovat lisäksi tieteellisesti liian matalalla osaamistasolla.

McGrath pitää sodankäyntimyyttiä virheellisenä ja vanhentuneena. Historiallisesti kristinuskon ja luonnontieteiden välillä on vallinnut vuoropuhelu. Hän suhtautuu luonnontieteiden mahdollisuuksiin positiivisesti ja suosittelee että teologian tulee tarvittaessa korjata tulkintojaan luonnontieteiden pohjalta. Toisaalta hän torjuu naiivin tieteisfundamentalismin ja tieteisuskon. Ei ole olemassa yhtä kiistatonta ja varmaa totuuden alkupistettä. Tieteessäkin joudutaan turvautumaan uskomuksiin. Sama aineisto voi saada vastakkaisia tulkintoja. Nykykäsityksen mukaan joudumme erehtymättömän tai ”todistetun” tiedon sijasta usein tyytymään todennäköisyyksiin ja parhaisiin mahdollisiin selityksiin.

Tiede on ilman muuta osoittautunut tehokkaaksi tavaksi hankkia – tietoa. Mutta tieteellä on myös rajansa. Elämän alkuperää, tarkoitusta, oikeaa, väärää ja vaikkapa päämäärää koskevat perimmäiset kysymykset ovat järkeviä, mutta mikroskooppi ja kaukoputki eivät anna niihin lopulta mitään vastauksia.

Myös intuitio, järki, kokemus ja traditio ovat mielekkäitä tietämisen lähteitä. Filosofi Ludwig Wittgensteinin kerrotaan kärjistäneen:

 

”Vaikka saisimme vastaukset kaikkiin tieteellisiin kysymyksiin, elämämme syvimpiä kysymyksiä ei olisi vielä edes sivuttu.”

 

Usko ja järki ovat kumppaneita. Molempia tarvitaan halutaan tai ei. Tämä perusasetelma ei ole muuttunut miksikään tuhansien vuosien aikana. Suomessa ja maailmalla erittäin arvostettu neurologian akatemiaprofessori Kai Kaila on useaan otteeseen esittänyt julkisuudessa sen hartaan toiveen ettei uskoa ja tiedettä pitäisi ajaa vastakkainasettelutilanteeseen - se aiheuttaisi lopulta valtavaa tuhoa molemmille ja samalla koko ihmiskunnalle. Näin Kai Kaila:

"Tiede, biologia mukaan lukien, on parhaimmillaan vain sinnikäs ja systemaattinen yritys hahmottaa reaalimaailmaa ja siinä vallitsevia säännönmukaisuuksia. Suuri osa tieteellisestä tiedosta saavutetaan kokeellisin menetelmin, ja jokainen tieteellinen koe on luonnolle asetettu kysymys. Aktiivisen tutkijan kunnianhimoisimpiin tavoitteisiin kuuluu usein osoittaa jokin tiedeyhteisössä vallitseva käsitys puutteelliseksi, tai jopa täysin vääräksi. Aidon tutkijan on siten pakko elää jatkuvassa epävarmuudessa – luonto on keskustelukumppani joka on aina oikeassa."

 

Evoluutioteoria, maallistuminen, uskonto ja ihmisen lisääntymishalu

 

On syytä tuoda esille lopuksi eräs esimerkki siitä miten ehdottomaksi totuudeksi mielletty evoluutioteoria saattaa nimenomaan ihmisen itsensä kannalta olla hieman ongelmallinen. Evoluution mekanismeja ovat muun muassa luonnonvalinta ja sen muotona seksuaalivalinta,mutaatiot,migraatio ja geneettinen ajautuminen. Luonnonvalinnan ansiosta parhaiten ympäristöönsä sopeutuvat yksilöt populaatiossa menestyvät parhaiten ja saavat myös enemmän jälkeläisiä kuin heikommin sopeutuvat. Näin menestyneimmistä yksilöistä tulee lopulta populaation vallitseva tyyppi. Koska geenit määräävät eliöiden ominaisuudet, tämä merkitsee samalla, että sopeutuvimpien yksilöiden geenit yleistyvät populaatiossa.

Teoriassa näyttää olevan ongelma sillä ihminen ei näytä oikeassa elämässä toimivan näin. Ne joilla olisi parhaimmat mahdollisuudet tuottaa jälkipolvelle parhaimmat mahdollisuudet elää, ns. hyvä elämä, heillä on vähiten lapsia. He ovat usein korkeasti koulutettuja ja erittäin hyvätuloisia. Ne joilla on heikoimmat edellytykset tarjota ns. hyvä elämä lapsilleen synnyttävät eniten. Asiat ovat siis järjen valossa kääntyneet päälaelleen. Vai olisiko kyse tässä liian matalan syntyvyyden ja toisaalta korkean syntyvyyden ristiriidassa evoluutioteorian kannalta juuri siitä että luonnonvalinta ei suosikaan ”suunnittelijoita” vaan sitä ihmispopulaatiota joka pitää yhä prinsiippinään lisääntymistä? Tämä on kysymys joka odottaa vastausta mm. tieteentekijöiltä. Pelkkä 60-lukulainen vasemmistolainen "nälkä lähtee naimalla"-hilluttelu ei riitä. Kysymys on liian järisyttävästä asiasta että se voitaisiin ohittaa latteilla sloganeilla ja hekottelulla.

Evoluutioteorialla on selitettävänä myös se miksi uskonnolliset ihmiset, kuten ortodoksijuutalaiset sekä fundamentalistiset muslimit ja kristityt synnyttävät lapsia kun taas maallistuneet ihmiset eivät. Toimiiko evoluutioteoria nimenomaan uskonnollisten ihmisten puolesta eli ovatko uskonnolliset ihmiset niitä jotka ”luonnonvalinnan ansiosta sopeutuvat parhaiten ympäristöönsä”? Kulttuurihistoria on osoittanut useaan kertaan kuinka tietyn korkean elintason saavuttaminen näyttää suorastaan tähtitieteellisellä tavalla johtavan vääjäämättä korkean kulttuurin taantumiseen, ensin uskonnon merkityksen romahdukseen, mutta myöhemmin myös mm. demografiseen heikkoon kehitykseen – väestön vähenemiseen – ja lopulta korkeakulttuurin romahdukseen ja korvautumiseen toisella, lisääntymishaluisemmalla kulttuurilla.

Tieteellä, filosofialla ja uskonnolla on vielä paljon asioita selvitettävänä. Parasta olisi myös että se tapahtuisi osapuolten yhteisymmärryksessä eikä vastakkainasettelulla.


( Päivitetty: 16.05.2013 15:52 )

 - pelontorjunta | Kommentoi



 Ubuntu ei ole yhteisön Linux-jakelu
30.04.2013 16:51 | pelontorjunta

Tämän pitäisi olla selvää kaikille, jotka ovat seuranneet Ubuntun kehitystä. Mutta niille jotka eivät ole asiaa vielä sisäistäneet tulkoot asia mainittua: Ubuntu ei ole yhteisön Linux-jakelu. Mitä nopeammin sen sisäistät sen parempi, varsinkin jos olet ollut siinä harhaluulossa, että Canonicalin johtaja Mark Shuttleworth välittää hyvinkin paljon siitä, mitä Ubuntu-yhteisön mielestä Linux-jakelun pitäisi olla.

Kyllä, Ubuntu on avoimen lähdekoodin Linux-järjestelmä, mutta niin on Android Linux samalla tavalla? Jos olet kehittäjä, kuinka monta kertaa olet kuullut Googlen konsultoineen sinua ennen kuin jokin ominaisuus on toteutettu Androidissa? Tämän jälkeen sinun ei sitten tarvitsekaan olla yllättänyt ja harmistunut siitä että Canonical tekee yhä enemmän juuri samoin. Se tekee nimittäin kasvavassa määrin päätöksiä jossa se ei kuuntele kovinkaan paljon ”yhteisön” mielipiteitä.

Niin paljon meteliä kuin kuullaankaan mm. siitä kun Canonical teki päätöksen siirtyä käyttämään uutta näyttöpalvelinta (display server) nimeltään Mir (huolimatta siitä mitä mieltä olet Mirin järkevyydestä tai järjettömyydestä), jos ajatellaan asiaa siitä näkökulmasta että päätöksen tekee kaupallinen toimija nimeltään Canonical, sinulle on siitä huomattavasti vähemmän mielenvaivaa. Sama asia nousi esille Canonicalin päätettyä että Ubuntu käyttää työpöytäympäristönään Gnomen sijasta mielipiteitä selvästi jakanutta Unityä. Asia liittyi ilman muuta mobiili- ja ARM-laitteiden aiheuttamaan muutokseen IT-maailmassa. Käsität nyt selkeämmin miksi ”yhteisöä” ei näistä asioista informoitu. Tämän asian ymmärtäminen auttaa myös käsittämään mitä seurauksia sillä on nykyisten yhteisön hankkeisiin.

Liian monet ihmiset eivät ymmärrä tätä: Ubuntu on sarja käyttöjärjestelmiä (pöytäkone, palvelin, pilvi, ja kosketus) joita sponsoroi yritys nimeltä Canonical Ltd ja Canonical on kaupallinen kokonaisuus työntekijöineen, palkattuine työntekijöineen. Siispä jokainen päätös on nyt nähtävä kaupallisen yrityksen näkökulmasta.

Siitä aloitetaan ja siihen se myös päättyy, nimittäin kaupallisiin etuihin. Vaikka Canonical on toiminut vuoden 2004 alusta lähtien, yhtiö ei ole koskaan ollut kannattava. Pidä tämä mielessä, koska se on kantava voima lähes jokaisessa päätöksessä ja hankkeessa jotka lähtevät Mark Shuttleworthin ja hänen miehistönsä päistä. Tarve että toiminnan pitää olla KANNATTAVAA. Yhteisön hankkeen puolestaan ei tarvitse olla kannattavaa sillä se kaikki tapahtuu vapaaehtoisin voimin.

Jos Canonicalin päätösten vaikutus on yhteisön lempijärjestelmän kannalta positiivinen, se on tapahtunut vain vahingossa, se ei ole ollut ehdottomasti mikään päätarkoitus. Samaan aikaan ei kannata pettyä, jos projektiisi vaikutti kielteisesti se mitä Mark Shuttleworth oli päättänyt tehdä.

Tässä mielessä, on oltava valmis hyväksymään se että päätöksissä yhä useammin paljastuu Canonicalin liiketaloudelliset tavoitteet. Niitä tulee nimittäin yhä lisääntyvässä määrin. Jos olet tarkkaillut Mark Shuttleworthia pitemmältä ajalta, näet edessäsi miehen joka pitää itseään avoimen lähdekoodin versiona Steve Jobsista. Se ei hyvä eikä huono visio, mutta se on aika osuva profiili hänestä. On hän olemukseltaan sitten hyvä tai huono lajissaan, hän on joka tapauksessa liikemies. Onhan hän aiemmilla liiketoiminnastaan saamillaan varoilla perustanut kyseisen Canonical Ltd:n.

Tämän kautta avautuu näkymä jota vastaan ”yhteisö” näkee miksi Canonical tekee kumppanuuksiin ja sovelluksiin liittyviä päätöksiä. Koska useimmat meistä uskomme aika lujasti avoimen lähdekoodin ja ohjelmistojen filosofiaan (ne ovat osoittaneet jo kauan sitten toimivuutensa ja vahvuutensa), emme välitä paljoakaan Canonicalista. Voittotavoitteeseen pyrkivä yhtiö tekee ilman muuta omalta kannaltaan oikeita valintoja. Ongelma on kuitenkin tässä nyt se että varsinainen raskaan sarjan tuotannonala ei ole osoittanut todellista kiinnostusta siitä mitä Mark Shuttleworth on kaupustelemassa.

Sarja erityyppisiä hankkeita, jotka eivät ole saaneet juuri merkittävää otetta markkinoilla (Ubuntu TV, Ubuntu Android ja Ubuntu for Phones) ajaa lopulta Mark-herran hakemaan kumppanuussuhteita jotka eivät välttämättä eroa kovinkaan paljoa siitä mitä Novell on tehnt Microsoftin kanssa (Novell on käytännössä Microsoftin taskussa). Ja ole syytä ihmettele jos löydämme pian Microsoftin Steve Ballmerin neuvottelupöydässä Mark Shuttleworthin kanssa.

Ulos umpikujasta – Open Ubuntu?

 

Mark Shuttleworth on tien haarassa. Nykyisen kaltaisella toiminnalla hän ei voi koskaan tehdä voittoa. Sam Varghesella on ratkaisu Shuttleworthin dilemmaan: 

Over the past few weeks, the man who runs Canonical, Mark Shuttleworth, has had to announce numerous changes in the way the Ubuntu GNU/Linux distribution is run.

There has been a decision to change the display server and a decision to change the length of support for non-LTS (long term support) releases. The community around Ubuntu has not been kept informed about these changes until the news was dumped on them.

And, as usual, when that happens, Shuttleworth has faced the wrath of the people who have for long considered Ubuntu to be only a community distribution.

Of course, the people are not to blame - the idea that this project is solely a community one was created and propagated by Shuttleworth and his minions. There was never a whisper that Ubuntu is a commercial distribution that needs to make money or at least balance the books.

Now that Shuttleworth has started cutting back and making changes that he believes will lead to profitability, those who believed in him from the start have become his worst critics.

A good way to get out of this mess is to look at what the two other main commercial Linux companies have done - create community distributions so that users who want a desktop system can have no complaint. Red Hat's Fedora and SUSE's openSUSE have kept the fans on-side and ensured that there are no people jumping ship.

Developers who want to contribute from outside the ranks of the company are free to do so and the two projects have their own system of governance to ensure that communication channels are kept open.

But if Shuttleworth wanted to go down this route - with something which I have called Open Ubuntu - then his main drawback would be the money involved. Plus his admission that what has been called a community distribution all along is really more of a business-oriented distribution.

Both Red Hat and SUSE make enough profits to support their community distributions. What they get back makes the efforts more than worth their while. Both Fedora and openSUSE are strategic investments.

What Shuttleworth needs to realise is that a distribution cannot be both a community and enterprise system. It has to focus on one or the other.

This does not mean that people who handle various aspects of management for a community distribution do not make their own decisions. For example, in Debian, the granddaddy of all community distributions, the mailing lists are open to everyone to see what is being discussed. A decision is made by a person in charge of a particular area of operations.

Unfortunately, when something like this happens, the Canonical reaction has been to allow its community manager, Jono Bacon, to spin out some spiel that looks like a remedy. Six months later the whole fiasco is repeated and Bacon gets ready with more spin.

Canonical is cutting back on expenditure in an obvious sign that it cannot afford to continue on the path it has taken all these years. There are no more summits where developers meet in person; this now happens online. The free CDs stopped some years back. Yes, the bottomline needs to improve.

As Canonical is a private company, it does not have to declare its yearly profit and loss figures. The only revenue figures that one can find on the web are for 2009; the figure is $US30 million. If one assumes that, like SUSE, the profit margin is in the 15 to 20 percent region, then it is not much to write home about.

Getting people back on-side is important for any company that plans to make money off free and open source software. You can have all the proprietary extensions you like, but unless the community is with you, you will ultimately be toast.

Open Ubuntu, methinks, is the way to go.

 

Kiinnostavaa nähdä toteuttaako Shuttleworth koskaan tuota Vargehesen ehdotusta: jakoa kaupalliseen ja avoimeen Ubuntuun. On selvää ettei Canonical voi elää liiketoiminnallisen kannattavan yrityksen ja vapaaehtoisuuteen voittoatavoittelemattoman yhteisön kaksoisroolissa.

Jos muotitietoisesti ihailet Steve Jobsia ja sinulla on voittoon tähtäävä yritys, piilotettu tavoite olisi ilman muuta ottaa yritys yleisöltä joka tapauksessa ja ennen pitkää. Myös jalkapalloseurat olivat aikoinaan ”yhteisöjä” mm. Britanniassa vaan eivät ole enää. Tässä ovat ne tekijät eri päätöksissä ja sopimuksissa joita Mark Shuttleworth tekee. On syytä korostaa ettei Ubuntu ei ole yhteisön jakelu, käyttöjärjestelmä. Mitä nopeammin tuon asian tajuat, sitä vähemmän tulet pettymään mihinkään herra Shuttleworthin tekemiin päätöksiin.

Niin paljon mitä puhutaankin Ubuntusta ja Canonicalista on yksi asia varma: Linuxin tulevaisuus ei ole ollenkaan Mark Shuttleworthin ja Ubuntun varassa. Tällainen väite on jo lähtökohdiltaan virheellinen. Ubuntu, vastoin yleistä luuloa ei ole suinkaan suurin puhumattakaan ainoa tekijä joka on lisännyt viimeisen 9 vuoden aikana Linuxin käyttöä. Tosin Mark Shuttleworth, hänen lähipiirinsä ja jopa Ubuntun käyttäjät haluavat asian nähdä tällä tavoin.

Linux-ydintä käyttävät järjestelmät ovat vallanneet jo nyt markkinajohtajuuden supertietokoneissa, palvelinkoneissa ja mobiililaitteissa. Canonicalilla ei ole ollut kovinkaan keskeistä osaa tässä kehityksessä. Linuxin käyttö on voimakkaasti lisääntymässä myös kodintekniikassa sekä autoteollisuudessa. Maailman suurimmista pörsseistä tiettävästi noin 80% toimii Linuxilla. Internet on hyvin suurelta osin Linuxilla toimiva. Linus Torvaldsin ja Richard Stallmanin liikkeelle laskema kehitys ei ole sen paremmin Mark Shuttleworthin kuin minkään muunkaan yksittäisen Linux-toimijan, ei edes niinkään merkittävän Linuxin hyödyntäjän kuin Googlen varassa. Teollisuus, pörssit, kauppa ja julkinen sektori itse on valintansa tehnyt, ne hyötyvät ilmiselvästi Linuxista ja avoimen lähdekoodin järjestelmistä mm. kustannustehokkuuden kautta ja niiden valinta näyttää olevan lisääntyvä Linuxin käyttö läpi koko informaatioyhteiskunnan.


( Päivitetty: 30.04.2013 17:15 )

 - pelontorjunta | Kommentoi



 Rahanpesua ja virtuaalirikollisuutta
16.04.2013 16:21 | pelontorjunta

 

Rahanpesun vastaisten tutkintamenetelmien ja ehkäisevien toimenpiteiden kehittyessä rikollisjärjestöt ovat kääntyneet internetin puoleen toimittaessaan piiloon yhä suurempia laittomia pääomia. Uudella sektorilla rikollisten ei tarvitse edes huolehtia rangaistuksista, sillä lainsäädäntöä ei monin paikoin vielä ole olemassa.

Internetin kautta tarjotaan kaikenlaisia palveluja. Halukkaat voivat perustaa uusia yhtiöitä, avata pankkitilin vuorokaudessa ja suorittaa rahansiirtoja. Internetin kautta on mahdollista suorittaa rahansiirtoja. Internetin kautta on myös mahdollista käyttää elektronista pankkikirjaa, joka toimii ATM-järjestelmällä (Automated Teller Machine). Se on käytännöllisesti katsoen pankkiautomaatiotoiminta, jonka kautta voi suortiaa kansainvälisiä rahansiirtoja SWIFT-järjestelmällä (Society of Worldwide Interbank Financial Telecommunication). Tätä kautta halukkaat voivat hankkia jopa omistukseensa offshore- eli vitriinipankin.

Pankkitoiminnasta kiinnostunut henkilö voi yksinkertaisesti vain maksaa vaadittavan summan ja hankkia itselleen näin pankkitoimiluvan veroparatiisista. Täydellinen nimettömyys voidaan taata ostamalla pankin osakkeet toisen offshore-yhtiön nimiin. Verottomuus tekee toiminnasta äärettömän edullista. Oman pankin omistaminen kasvattaa yhtiön tuottoa. Pankkitalletuksista tulee näin käytännöllisesti katsoen salaisia. Tämäntyyppistä toimintaa harjoittavissa maissa aloitustalletus ei ylitä 500 000 euroa. Internetistä löytyy jopa hinnasto oman pankin perustamiseen. Kansainvälinen lisenssi maksaa 145 000 euroa ja arvonlisäveron, yhtiön perustaminen vain 4 500 euroa ja arvolisäveron. Pienikokoisen pankin rahastotalletukseksi riittää 100 000 euroa ja SWIFT-järjestelmällä operoimiseen tarvitaan 45 000 euroa. Kun vielä lasketaan yhteen muut kulut, joista kaikki eivät ole edes välttämättömiä, selviää, että 1 400 000 eurolla voi halutessaan tilata oman offshore-pankin, joka on valmis käyttöön noin vuoden sisällä.

Nimettömille tileille avatut luottokortit ovat vieläkin helpompia järjestää. Offshore-pankkeihin nojaavat rahoituslaitokset tarjoavat nimettömiä tilejä asiakkaidensa käyttöön Itä-Euroopan maissa. Internetin kautta voidaan hankkia myös henkilötodistuksia, kansalaisuuspapereita ja arvonimiä.

Kun rahanpesijä hyödyntää internetpalveluja ja erilaisia ”Offshore Profit Center”-toimintoja, hän heikentää huomattavasti likaisen rahan kierrätystä vastustavan normiston voimaa, sillä internetpalvelu ei millään tavoin syyllisty rikokseen. Se ainoastaan tarjoaa rahoituspalveluja tietämättä investoitujen pääomien mahdollisesta rikollisesta alkuperästä.

Offshore-toiminta on täysin laillista silloin, kun pääomia halutaan saada turvaan mahdolliselta poliittiselta kuohunnalta, kun halutaan välttää perintölakia - yleensä aina silloin, kun halutaan suojaan parrasvaloilta ja verottajan kouralta. Sektorilla operoivat henkilöt tietävät varsin hyvin, että ainoastaan tietyissä, tarkkaan rajatuissa tilanteissa, joihin sisältyy isäntämaan lain mukaan selvät rikos, pankki on velvollinen antamaan viranomaisille asiakasta koskevia tietoja. Tämäkään ei kuitenkaan ole ylitsepääsemätön este siitäkään huolimatta, että kansainvälisellä kentällä toimijoilla on muodollinen velvollisuus seurata ja ilmoittaa asiakkaiden rahansiirroista. Periaate oman maan lainsäädännön koskemattomuudesta tekee sopimukset mahdollisiksi mutta ei velvoita pankki- ja yhtiötoiminnan avoimuuteen. Samaan aikaan myöskään nimettömiä tilejä ja luottokortteja toimittavaa välittäjää ei voida syyttää rikoksesta, sillä tällä ei ole minkäänlaista suhdetta asiakkaisiin, jotka ostavat hänen palveluksiaan internetin kautta.

Rikollisorganisaatiot toimivat internetissä käyttäen hyväkseen sähkörahaa. Välineet, joilla ei ole minkäänlaista aineellista vastinetta, tarjoavat mahdollisuuden täydelliseen nimettömyyteen sekä yksinkertaisempaan ja nopeampaan pääoman siirtoon. Välineet ovat helppokäyttöisiä, nopeita ja tehokkaita, ja niiden kohdalla kaikenlainen valvonta lakkaa täysin. Toimija ei tunne asiakastaan, eikä hänellä näin ollen ole minkäänlaista mahdollisuutta arvioida, liittyykö operaatioon mahdollisesti joitakin outoja tai poikkeavia piirteitä. Smart cardien käytön rajoittaminen tekisi valvonnasta tehokkaampaa. Kortin ovat henkilökohtaisia lompakoita, joiden sisältö on käteistä rahaa, ja niin kuin tiedämme, käteisen rahan reittejä ei voida seurata. Poliisin käytössä tulisi olla laaja informaatioverkosto, joka takaisi mahdollisuuden tehokkaaseen kontrolliin. Smart card, älykortti, toimii kuten ladattava pankkikortti, mutta siinä ei ole samoja rajoituksia. Eräs yhtiö markkinoi korttia, jonka kate oli 92 000 euroa.

Kansainväliseen luottotoimintaan kiinteästi liittyvän sähköisen rahan liikkeitä voidaan seurata, mutta nimettömät sähkölompakot karkaavat kontrollista. Yhteistä korteille on se, että molemmat toimivat laajoilla markkinoilla ja ovat nopeakäyttöisiä. Maksumääräysten volyymi ja tempo eivät aina anna mahdollisuutta suorittaa tehokasta kontrollitoimintaa. Riittää, kun ajatellaan eurooppalaisverkosto Targetin (Trans-European Automated Real-Time Gross Settlement Express Transfer System) toimialuetta. Target on ainoa pankkialusta euroissa tapahtuville rahansiirroille.

Ainoastaan yhdenmukainen valvontajärjestelmä pystyy takaamaan tuloksia rahanpesun monitahoisella rintamalla, johon kuuluvien osake- ja obligaatioinvestointien kautta järjestäytynyt rikollisuus tunkeutuu kauppa- tai tuotantoketjuihin tai luo uusia toimintamuotoja. Se järjestää ne fuusioiden ja ketjuuntumisien kautta holdingyhtiöiksi, joka suojaa ulkopuoliselta valvonnalta kuin läpipääsemätön muuri. Tästä syystä olisi toivottavaa, että rahanpesurikoksista voitaisiin syyttää henkilöiden lisäksi myös yrityksiä. Muutos soisi mahdollisuuden puuttua niiden yhtiöiden toimiin, jotka kierrättävät rahaa esim. Italiassa, vaikka niiden pääkonttori sijaitsee usein ns. veroparatiiseissa tai maissa, jotka eivät tarjoa mahdollisuutta kansainväliseen yhteistyöhön.

 

Phishing ja call centerit

 

Toinen potentiaalinen rahanpesurintama ovat tietotekniikkapetokset, joista tehtyjen ilmoitusten määrä on yli kolminkertaistunut Euroopassa. Ns. phishing perustuu henkilöllisyyden anastamiseen.

Peruskaavan mukaan hakkeri anastaa tilin omistajan henkilöllisyyden ja tyhjentää tilin tilisiirron kautta toiselle tilille, joka kuuluu operaatiossa avustavalle rikoskumppanille. Rikoskumppani käy nostamassa rahat ja siirtää ne yleensä money transfer-järjestelmän kautta petoksen organisoineelle henkilölle.

Rahansiirto tukitilille maksaa. Internetin kautta tarjotaan suuria palkkioita niille, jotka antavat tilinsä käyttöön operaatioita varten. Järjestelmä tarjoaa mahdollisuuden käyttää suurta määrää valeomistajia, jotka antavat tilinsä rahansiirtokäyttöön. He ovat niin sanottuja valetilinomistajia tai rahamuuleja. Käteisen rahan liikkeet hoidetaan transfervälittäjien tai ladattavien luottokorttien kautta. Mitä monivaiheisempi ketju on, sitä vaikeampi poliisin on seurata rahan liikkeitä.

Valetilinomistajien rekrytointi tapahtuu internetin kautta. Ilmoituksissa tarjotaan vaivattomia ansioita, eikä tarjokkaalta vaadita muuta kuin että hänellä on oma pankkitili. Valetilinomistaja osallistuu rahanpesurikokseen, mutta näytettäväksi jää, onko kyseinen henkilö ollut tietoinen toimintansa rikollisesta luonteensa.

Elokuussa 2001 kaksi palermolaista liikemiestä, isä ja poika, saivat korkeimmalta oikeudelta vapauttavan tuomion rahanpesusyytteestä. Miehet oli tuomittu sekä ensimmäisessä että toisessa oikeusasteessa rahan kierrättämisestä phishing-menetelmällä. Korkeimman oikeuden tuomarit kumosivat vuoden ja neljän kuukauden tuomion, jonka miehet olivat saaneet esitutkintatuomarilta. Hovioikeus oli vahvistanut tuomion. Vapauttava tuomio merkitsi tärkeää ennakkotapausta alueella, joka on vielä toistaiseksi suhteellisen uusi.

Hovioikeuden mukaan rikoksen tahallisuus on pystyttävä näyttämään toteen. Pelkkä mahdollisuus, että toiminnasta saattaa olla hyötyä rikoksen toteuttamisessa, ei riitä. Liikemiehiä syytettiin siitä, että he olivat siirtäneet Western Unionin kautta 3 000 euroa venäläisille asiakkaille, jotka olivat rekrytoineet heidät internetin kautta. Rahat oli siirretty bolognalaisen urheiluseuran tililtä heidän tileille.

Monien välikäsien kautta tapahtuvia rahansiirtoja, jotka lopulta päätyvät veroparatiiseihin, on varsin hankala seurata. Vilpillisesti anastettujen rahojen takaisin saaminen on käytännössä mahdotonta. Mittasuhteittensa ja aiheuttamansa yhteiskunnallisten vahingon puolesta phishing-ilmiötä voidaan pitää vakavasti otettavana rikollisena toimintana.

Kansainväliset tutkijaviranomaiset ovat jo pitkään olleet tietoisia kyberrikollisuudesta. Poliisin palveluksessa onkin hakkereita, jotka pystyvät kehittämään vastatoimia tietotekniikkarikollisille.

Vishing on phishingin kehittyneempi ja riskittömämpi versio. Se perustuu Voip-teknologiaan, jota käyttämällä rikolliset voivat esittää ottavansa asiakkaaseen yhteyttä pankin oikeasta numerosta. He soittavat tilinomistajille, utelevat tilitietoja ja ujuttautuvat siten tietoliikennekanavia pitkin keventämään tämän käyttötiliä. Petoksen tuotto jaetaan rikollisten käytössä oleville tileille.

Toinen rikollisen käyttämä menetelmä on tunkeutuminen pankkien call centereihin, joiden kautta saadaan asiakkaiden luottamuksellisia tietoja. On mielenkiintoista todeta, että juuri Romaniassa, mihin monet yhtiöt ovat siirtäneet call center-toimintaansa, tämäntyyppisten petosten määrä on korkea. Italian keskuspankkijärjestön arvion mukaan telemaattisten petosten määrä on euroissa mitattuna n. 1,6 miljardia, kun se puolestaan esim. Britanniassa on vain puolet siitä. Tämä rintama muuttuu jatkuvasti.


( Päivitetty: 16.04.2013 16:27 )

 - pelontorjunta | Kommentoi



 Kun rock ei ollutkaan kova juttu Suomessa
02.04.2013 09:54 | pelontorjunta

Ihmiskunnalla on erikoinen piirre kirjoittaa menneisyytensä tavalla joka epäilemättä ei kestä tarkempaa kriittistä tutkimusta . Tätä historian ”puhtaaksikirjoittamista” ilmenee niin sotien kuin suurmiestenkin osalta. Myytti eli jumalaistaru (muinaiskreikaksi μῦθος, mythos, 'puhe', 'kertomus', 'tarina') on jumalia, yliluonnollisia olentoja, kaikkeuden syntyä tai muuta vastaavaa aihetta käsittelevä kertomus. Myös suuresti ihailtuja, tarunomaisia henkilöitä kutsutaan joskus myyteiksi tai myyttisiksi. Myytti kuuluu yleensä kiinteästi johonkin laajempaan mytologiaan eli jumaltarustoon.

Kreikan sana mythos piti alun perin sisällään useita erilaisia merkityksiä, kuten 'puhe', 'sana' ja 'kertomus'. Myöhemmin sana logos peri sanan mythos merkityksiä, ja viimeksi mainittu alkoi yhä useammin viitata valheeseen totuuden vastakohtana. Arkikielessä myytillä tarkoitetaan tarunomaista asiaa, kuvitelmaa, uskomusta, harhakäsitystä tai jotain järkiperusteita vailla olevaa.

Myyttejä Suomessakin löytyy vaikka muille jakaa. Urho Kekkosen lähes tarunomainen maine Suomen tyhjenevällä maaseudulla ja pohjoisen pikkukaupungeissa on taattu. Kekkonen kuulemma poisti Suomesta työttömyyden. Mitä nyt 300 000 suomalaista joutui lähtemään työnhakuun Ruotsiin ja jäljelle jääneet saivat tehdä melko mitäänsanomatonta työtä eurooppalaisittain tuskin edes keskinkertaisilla palkoilla. Mies myös koplasi sekä omat että Suomen edut yhteen. Jälkipolvi uskoo että vaikka suometuimme jollain ihmeen tavalla myös hyödyimme siitä. Vain helposti nenästä vedettävät hölmöt yleensä uskovat noihin tarinoihin. Suomi suomettui koska se palveli itsensä aiemmin jo pahasti ryvettyneen Urho Kaleva Kekkosen henkilökohtaisia valtapyyteitä ja Neuvostoliiton etuja. Ne olivat yksi ja sama asia.

Mutta siirtykäämme erääseen toiseen historian puhtaaksikirjoittamiseen – Suomen nyt uljaaksi uskottuun rock-historiaan. Avaat sitten television tai radion, luet printtijulkaisuja tai nettiblogeja, niin aina sieltä paistaa läpi kertomus siitä kuinka ”me silloin 1960-luvulla hullaannuimme rock-musiikkiin” jne. Nykyisin tehdään jo uskomattomia määriä kirjoja ja jopa elokuvia lähimenneisyydessä vaikuttaneista poppareista ja rock-yhtyeistä. Näiden julkaisujen kautta syntyy vastaansanomattomasti se kuva kuinka ”mahtavaa se kaikki silloin oli”.

Vaan miten lienee ollut todellisuus? Jos hetkeksi laitamme illuusiot, harhat ja nostalgian kultaamat muistot sivuun ja mietitään millainen oli yleinen suomalainen suhtautuminen rock-muusikoihin ja tuohon musiikkiin yleensäkin 1960- ja 1970-luvulla niin johtopäätös on aika erilainen kuin minkä viihdeteollisuus sinulle esittelee: mitään valtavaa rock-hurmosta Suomessa ei ole ollut koskaan ja erityisen vähäinen se oli juuri 1960- ja 1970-luvuilla. 

Suomen historian myydyin albumi on Queen-yhtyeen Greatest Hits II. Myyntiluku on mahtavat 150 000 kappaletta. Mutta kun yhtye ainoan kerran esiintyi Suomessa marraskuussa 1974, paikalle raahautui ainoastaan 670 musiikinkuluttajaa. Samaan aikaan Suomessa oli kovassa nousussa kotimaisen rockin oikeastaan ensimmäinen todellinen ruohonjuuritason yhtye Hurriganes. Se keräsi suurin piirtein yhtä suuria yleisömääriä pikkupaikkakunnilla keikkaillessaan kuin Queen Helsingissä. Hurriganesin osalta mitään erityistä hurmosta ei kuitenkaan pitkään kestänyt. Yhtye ei nauttinut ns. edistyksellisten rock-piirien kannatusta juuri lainkaan ja keikoilla se vetikin yleisökseen etupäässä työväenluokkaisia nuoria, jotka pitivät autoista ja ”bilistelystä”. Parin vuoden kuluttua Hurriganesin kuuluisuudet eivät keränneet enää edes pikkukaupunkien kaduilla kävellessään kenenkään huomioita osakseen, hurmoksesta nyt puhumattakaan. Ns. pikkupinkfloydit nauroivat yhtyeen monotooniselle kolmen soinnun ihmeelle. Mutta kuten Queen-yhtyeen esimerkki Helsingissä osoitti, edes ”parempi rock” ei näyttänyt vetävän massoja keikoille.

Mikael Huhtamäen kirjasta Live in Finland – Kansainvälistä keikkahistoriaa Suomessa 1955-1979 käy ilmi monta muutakin yllättävää tosiasiaa syrjäisen maan epätoivoisesta flirttailusta suuren maailman rocktähtien kanssa. Vuonna 1974 Queen ei vielä ollut maineensa kukkuloilla, mutta kuitenkin erittäin tunnettu yhtye. Kansainvälinen menestysalbumi Sheer Heart Attack oli ilmestynyt. Suomalaisia ei konsertti kuitenkaan kiinnostanut ja Kulttuuritalo Helsingissä kumisi lähes tyhjyyttään.

Brittiläisen mahtitrion Creamin - jonka vieraillessa Suomessa pääsylipussa luki Gream – lopetettua toimintansa kaksi sen jäsentä Eric Clapton ja rumpali Ginger Baker, siirtyivät Blind Faith-yhtyeeseen. Yhtyeestä kohistiin maailmalla valtavasti. Ja kun Blind Faith esiintyi kesäkuun alussa 1969 Hyde Parkissa, paikalla arvioidaan olleen yli 100 000 ihmistä. Pari päivää myöhemmin Blind Faithin keikkakalenterissa luki Helsinki ja Kulttuuritalo. Yhtyeelle oli järjestetty samalle päivälle kaksi konserttia, koska pidettiin itsestään selvänä, että molemmat konsertit myydään loppuun. Blind Faithin kahteen konserttiin myytiin yhteensä 1 350 lippua. Tällä yleisömäärällä ei olisi täytetty Kulttuuritaloa yhtään kertaa.

Monelle se AC/DC, jossa laulajana oli Bon Scott, on ainoa oikea AC/DC. Kun tämä AC/DC syyskuussa 1977 konsertoi Kulttuuritalolla, väkeä saapui paikalle vaivaiset 550 henkeä. Onhan se toki paljon verrattuna siihen, että samana vuonna Tom Waits keräsi Tavastia-klubille 200 kuulijaa.

Punklegenda The Ramonesin konsertti Kulttuuritalossa toukokuussa 1977 on myöhemmin kasvanut myyttisiin mittoihin. Mutta vasta myöhemmin – itse konsertissa oli katsojia vain 600. Yleisömäärän pienuuteen saattoi osaltaan vaikuttaa, että Ramones esiintyi samalla Suomen visiitillään Tampereella. Mutta ei senkään konsertin yleisömäärä ollut erikoisen suuri.

Toukokuussa 1967 Kulttuuritalossa esiintyi rockmaailman tuore sensaatio The Jimi Hendrix Experience. Yleisöä oli tällä kertaa sentään 1 200, mutta loppuunmyyty konsertti ei ollut. 1970-luvulla päästiin sentään useamman tuhannen yleisöihin. The Rolling Stones veti syyskuussa 1970 Olympiastadionille 5 500 katsojaa. Matti Laipio latisti jälkitunnelmaa kirjoittamalla Uudessa Suomessa, että ”ilman Mick Jaggeria Rolling Stones olisi keskinkertainen ja väritön yhtye”.Vuotta myöhemmin pitkänmatkan huippujuoksija Juha Väätäinen hullaannutti yleisurheilun EM-kisoissa samalla paikalla 45 000 suomalaista kahtena unohtumattomana iltana.

Deep Purple sai koottua Helsingin A-messuhalliin helmikuussa 1972 yli 4 000 katsojaa. Pointti-lehden toimittaja (vahvasti liioitellen) hurmaantui perusteellisesti:

”Maa tärisi ja kädet kiertyivät punaisiks. Huutoa riitti kilometrien päähän. Innostunutta ja lisää vaativaa huutoa. Ja lisää tuli”.

Monet pitävät suomalaista rock-journalismia edelleen tasoltaan kelvottomana, mutta epäilemättä muutos esimerkiksi vuoteen 1967 on ollut melkoinen ainakin Mika Huhtamäen kirjaansa Live in Finland löytämien esimerkkien perusteella. Helsingin Sanomat kirjoitti vuonna 1967 päivää ennen Jimi Hendrixin Suomen konserttia näin:

”Kun ruma laulajapoika Jimi Hendrix jokin aika sitten esiintyi Lontoon Finsbury Parkissa, hän heittäytyi lavalle selälleen ja soitti hampaillaan kitaraa! Kitara syttyi ilmiliekkeihin ja yleisöllä oli hauskaa. Miksi tämä amerikkalainen ”ruutimies” tulee maanantaina Suomeen, sen harvat ymmärtävät, mutta se on kuulemma maailman ehdottomasti paras showbändi.”

Seura-lehden musiikkipalstan toimittaja haukkui Hendrixin konsertin perusteellisesti:

”Musiikiksi ei esitystä voinut kutsua. Laulu oli sanoja, huokaisua ja huutoja. Soitto taas korvia repivää räminää ja vinkunaa ... Mene ja tiedä, mutta jos ”Jimi Hendrid and His Experience” on se, mitä kutsutaan popiksi, niin ei voi muuta kuin valittaa.”

Apu-lehti puolestaan kirjoitti ”Jimi Hendrixin maailmankuulusta lavashow'sta” otsikolla ”Hullu-Henrikin hupiklubi”. Jutussa Hendrixiä kuvailtiin mm. nykyisen popmusiikin kaunotukaksi. Jo aiemmin Suosikki oli valistanut lukijoita kertomalla, että Jimi Hendrixillä on turpea nenä.

Runsas sukupolvi myöhemmin rockmusiikista on tullut suuren luokan viihteellistä liiketoimintaa jossa musiikkia ympätään jo kaupallisiin tietokoneen pelisovelluksiin aivan harmiksi asti ja kuluttajilta pahemmin kyselemättä. Samaan aikaan konserteissa näkyy oikeastaan aika irvokas näky kun ”kapinallista” musiikkia kuuntelemassa on usein koko suku vaarista ja mummista vauvaan asti. Tähtien kamat on kuljetettu esiintymispaikoille kymmenillä rekka-autoilla ja itse ”starat” saapuvat paikalle henkilökohtaisilla suihkukoneillaan shampanjan ja kaviaarin kera. Mick Jaggerista tuli jo 1980-luvulla korkeista veroista mariseva Margaret Thatcherin politiikan kannattaja. Ted Nugentista asehullu äärikonservatiivi. Useimmat ovat kuitenkin valinneet aina poliittisesti turvallisemman ”edistyksellisen” leirin. Monet rocktähdet – esimerkkinä vaikkapa Bono ja Bob Geldoff- myrkyttävät ennestään jo sakeaa poliittista ilmapiiriä tolkuttomille ehdotuksillaan kehitysavusta. Maailman parantaminen näyttää pikemminkin pahentavan monien köyhien maiden taloutta ja köyhempien ihmisten asemaa: luomuruokaa afrikkalaisille. Vain ikääntyvät tähtien läntiset ihailijat eivät ole havainneet tämän ilveilyn todellisia kasvoja. He syytävät rahaa megakonserteissa tähdille, joista on tullut melkoisia poliittisia vaikuttajia ja eräänlaisia joka paikan touhottajia.

Ehkäpä 1960- ja 1970-luvun suomalainen nyrpeys sekä kotimaisia että ulkomaalaisia rock-tähtiä kohtaan oli sittenkin ainakin jossain määrin perusteltua. Kysymyshän on lopultakin vain siitä, että konstit on monet kun ihmiset halutaan vapauttaa liiasta rahoistaan. Kolme tai neljä vuosikymmentä sitten suomalaisilla lienee ollut parempaa käyttöä rahoilleen kuin tänään. Silloin parikymppiset nuoret ovat tämän päivän eläkeläisiä ja haluavat uskotella mielellään muille ja jopa itselleen olleensa sukupolvi sitten kovempia rokkareita kuin todellisuudessa olivatkaan.  Tosiasiaksi nimittäin jää se että 1960-luvun "kova juttu" Suomessa lienee ollut pikemminkin tango kuin rock- tai popmusiikki. 1970-luvun suuri suomalainen iskelmätähti oli puolestaan humppakuningas Erkki Junkkarinen.

 


( Päivitetty: 09.04.2013 17:43 )

 - pelontorjunta | Kommentoi



 Churchill - The Man of Blood (osa 1)
07.03.2013 14:38 | pelontorjunta

 

Säännöllisin ajoin esitetään suurelle yleisölle ja asiantuntijoille kysymys: "Kuka oli vuosisadan suurin henkilö?" Hyvin usein eteenkin anglosaksisissa maissa päästäänkin yksimielisyyteen. Väistämätön vastaus näyttää olevan: Winston Churchill. Kyllä. Esim. professori Harry Jaffa julisti jo vuosia sitten, että Churchill ei ollut vain 1900-luvun huomattavin henkilö vaan useiden vuosisatojen myös.

Tavallaan Churchill sopii vuosisadan henkilöksi sillä erityisesti 1900-luku oli paitsi hyvinvointivaltion kasvun myös tuhoisien sotien vuosisata. Winston Churchill oli päästä varpaisiin asti mies joka oli näissä toiminnoissa eräs keskeisimpiä henkilöitä. Sota tietenkin oli hänen elinikäinen intohimonsa, vaikka hän itse mainitsi toiminnan hyvinvointivaltion luomisessa erääksi suosikkisaavutuksistaan.

Jotta ymmärtäisimme millainen hän todella oli joudumme porautumaan sankarillisen julkikuvan taakse. Tavanomainen kuva Churchillistä, erityisesti hänen roolinsa toisessa maailmansodassa, oli Churchillin itsensä maalaama ja sen hän teki heti kun sota oli ohi. Viime vuosikymmeninä Churchill- legenda on hyväksytty kansainvälisissä instituutioissa ja tutkijoiden valtavirran keskuudessa. Churchillistä on tullut, kuten Christopher Hitchens totesi, "toteemi" paitsi amerikkalaisen establishmentin, New Dealin jälkeläisten, mutta myös uuskonservatiivisten vaikuttajien keskuudessa. Unohtamatta myöskään toimittajia ja kirjailijoita Wall Street Journalissa sekä leegiota "konservatiivisia" kolumnisteja kuten William Safire ja William Buckley. Ei ole poissuljettu että tällä vuosituhannella hänen bulldog-muotokuvastaan tehdään vielä jokin logo.

Epäilemättä vuonna 1940 Churchill näytteli muutaman kuukauden aikana rooliansa suorastaan erinomaisesti. Kuten sotahistorioitsija kenraalimajuri JFC Fuller totesi Churchillin sodanaikaisesta politiikasta:

"Churchill oli siihen sankarilliseen muottiin valettu mies, jossa hän raivopäänä oli aina valmis johtamaan kun kaikki näytti olevan turhaa ja oli parhaimmillaan kun asiat olivat pahimmillaan. Hänen lumoava retoriikkansa, hänen taistelutahtonsa ja hänen vaatimuksensa tuhota vihollinen vetosi ihmisen vaistoihin ja teki hänestä erinomaisen sodan johtajan. "

Historia toistaa itseään heittäessään Churchillin kaksintaisteluun Hitleriä vastaan. Ei siis ihme että hänen kuuluisin puheensa "taistelemme heitä vastaan rannoilla ... me taistella heitä vastaan kentillä ja kaduilla", oli plagioitu Ranskan johtajalta Clemenceaulta Ludendorffin suurhyökkäyksen ajalta ensimäisessä maailmansodassa, vaikka todellisuudessa uhka saksalaisten invaasiosta Britanniaan oli hyvin vähäinen (ja että Hitler todellisuudessa halusi Britannian kanssa rauhan). Muutaman kuukauden aikana vuonna 1940, Churchill näytteli roolinsa unohtumattomasti.

 

Opportunismia ja retoriikkaa

 

Tosiasiassa termi joka ennen vuotta 1940 parhaiten liittyi Winston Churchilliin oli "opportunisti". Hän oli kahdesti muuttanut puoluekantaansa; Konservatiiveista (Tory) Liberaaliksi ja sitten takaisin. Siirtymistään liberaaleihin selitettiin vapaakauppakysymykseen liittyväksi. Mutta vuonna 1930, hän möi koko vapaakaupan sekä jopa ruokatariffit ja julisti heittäneensä "Cobdenismin" pois ikuisesti. Kauppakamarin johtajana ennen ensimmäistä maailmansotaa hän vastusti varustautumista. Kun hänestä tuli meriministeri vuonna 1911, vaati hän suurempia ja suurempia talousarvioita, levitti villejä huhuja voimistuvista Saksan merivoimista, aivan kuten hän teki myös 1930-luvulla samantapaisilla väitteillä Saksan ilmavoimista. Hän hyökkäsi sosialismia vastaa ennen ja jälkeen maailmansodan, kun taas sodan aikana hän edisti sotasosialismia, jossa vaadittiin rautateiden kansallistamista ja hän totesi puheessaan:

"Meidän koko kansakunta on organisoitava, sosialisoitava, jos haluat käyttää tätä termiä. "

Churchillin opportunismi jatkui loppuun asti. Vuoden 1945 vaaleissa hän viittasi Hayekin ”Road To Serfdom” (Matka maaorjuuteen) -kirjaan ja yritti maalata työväenpuolueesta totalitaarisen vaikka Churchill itse vuonna 1943 oli hyväksynyt Beveridge-suunnitelmat sodanjälkeisestä hyvinvointivaltiosta ja keynesiläistä talousmallista. Läpi uransa hänen ohjenuoranaan oli kiivetä valtaan ja pysyä siellä.

Kaksi periaatetta oli hänelle läheistä. Toinen oli antikommunismi: hän oli varhainen ja kiihkeä bolshevismin vastustaja. Vuosien ajan hän leimasi nämä "saamarin paviaaneiksi" ja "likaisiksi Moskovan murhaajiksi." Hän ihaili ja arvosti Benito Mussolinia ja hänen saavutuksia (tai niin hän ajatteli). Hänen mielestä äärinationalismi ja sen sosiaalisen näkökulma purisi leninismiä vastaan. Churchill ylisti "fasismin voittoisaa taistelua leninismin eläimellisiä himoja vastaan" väittäen, että "se osoittautui tarpeelliseksi vastalääkkeeksi kommunismin myrkkyyn."

Kuitenkin tuli aika, jolloin Churchill teki rauhan kommunismin kanssa. Vuonna 1941 hän antoi varauksettoman tukensa Stalinille ja toivotti hänet liittolaisekseen syleillen häntä ystävänä. Churchillin sekä Rooseveltin käyttämä hellittelevä lempinimi Stalinista oli "Joe-setä". Vielä niinkin myöhään kuin Potsdamin konferenssissa hän toistuvasti oli maininnut Stalista: "Pidän siitä miehestä." Kun kiistattomat tiedot Neuvostoliiton teloittamista puolalaisista Katynissä paljastuivat kommentoi Churchill:

"Ei kannata parveilla kolmen vuoden takaisten hautojen ympärillä Smolenskissa."

Ollessaan kukistamassa Hitleriä vaikutti Churchill täysin tietämättömältä siitä vaarasta mikä Eurooppaa uhkasi kunnes oli jo liian myöhäistä. Huipentuma ihastuksessa tuli marraskuussa 1943 Teheranin konferenssissa, jolloin Churchill esitti Stalinille Ristiritareiden Miekan korkeaa arvomerkkiä. Ne jotka haluavat määritellä mitä sana "törkeys" tarkoittaa voisivat miettiä tätä episodia.

Näyttää siltä että vain hänen rakkautensa brittiläistä imperiumia kohtaan oli pysyvää. Jos Churchill ylipäätänsä seison minkään asian puolesta se oli ”Imperiumi”; hänen kuuluisa toteamuksena ettei tullut pääministeriksi johtaakseen valtakuntansa vararikkoon. Mutta juuri sen hän teki vain siksi että voisi tuhota Hitlerin.

Opportunismin lisäksi myös retoriikka oli hänen tuntomerkkinsä. Tämä lahjakkuus auttoi häntä hallitsemaan ihmisiä mutta se osoittautui myös kohtalokkaaksi. Monet jotka tunsivat Churchillin havaitsivat hänessä erikoisen piirteen. Vuonna 1917 Lordi Esher kuvaili asiaa näin:

”Hän käsittelee suuria aiheita rytmikkäällä kielellä ja joutuu nopeasti omien lauseittensa orjaksi. Hän pettää itseään muka ottamalla laajoja näkemyksiä mukaan kun hänen mielensä on kiinnittynyt kuitenkin vain suhteellisen pieniin osa-alueisiin”

Robert Menzies, toisen maailmansodan aikainen Australian pääministeri mainitsi Churchillistä:

"Hänen todellinen tyranniansa on tuo kimalteleva lause, niin houkutteleva, että hänen mielessään on hankalien tosiasioiden väistyttävä."

Eräs toinen kollega kirjoitti:

"Hän on ... niiden sanojen orja, joita hänen mielensä muodostaa ajatuksista .... Ja hän voi vakuuttua lähes jokaisesta totuudesta, jos se kerran on aloittanut villin matkansa hänen retorisesta koneestaan . "

Vaikka Winstonilla ei ollut ylipäätänsä periaatteita oli hänellä kuitenkin yksi joka pysyi aina: rakkaus sotaan. Se alkoi aikaisin. Lapsena hänellä oli valtava 1500 kappaleen kokoelma tinasotilaita joilla hän leikki monta vuotta kun useimmat pojat siirtyivät jo muihin asioihin. Ne olivat "kaikki brittejä", hän kertoi, ja hän taisteli näissä taisteluissa veljensä Jackin kanssa, jolla "sai olla vain värillisiä armeijoita ja joilla ei saanut olla tykistöä." Hän ei liittynyt yliopiston vaan Sandhurstin Kadettikouluun ja sinnekin hän pääsi ”rimaa hipoen”. "Siitä hetkestä kun Churchill lähti Sandhurstista ... hän teki kaikkensa päästäkseen taisteluihin, missä ikinä sota oli käynnissä." Kaikkien todisteiden mukaan ainoa asia mistä hän todella oli innoissaan oli sota. Muutamien harvojen kanssa hän rakasti sotaa, ”jopa pamahduksia", kuten hän niitä kutsui ja hän oli hyvin rohkea tulitaistelussa.

Vuonna 1925 Churchill kirjoitti:

"ihmiskunnan kertomus on sota."

Katastrofaalisella tavalla tämä ei tietenkään pidä paikkaansa. Sosiaalisen filosofian ja klassisen liberalismin peruskäsitteet olivat häneltä täysin hukassa. Erityisesti hän koskaan ymmärtänyt, kuten Ludwig von Mises selitti, että ihmiskunnan todellinen historia on kertomus kasvavasta sosiaalisesta yhteistyöstä ja työnjaosta. Rauha, ei sota, on kaiken isä. Sankarillemme rauhan vuodet olivat kuin "mitäänsanomaton rauhan ja latteuden taivas." Tämä oli mies, kuten tulemme näkemään, joka halusi enemmän sotia kuin oikeassa elämässä oli.

Kun hänet oli lähetetty Intiaan alkoi hän lukea innokkaasti ja viehättyi darwinismiin. Hän menetti kaiken mitä hänellä oli uskonnollisuuden rippeistä jäljellä. Hänestä tuli, hänen omien sanojensa mukaan, "materialisti" ja hartaasti hän vahvisti maailmankuvaansa, että ihmisen elämä on olemassaolon taistelua tavoitteena eloonjäänti. Tämän elämänkatsomuksen ja historian Churchill ilmaisi Savrola-romaanissaan. Oli täysin selvää että Churchill oli rasisti, mutta hänen rasisminsa oli syvempää kuin useimpien aikalaisten. On outoa, miten hänen kolkko darwinilainen näkemys, sodan keskeinen sija ihmiskunnan historiassa, ja hänen rasisminsa, samoin kuin hänen pakkomielteensä "suuriin johtajiin" muistutti hänen vihamiehensä Hitlerin olemusta.

Jos Churchill ei ollut mukana sodassa, hän raportoi siitä. Hän loi aluksi mainetta sotakirjeenvaihtajana Kitchenerin operaatioissa Sudanissa sekä buurisodassa. Joulukuussa 1900 järjestettiin nuoren toimittajan kunniaksi - julkisuutta saaneista seikkailukirjoitusten ansioista - jopa illalliset Waldorf-Astoriassa. Mark Twain tutustui häneen. Lyhyessä satiirisessa puheessa Twain ovelasti ehdotti, että Churchill englantilaisen isänsä ja amerikkalaisen äitinsä puolesta olisi täydellinen angloamerikkalaisuuden edustaja.

 

"Uusi Liberalismi" – Winston sosialisoimassa Britanniaa

 

Hänen taustansa kuuluisan herttuan ja poliitikon poikana vei hänet parlamenttiin ja Konservatiiveihin. Hänen levoton kunnianhimonsa oli aluksi ainoa jolla hän erottautui muista. Mutta vuonna 1904 hän loikkasi liberaaleihin koska väitti ettei hyväksynyt konservatiivien ehdotusta suojatulleista. Kuitenkin Robert Rhodes James, yksi Churchilli ihailijoita paljasti:

”Arvoitiin [tuolloin], luultavasti oikein, että jos Arthur Balfour olisi vuonna 1902 antanut hänelle ministerin tehtävät ei Churchillissä olisi kehittynyt tällaista palavaa innostusta vapaakauppaan eikä liberalismiin.”

Clive Ponting toteaa:

”Koska hän oli jo hyväksytty Roseberyyn hän etsi tekosyytä loikata puolueesta joka näytti olevan haluton tunnistamaan hänen lahjojaan ja koska liberaalit eivät hyväksyneet protektionisteja puolueeseensa.”

Muoti-ilmiön aallossa, ilman periaatteita ja vallanjanoisena tuli Churchillistä pian ”uuden liberalismin” kannattaja joka oli hänen isänsä päivitetty versio ”Tory demokratiasta. ”

Konservatiivisten arvojen innokkaat kannattajat näyttävät unohtaneen että Churchill oli heidän karsastaman hyvinvointivaltion yksi pääarkkitehdeista Britanniassa. Modernin hyvinvointivaltion kehitys alkoi 1880-luvulla Bismarckin Saksassa. Englannissa käännekohtana oli Asquithin tulo pääministeriksi.

Vuoden 1906 vaaleissa Churchill voitti edustajanpaikan Manchesterissa. Hän palveli Henry Campbell-Bannermanin liberaalihallituksessa siirtokuntien alivaltiosihteerinä. Churchillistä tuli pian hallituksen ulkopuolisen hallinnon tärkein jäsen, ja kun Herbert Henry Asquithista tuli Campbell-Bannermanin seuraaja vuonna 1908, juuri kukaan ei yllättynyt Churchillin pääsystä hallitukseen kauppakomission puheenjohtajana.

Churchill "oli jo julistanut kääntymyksensä kollektiiviseen sosiaalipolitiikkaan" ennen siirtymistään kauppakomission puheenjohtajaksi. Hän hyppäsi mukaan muodikkaaseen sosiaali-engineering- termejä täynnä olevaan aikakauteen väittäen, että "kansa vaatii jyrkkiä korjaavia ja parantavia prosesseja." Valtion oli hankittava kanavia ja rautateitä, kehitettävä tiettyjä kansallisia teollisuudenaloja, 8 tunnin työpäiviä, progressiivisia veroja sekä taattava kansallinen vähimmäiselintaso. Winstonista oli tullut ”jonkin sortin sosialisti”.

Valtiojohtoinen kehitys sai Churchillin täydellisen hyväksynnän koska hän mainitsi:

”Menen kauemmas, haluaisin nähdä valtion aloittavan erilaisia uusia erilaisia kokeiluja. . . . Olen hyvin pahoillani, rautatiet eivät ole meidän [valtion] käsissämme. Voisimme [valtio] tehdä paremmin jotain kanavia.”

Churchillista tuli täydellinen huijarimainen poliittinen yrittäjä, innokas yhden jos toisen sosiaalisen elämänalan politisoija. Hän haukkui konservatiiveja puuttumisesta jopa "yhteiskunnalliseen suunnitelmiin, uudistuksiin tai jälleenrakentamiseen", kun taas kehui, että hän ja hänen liittolaisensa aikovat ehdottaa "leveää, kattavaa, toisistaan riippuvaisia sosiaalisen toiminnan järjestelmiä" johon sisällytetään "massiivisia lainsäädäntöehdotuksia ja hallinnollisia määräyksiä."

Churchillista tuli ammattiliittojen kannattaja ja tukija. On ironista että sen ammattiliittojen mahtavan ylivallan Britanniassa, jonka Margaret Thatcher purki oli suurelta osin ollut rakentamassa kaikkien ”kunnon konservatiivien” suuri idoli – Winston Churchill.

 

Ensimmäinen maailmansota

 

Vuonna 1911 Churchill tuli laivastoministeriksi ( Lord of Admiralty) ja nyt hän oli todella omassa elementissään. Luonnollisesti hän nopeasti liittoutui sotapuolueen kanssa kriisin liekkien alkaessa loimuta. Hänestä tuli heti sodan innokas kannattaja. Kun lopullinen kriisi puhkesi kesällä 1914 oli Churchill kabinetin ainoa jäsen joka tuki sotaa alusta alkaen. Asquith, hänen oma pääministerinsä, kirjoitti hänestä:

"Winston hyvin sotaisana ja vaatii välitöntä mobilisaatiota .... Winston kaikkine sotamaalauksineen kaipaa meritaisteluja aamun varhaisina tunteina ja Goeben-aluksen upottamista. Koko asia tekee minut surulliseksi. "

Sodan aattona 28. heinäkuuta 1914, kolme päivää ennen Saksan hyökkäystä Belgian, Churchill mobilisoi Britannian laivaston, maailman historian siihen mennessä suurimman. Ei ihme, että kun sota Saksan kanssa puhkesi, Churchill, toisin kuin jopa muut sotaa kannattavat brittipoliitikot, oli yhtä hymyä, ”rinta kaarella”.

Vihollisuuksien alettua oli Churchill innokkaasti ajamassa Saksan nälkäsaartoa. Tämä oli luultavasti tehokkain joukkotuhoase mitä millään sodan osapuolella oli. Ainoa ongelma oli, että kaikkien sodan osapuolten mielestäni, Britanniaa lukuunottamatta, se oli laitonta. Winstonille tällaiset asiat eivät koskaan herättäneet mitään tunnontuskia. Hän oli valmis rikkomaan sääntöjä aina silloin kun katsoi maansa olevan vaarassa ja hänen mielestään näin oli lähes aina.

Nälkäsaarrolla oli tiettyjä varsin epämiellyttäviä seurauksia. Noin 750000 saksalaisia siviilejä menehtyi sen seurauksena nälkään ja sairauksiin aliravitsemuksen takia. Vaikutus niihin jotka selvisivät hengissä oli ehkä aivan yhtä pelottava omalla tavallaan. Eräs historioitsija on todennnut kuinka "maailmansodan uhriksi joutuneesta nuorisosta tuli radikaalein kansallissosialismia kannattanut ryhmä." Saarto ja sen murtaminen antoi myöhemmin tekosyyn Wilsonille viedä USA sotaan vuonna 1917.

Oliko Churchill tosiasiallisesti järjestänyt Lusitanian upottamisen 7. toukokuuta 1915 vai ei on vielä epävarmaa. Viikkoa ennen katastrofia, hän kirjoitti Walter Runcimanille, kauppaministeriön puheenjohtajalle, että "tärkeintä oli houkutella puolueettomien maiden merenkulku meidän rannoille, toiveena erityisesti sotkea Yhdysvallat sotaan Saksan kanssa." Merkittävissä asemissa olevat henkilöt Britanniassa ja Amerikassa uskoivat että Saksan upottama Lusitania sotkisi Yhdysvaltojen sotaan.

Patrick Beeslyn tutkimus - "Room 40"- selvitti brittilaivaston tiedustelupalvelun toimintaa ensimmäisessä maailmansodassa. Beeslyn tutkimuksen tulokset sotivat jopa hänen omia ennakkokäsityksiä vastaan. Beesly toteaa:

”ellei uutta tietoa tulee päivänvaloon, olen vastahakoisesti päättelemässä, että oli olemassa salaliitto tietoisesti asettaa Lusitania vaaraan siinä toivossa, että jopa epäonnistunut hyökkäys veisi Yhdysvaltojen sotaan [Saksaa vastaan]. Tällainen salaliitto ei olisi voitu toteutua ilman Winston Churchillin lupaa ja hyväksyntää.”

Joka tapauksessa on varmaa, että Churchillin politiikka teki USA:n ja Saksan konfliktin todennäköiseksi. Lusitania oli matkustajalaiva joka oli täynnä sotatarvikkeita. Churchill oli antanut määräyksiä kauppa-alusten kapteeneillä hyökätä saksalaisten sukellusveneiden kimppuun jos ne kohtaavat saksalaiset ja saksalaiset olivat tietoisia tästä. Ja kuten Churchill korosti muistelmissaan oli puolueettomien maiden sotkemisen konfliktiin Saksan kanssa keskeinen osa sodankäyntiä maailmansodassa:

"On olemassa monenlaisia toimia sodassa, jotkut vain tapahtuu taistelukentällä ... . manööveri joka tuo liittolaisen taistelukentälle on yhtä käyttökelpoinen kuin sotaoperaatio joka tuo voiton suuressa taistelussa. "

Keskellä verisiä taisteluja Churchill oli energinen henkilö jonka aivoista lähti idea toisensa jälkeen. Joskus hänen oletuksensa toimi hienosti, joskus ei niin hyvin. Gallipolin tunnettu fiasko synkensi hänen nimensä vuosiksi ja siirsi hänet väliaikaisesti pois hallituksesta. Hänen reaktionsa oli tyypillinen. Vieraalleen hän sanoi osoittaen karttoja seinällä:

"Tämä on minun elämääni ... Kyllä, olen valmis kaikkeen tuottaakseni tappion sodassa saksalaisille. "

 

Sotien väliset vuodet

 

Muutaman seuraavan vuoden aikana Churchill oli eri ministerinä hallituksissa. Sotaministerinä hän oli kuitenkin siinä tehtävässä mihin hänen luonteenpiirteensä viittasi. Churchill ajoi ristiretkeä murskatakseen bolshevismin Venäjällä. Samoin siirtomaaministerinä hän oli valmis viemään Britannian sotaan Turkkia kanssa Chanakin tapauksen takia mutta Britannian lähettiläs Turkissa ei antanut Churchillin uhkavaatimusta ja lopulta ”viileämmät päättäjät” konfliktissa pääsivät voitolle ja yksi uusi turha sota vältettiin. Hän raivosi kun paikallisissa konflikteissa afgaaneja vastaan ei hyväksytty hänen ehdotuksiaan käyttää pommikoneita ja myrkkykaasuja ”uppiniskaisia arabeja vastaan”. Hän vastusti kiivaasti siirtokunnista tärkeimmän, Intian hallinnon autonomiavaatimuksia.

Vuonna 1924 Churchill loikkasi takaisin konservatiiveihin ja hänestä tehtiin valtiovarainministeri. Hänen isänsä samassa toimistossa oli aikoinaan todennut desimaaleista: ”mitä pirun pisteitä nuo ovat?” Churchillin kuuluisin teko oli palauttaa Britannia takaisin kultakantaan täysin epärealistisella sotaa edeltäneellä vaihtokurssilla ja hän toimillaan oli hyvin vakavasti vahingoittamassa Britannian vientikauppaa koko 1920-luvun ja hän turmeli kultakannan maineen, kuten Murray N. Rothbard huomautti. Tuskin kukaan on ollut eri mieltä AJP Taylorin Churchillille antamasta tuomiosta sillä hänen mielestään valtiovarainministeri

"ei ymmärrä taloudellisista perusteista mitään. Mikä merkitsee hänelle oli jälleen omistautuminen brittiläiselle suuruudelle jossa Englannin punta voi jälleen " katsoa dollaria kasvotusten " ja kuningatar Victorian päivät olisi palautettu. "

Tunnettu taloustieteilijä John Maynard Keynes kirjoitti hyvin sarkastisen näkemyksen (1925) Churchillistä ja kysyi: ”Miksi Churchill saattoi mennä tekemään jotain noin typerää?” Churchillin talouspoliittinen tietämättömyys sekä valuutan vaihtokurssin palauttaminen vanhalle sotaa edeltäneelle tasolle osoitti että hän ei käsittänyt imperiumin taloudellisen pohjan heikentymistä. Hän eli illuusiossa jonka mukaan sodan vuoksi mitään ei olisi muuttunut.

Toistaiseksi Churchill oli mukana politiikassa yli 30 vuotta mutta hän ei ollut saavuttanut mitään sellaista jolla hän olisi osoittanut suuruutensa. Kuuluisa on moderni mytologia joka väittää hänen ajaneen kovaa linjaa Hitleriä vastaan 1930-luvulla. Mutta on tärkeää ymmärtää, että Churchill oli ajanut kovaa linjan myös nöyryytettyä Weimar Saksaa vastaan. Hän tuomitsi kaikki liittoutuneiden aseistariisumissuunnitelmat jo ennen kuin Hitler tuli valtaan. Muiden kaltaistensa tavoin hän ajoi fantasiaa jonka mukaan Saksan pitäisi raahata Versaillesin kahleita maailman tappiin asti. Kävikin sitten niin että mitä Britannia ja Ranska kieltäytyivät myöntämästä demokraattiselle Saksalle joutuivat ne myöntämään myöhemmin Hitlerille. Jos useimmat eivät halunneet kuunnella Churchilliä oli heillä siihen perustellut syynsä. Hän oli yrittänyt lietsoa hysteriaa liian usein ennenkin: ristiretken puolesta bolshevikkeja vastaan, vuoden 1926 yleislakon aikana, Intian itsenäistymisen kuolettavista vaaroista, kruunusta luopumisen kriisin vaaroista. Miksi maksaa vaivaa huomioimalla hänen uusimpia harhojaan?

Churchill loi jo uransa alkuvuosina voimakkaat kontaktit sionistiseen painostusjärjestöön nimeltään Focus. Churchill näki tässä liikkeessä mahdollisuuden tehdä Palestiinan juutalaisista eräänlainen läntinen tukikohta Lähi-Itään. Järjestö jolla oli huomattavia taloudellisia tukijoita kuten Sir Robert Mond (useiden kemiallisten yritysten johtaja) ja Sir Robert Waley-Cohn (Shellin toimitusjohtaja), tukivat Churchilliä taloudellisesti ja poliittisesti. Samalla hän loi tämän ryhmän kautta uusia kontakteja.

Vaikka olikin konservatiivinen kansanedustaja, alkoi Churchill ruoskia konservatiivisia hallituksia. Ensin Baldwinin ja sitten Chamberlainin väitetystä sokeudesta natsien muodostamaan uhkaan. Hän itse liioitteli huomattavasti Saksan asevarustelun laajuutta ja vääristeli Saksan pommikonetuotannon määriä. Churchillin valheiden tarkoitus oli osoittaa saksalaisen suunnittelevan hyökkäystä Britanniaan, joka ei itse asiassa koskaan ollut Hitlerin aikomus (Saksan ilmavoimien strategia oli tukea maavoimien operaatioita). Siihen aikaan Churchill pyrki edistämään ahkerasti suuren liittokunnan muodostumista. Se olisi käsittänyt Britannian, Ranskan, Neuvosto-Venäjän, Puolan ja Tšekkoslovakian. Koska Puola, jonka puna-armeija melkein valtasi vuonna 1920, hylkäsi kaiken liittoutumisen Neuvostoliiton kanssa ja koska Stalinille ainoa käytävä Saksaan oli Puolan kautta, Churchillin suunnitelma oli täysin arvoton.

Ironisesti tällä ennakoivalla rummutuksella Saksaan vaarasta olisikin ollut jotain katetta väitteelle hänen kaukonäköisyydestään mutta Churchillin piti pilata tämäkin ansio. Syksyllä 1937 hän nimittäin esitti:

”Kolme tai neljä vuotta sitten olin itsekin kovin levoton. . . . Huolimatta riskit jotka odottavat toteutumistaan, uskon että suurimittainen sota ei ole välittömästi uhkaamassa ja olen edelleen sitä mieltä, että on olemassa hyvät mahdollisuudet ettei suursotaa käydä meidän elinaikanamme. . . . En aio teeskennellä, että jos minun piti valita kommunismin ja natsismin, valitsisin kommunismin.”

Huolimatta kaikesta hölynpölystä Churchillin ns. "kaukonäköisyydestä", liennytyspolitiikan vastustamisesta 30-luvun aikana, on ilmeistä että Chamberlain hallituksen linja - nopea varustautuminen sekä samanaikainen valmius testata diplomaattiset mahdollisuudet rauhaan Saksan kanssa – oli selvästi realistisempi kuin Churchillin kaavailut. Yleinen mytologia on niin kaukana historiallisesta totuudesta, että jopa kiihkeä Churchillin myötäilijä Gordon Craig tuntee velvollisuudekseen kirjoittaa:

”On kohtuullisen tunnettu asia tänään että Churchill oli usein tietämätön ja hänen väitteensä saksalaisten vahvuuksista liioiteltuja ja hänen vaihtoehtonsa niin epäkäytännöllisiä, että hänen painotuksensa ilmavoimista oli aiheeton.”

Kuten muuan brittiläinen historioitsija on myöhemmin todennut:

"On syytä muistaa, että 1930-luvulla Churchill ei vastustanut Italian ja Japanin lepyttelypolitiikkaa."

On myös syytä muistaa, että Churchilliä edeltäneet hallitukset loivat ne mahdollisuudet että Churchill saattoi voittaa ”Battle of Britainin”. Clive Ponting on havainnut kuinka

”Baldwinin ja Chamberlain hallitukset. . . olivat mahdollistaneet sen että Britannia oli ensimmäinen maa maailmassa joka otti käyttöön täysin integroidun ilmapuolustusjärjestelmän perustuen tutkaohjaukseen, jolla suunnattiin torjuntahävittäjät viholliskoneita vastaan. . . Churchillin panos oli ollut vuodattaa halveksuntansa tutkahankintaa vastaan hänen ollessa oppositiossa 1930-luvulla.”


( Päivitetty: 02.04.2013 20:02 )

 - pelontorjunta | Kommentoi



 Churchill - The Man of Blood (osa 2)
07.03.2013 15:24 | pelontorjunta

 

USA:n sotkeminen jälleen sotaan

 

Syyskuussa 1939 Britannia meni sotaan Saksaa vastaan Chamberlainin hallituksen Puolalle annetun paniikissa tehdyn takauksen takia. Lloyd George oli nimittänyt takuita "älyttömiksi". Churchill oli puolestaan tukenut takuita. Sodan myötä Winston palasi takaisin vanhaan työpaikkaansa laivastoministeriksi. Sitten heti ensimmäisen kuukauden aikana tapahtui jotain aivan hämmästyttävää: Yhdysvaltain presidentti Franklin Delano Roosevelt aloitti henkilökohtaisen kirjeenvaihdon - ei suinkaan pääministerin - vaan laivastoministeri Churchillin kanssa ohittaen kaikki tavalliset diplomaattiset kanavat. Tämän epäilyttävän tapahtuman taustoja ei ole koskaan saatu selville koska osa kaikkein arkaluonteisimmista viime sotiin liittyvistä asiakirjoista on yhä niin Britanniassa kuin USA:ssakin julkaisematta.

Alkoi vimmattu lähes parin tuhannen keskinäisen viestin lähettäminen. Tyler Kent, amerikkalainen salakieliin erikoistunut virkailija Yhdysvaltain Lontoon suurlähetystössä toimi viestilähettinä tässä kommunikoinnissa mutta hän joutui pian brittiviranomaisten pidättämäksi ja vangitsemaksi. Ongelmana oli, että osa viesteistä sisälsi viittauksia Rooseveltin sopimuksista neutraalin maan (USA) ja sotaa käyvän maan (Britannia) välillä jo ennen kuin sota oli ehtinyt Euroopassa edes puhjeta.

Vuonna 1940 Churchillistä vihdoin tuli pääministeri, ironista kyllä Chamberlainin hallituksen erottua Norjan fiaskon takia, jota Churchill enemmän kuin kukaan muu oli edesauttanut. Puolan kaaduttua oli hän vastustanut kaikkia neuvotteluratkaisuja Hitlerin kanssa. Monet asiaan liittyvät asiakirjat ovat vielä sinetöity kaikkien näiden vuosien jälkeen, mutta on selvää että vahva rauhan osapuoli oli ollut Britanniassa ja myös maan hallituksessa. Siihen kuului mm. Lloyd George alahuoneessa ja lordi Halifax, ulkoministeri, hallituksessa. Ranskan romahduksen jälkeenkin Churchill hylkäsi Hitlerin uudistetun rauhan tarjouksen. Tämän jos minkä pitäisi olla hänen suuruutensa peruspilari.

Brittiläinen historioitsija John Charmley nostatti aikoinaan raivoisan protestien myrskyn kun hän arvioi, että vuonna 1940 neuvoteltu rauha olisi ollut eduksi sekä Britannialle että Euroopalle. New York Timesiin kirjoittanut Yalen yliopiston historioitsija tuomitsi Charmleyn väitöskirjan "moraalisesti kuvottavaksi." Silti Charmleyn tieteellisistä ja yksityiskohtia myöten perusteellisessa työssä paljastuu että Churchillin järkkymätön kieltäytyminen edes kuuntelemasta rauhanehtoja vuonna 1940 sinetöi sen minkä piti olla Churchillille kaikkein rakkainta - imperiumin ja porvarillisen riippumattoman Britannian tappion. On myös todennäkköistä että tämä linja myös sinetöi Euroopan juutalaisuuden tuhon. On hämmästyttävää, että vielä yli puolen vuosisadan jälkeen asiasta tehty kriittinen tieteellinen tutkimus aiheuttaa näin raivokkaan primitiivireaktion tutkijoiden keskuudessa.

Lloyd George, Halifax, ja toiset olivat avoimia kompromissirauhaan koska he ymmärsivät että Britannia ja dominiot eivät voineet yksin voittaa Saksaa. Ranskan kukistumisen jälkeen Churchillin tavoite täydellisestä voitosta voitaisiin toteuttaa vain yhdellä ehdolla: Yhdysvallat on saatava sotkettua maailmansotaan. Ei ihme, että Churchill laittoi kaiken peliin tämän toteutumiseksi.

Joseph Kennedy, Yhdysvaltain suurlähettiläs Britanniassa, totesi myöhemmin:

"Joka tunti olivat britit yrittäneet selvittää kuinka saisivat meidän tulemaan mukaan sotaan."

Kun hän Kennedy lähti Lissabonin laivalla New Yorkiin, hän vetosi ulkoministeriöön ilmoittaen, että jos aluksessa tapahtuu räjähdys keskellä Atlanttia ei Yhdysvaltojen pidä syyttää siitä Saksaa. Julkaisemattomissa muistelmissaan Kennedy kirjoitti:

"Ajattelin, että saisin jonkinlaisen suojan siltä varalta että Churchill järjestäisi pommin laivaan."

Kennedyn pelot ovat ehkä liioiteltuja. Vaikka tämä toiminta oli ollut tärkeä osa Churchillin politiikkaa edellisessä maailmansodassa, ja hän ei epäröinyt käyttää likaisia temppuja uudessakaan sodassa, löysi hän Franklin Rooseveltissä tarpeeksi valmiin yhteistyökumppanin.

Nykyisin tiedetään jo hyvin että Rooseveltin keino tunkea USA sotaan sisälsi niin paljon Churchillin harjoittamia keinoja, manipulointia, pelonlietsontaa, propagandaa sekä yleisön ja politiikkojen harhauttamista ettei asia ole ollut enää vuosiin kiistanaihe tutkijoiden keskuudessa.

Bailey, diplomatian historioitsija Stanfordista valotti Rooseveltia sodan alkuvaiheesta:

”Franklin Roosevelt oli toistuvasti pettänyt amerikkalaisia ennen Pearl Harboria. . . . Hän oli kuin lääkäri, jonka on kerrottava potilaalle valheita potilaan omaksi parhaaksi. . . . Maa oli valtaosaltaan haluton sotaan aivan Pearl Harborin päivään saakka ja avoin yritys viedä kansakunta sotaan olisi johtanut varmaan epäonnistumiseen ja lähes varmasti Rooseveltin syrjäyttämiseen vuonna 1940 ja näin aiheuttanut täydellisen tappion hänen tavoitteelleen..”

Churchill itse ei koskaan vaivautunut peittämään Rooseveltin roolia juonittelussa. Vuonna 1976 paljastettiin vihdoinkin julkisuudessa tapaus William Stephenson, brittiläinen agentti koodinimeltään "Intrepid" sekä laaja brittiläis-amerikkalainen vakoilu, manipulointi, propaganda ja vaikuttajia täynnä oleva verkosto, jonka pääasiallinen tehtävä oli muokata yleistä mielipidettä USA:ssa sodalle myönteiseksi.

Kaikista provosointitoimista huolimatta Churchill sen paremmin kuin Rooseveltkaan eivät kyenneet saamaan Hitlerin Saksaa ja Rooseveltin USA:n välille sotaa, sillä Hitler ei halunnut missään tapauksessa kärjistää tilannetta USA:n kanssa. Niinpä Roosevelt alkoi yhä enemmän hakea ratkaisua pääsylle sotaan Japanin kautta. Hän sai japanilaiset lopulta hyökkäämään Pearl Harboriin käyttämällä keinona erittäin tehokasta kauppasaartoa ja mm. jäädyttämällä Japanin varat USA:ssa. Sitä ennen Japani oli yrittänyt kaikin keinon saada USA:n ja Japanin välille neuvotteluratkaisua, Roosevelt taas pyrki nimenomaan sotaan.

Churchill uskoi kongressin antavan Rooseveltille luvan julistaa sota Saksalle. USA:n tulo sotaan vahvisti vanhan sanonnan: "Kaikki on reilua sodassa ja rakkaudessa."

Ei ihme, että Englannin parlamentissa 15. helmikuuta 1942 Churchill julisti Amerikan liityttyä sotaan:

"Tämä on se mitä olen haaveillut, johon työlläni olen pyrkinyt, ja nyt se on käynyt toteen."

Churchillin ihailijat eivät suinkaan ole kritisoineet hänen rooliansa Amerikasta vetämisessä mukaan sotaan. Päinvastoin, se lasketaan hänen saavutuksekseen. Kysymys koskee oikeastaan enemmän amerikkalaisia. Mitä merkitsee että heidän presidenttinsä teki yhteistyötä ulkomaisen hallituksen päämiehen kanssa sotkeakseen oma maa mukaan sotaan? Kysymys oli taas Churchillille täysin yhdentekevä. Hän ei edes nähnyt Yhdysvaltojen täysivaltaisena ja itsenäisenä kansakuntana, jolla on oma luonne ja paikka maailmassa. Hänelle, amerikkalaiset olivat vain yksi "englantia puhuva kansa." Hän – englantilaisen aatelismiehen ja amerikkalaisesta rikkaasta suvusta peräisin olleen äidin poika - näki mielellään amerikkalaiset ja britit yhtenä kansakuntana jonka tehtävänä olisi jatkossakin suvereenisti hallita maailmaa.

 

Churchillin suuri epäonnistuminen

 

Mutta Churchillin käymässä sodassa on jotain perin pahasti pielessä. Sodan alkuvaiheessa Churchill julisti:

"Minulla on vain yksi päämäärä elämässä, tappio Hitlerille ja tämä tekee asiat hyvin yksinkertaiseksi minulle."

Kirjaimellisesti siis "voitto, voitto hinnalla millä hyvänsä" oli hänen politiikkansa käytännössä loppuun saakka. Tästä muodostui Churchillin perusteellinen ja kohtalokas virhe maailmansodassa: sotilaallisen toiminnan ja poliittisen strategian erottaminen toisistaan.

Kuten nyt tiedämme, Churchill rakasti ja nautti sodasta. Ja hän kävi sotaa ajattelematta yhtään sitä vanhaa Clausewitzin viisautta jonka mukaan ”sota on politiikan jatketta toisin keinoin.” Kaikista viime sodan suurvaltojen johtajista juuri Churchill kaikkein vähiten mietti ennen taistelujen päättymistä ja vihollisen tuhoutumista mitkä tulisivat olemaan sodan seuraukset. Stalin taas ymmärsi täysin, että koko sodan tarkoitus on pyrkiä tiettyihin tavoitteisiin ja valvoa tiettyjä poliittisia vaatimuksia. Koko sodan hän ei koskaan unohtanut näitä tärkeitä poliittisia tavoitteita. Mutta Churchillille kaikki oli Hitlerin lyöminen sodassa miettimättä yhtään sen paremmin Britannian kuin Euroopan tulevaisuutta.

Tuvia Ben-Moshe on ovelasti tuonut esille tämän groteskin välinpitämättömyyden:

”Kolmekymmentä vuotta aikaisemmin, Churchill oli kertonut Asquithille että. . . hänen elämänsä tavoite oli "komentaa suuria voitokkaita armeijoita taisteluissa." Toisen maailmansodan aikana hän oli päättänyt ottaa täyden hyödyn minkä tilanne oli hänelle suonut, lähes esteettömän sotilaallisen hallinnan suuressa konfliktissa. Hän oli altis jättämään tai lykkäämään asioiden käsittelyä todennäköisesti sen vähäisen ilon takia. . . . Näin tehdessään hän hyllytti tai laiminlöi kokonaan niiden asioiden hoidon joihin hänellä olisi ollut pääministerin virkansa puolesta suuret mahdollisuudet.”

Churchillin politiikka tuki totaalisesti Stalinia ja samalla sulki muita mahdollisesti edullisempia lähestymistapoja. Sotilasasiantuntija Hanson Baldwin on esimerkiksi todennut:

”Ei ole epäilystäkään, etteikö se olisi ollut niin Britannian, USA:n kuin koko maailman etu jos kaksi suurta diktatuuria olisi pantu taistelemaan keskenään. Tällainen taistelu, jonka tuloksena olisi ollut sekä kommunismin ja natsismin heikkeneminen, olisi antanut mahdollisuudet huomattavasti vakaammalle rauhalle.”

Tämän järkevämmän vaihtoehdon sijasta Churchill heitti kaiken apunsa Stalinin Neuvostoliitolle.

Franklin Rooseveltin typerä ja naivi suhtautuminen Joseph Staliniin on tunnettu asia. Hän näki Stalinin "edistyksellisenä" miehenä ja korvaamattomana työtoverina luomaan tulevaisuudessa ”uutta maailmanjärjestystä”. Mutta uuskonservatiivit ja monet muut, jotka vertaavat ja Rooseveltin naiiviutta tässä asiassa Churchillin ”vanhan maailman” oveluuteen ja viekkauteen ovat valitettavasti pahasti väärässä. Rooseveltin kuvottava Stalinin imartelu on helposti sovitettavissa myös Churchilliin. Aivan kuten Roosevelt, Churchill äitelällä kommunististimurhaajan imartelulla ja kehumisella haki innokkaasti Stalinin henkilökohtaista ystävyyttä. Lisäksi hänen Stalinin ihailu ei eronnut julkisesti ja yksityisesti toisistaan. Tammikuussa 1944 hän vielä puhui Anthony Eedenille "syvään juurtuneista muutokset, jotka ovat tapahtuneet Venäjän valtiossa ja hallituksessa sekä uudesta luottamuksesta joka on kasvanut meidän sydämissämme Stalinia kohtaan." Vaimolleen Clementinelle Churchill kirjoitti kirjeessä lokakuussa 1944 Moskovan konferenssin jälkeen:

"Minulla on ollut erittäin miellyttäviä keskusteluja vanhan Karhun kanssa. Pidän hänestä sitä enemmän mitä enemmän näen häntä. Nyt he kunnioittavat meitä ja olen varma he haluavat työskennellä kanssamme. "

Kirjailijat, kuten Isaiah Berlin, ovat yrittäneet antaa vaikutelman, että Churchill vihasi tai halveksi kaikkia diktaattoreita kuten Stalinia, ovat joko tietämättömiä tai epärehellisiä. Churchillin kannattajat väittävät usein, että toisin kuin amerikkalaiset, tämä älykäs ja tämä viekas brittiläinen valtiomies näki Neuvostoliiton vaaran ja toimi sinnikkäästi estääkseen sen. Churchillin kuuluisa "Välimeren strategia” hyökätä Eurooppaan sen "pehmeän vatsan" kautta väitetään olevan osoitus tästä. Mutta tämä oli Churchillin jälkikäteen laadittua puolustusta jonka hän kehitteli kylmän sodan vuoksi eikä siitä ole juuri mitään vakavasti otettavaa näyttöä. Koko Balkanin operaation sotilaallinen onnistumismahdollisuus oli lähes olematon eikä se koskaan ollut vakavasti harkinnassa. Operaationa se olisi ollut yhtä toteuttamiskelvoton kuin Winstonin idea iskeä Eurooppa-linnoitukseen Suomen talvisodan aikana pohjoisesta käsin, tai hyökätä Pohjois-Ranskan kautta vuonna 1945, johon mennessä puna-armeija olisi voinut olla jo Reinillä.

 

Churchillin visio Saksan kohtelusta sodan jälkeen

 

Churchillin kaunis näkymä Stalinista ja Venäjästä poikkesi jyrkästi siitä miten hän näki Saksan. Hitlerin takana kummitteli Churchillin havainnoissa vanha haamu preussilaisuudesta, joka oli aiheuttanut, väitettiin, ei vain kaksi maailmansotaa, vaan myös Preussin ja Ranskan välisen sodan. Se mitä vastaan hän taisteli oli "natsien tyrannia ja Preussin militarismi", "kaksi keskeistä saksalaista elementtiä elämässä, jotka on ehdottomasti hävitettävä." Lokakuussa 1944 Churchill oli vielä selittänyt Stalinille:

"Ongelmana oli, miten estää Saksaa pääsemästä jaloilleen meidän lastenlastemme aikana."

Churchillin visio saksalaisuudesta syntyi yhdistelmästä lähes rotutietoisesta vastenmielisyydestä ja voimatasapainolaskelmista.

"Churchillin tarkoituksena ei ollut pelkästään pelastaa maailman sivilisaatiota natseilta, mutta hänen omien sanojensa mukaan "toistaiseksi ehkäisemällä niiden [saksalaisten] nousu jälleen sotilaalliseksi voimaksi."

Churchill kieltäytyi kaikin tavoin edes kuuntelemasta niitä Saksan sisällä olevia voimia jotka pyrkivät kukistamaan Hitlerin. Sen sijaan, että olisi pyrkinyt kaikin tavoin edistämään ja auttamaan natsienvastaisen vallankaappauksen onnistumista Saksassa, Churchill vastasi näihin tunnusteluihin Saksan puolelta kylmällä hiljaisuudella. Adam von Trottin ja muiden vastustajien lähettämät varoitukset lähestyvästä Euroopan bolshevisoinnista eivät tehneet minkäänlaista vaikutusta Churchilliin. Muuan historioitsija onkin kirjoittanut:

"hänen tinkimättömyytensä ja kieltäytymisensä hyväksymästä keskusteluja toisinajattelevien saksalaisten kanssa sulki edes mahdollisuuden lopettaa sota jo heinäkuussa 1944."

Jälkeenpäin Churchill valehteli alahuoneessa roolistaan Casablancan neuvotteluissa jossa oli ollut kyse Saksan ehdottomasta antautumisesta. Eisenhower vastusti sinnikkäästi ehdottoman antautumisen mallia sen vaikeuttaessa sotaa koska se nosti Wehrmachtin taistelumoraalia.

Churchillin tuki ns. Morgenthaun suunnitelmalle antoi saksalaisille pelottavan kuvan mitä "ehdoton antautuminen" tarkoittaisi. Tämä suunnitelma jota Roosevelt ja Churchill käsittelivät Quebecissa, olisi merkinnyt toteutuessaan Saksan muuttamiseksi maatalous- ja pastoraalimaaksi niin että hiilikaivokset ja Ruhrin teollinen talousalue olisi romutettu. Se olisi voinut johtaa miljoonien saksalaisten kuolemaan ja suunnitelmana se muistutti natsien alustavasti Venäjälle ja Ukrainaan kaavailemaa mallia. Tämä Churchillin hyväksynnän saanut mutta myöhemmin hylätty ja historiasta häivytetty visio oli omalta osaltaan vaikuttamassa Saksan propagandakoneiston säestyksellä siihen miten ankarasti ja katkerasti saksalaiset sotivat toivottomaan loppuun asti.

Churchill oli aluksi vastenmielinen Morgenthaunin suunnitelmalle. Mutta professori Lindemann, mielipuolinen saksalaisten vihaaja kuten Morgenthau itse, voitti Churchillin puolelleen. Lindemann totesi lordi Moranille, Churchillin henkilökohtaiselle lääkärille:

"Selitin Winstonille että tarkoituksena oli pelastaa Britannia konkurssilta poistamalla vaarallinen kilpailija .... Winston oli ajatellut sitä tällä tavalla, ja hän sanoi ettei enää halua lisää julmuuksia Saksan kansalle. "

Itseasiassa Morgenthaunin ohjelman sanamuodon laati kokonaan Churchill. Kun Roosevelt palasi Washingtoniin, Hull ja Stimson ilmaisivat kauhunsa. Toisaalta Churchill ei katunut. Sodan aikaa käsittelevässä historiassaan hän ei mainitse osuudestaan Morgenthaunin suunnitelmasta ja hän vääristää sen määräyksiä. Epäsuorasti hän valehteli oman roolinsa ja sen että hän tuki tätä kammottavaa ohjelmaa.

 

Saksan pommitukset

 

Churchillin keskeinen osa Saksan kaupunkien pommituksista on tunnettu asia. Hän valehti röyhkeästi alahuoneessa ja sekä suurelle yleisölle että pommitukset olisi suunnattu vain sotilaallisten ja teollisten laitosten tuhoamiseksi. Itse asiassa, tavoitteena oli tappaa ”alue- ja mattopommituksilla” niin monta siviiliä kuin mahdollista siten ja tällä tavalla murtaa saksalaisten taistelumoraali ja pakottaa Saksa polvilleen. Jo sodan aikana tehdyt analyysit olivat osoittaneet että pommitukset itse asiassa vain lujittivat saksalaisten vastarintaa ja niiden kyky heikentää Saksan sotatuotantoa ei ollut niin valtava kuin on yleensä luultu (sen suurin merkitys lienee ollut välillinen; se että Saksa joutui sitomaan paljon torjuntahävittäjiä ja eteenkin raskasta ilmatorjuntatykistöä miehistöineen, joten se helpotti liittoutuneiden painetta taistelurintamilla. Toisaalta pommikoneet olivat valtaosaltaan poissa tukemassa liittoutuneiden omia sotilasoperaatioita).

Marsalkka Bernard Harris, RAF:n strategisten pommitusten johtaja oli Churchillin mies tähän virkaan. Harris oli vakaumuksessaan ainakin rohkea eikä peitellyt näkemyksiään myöhemminkään:

”Tavoitteena oli yksiselitteisesti Saksan kaupunkien tuhoaminen, saksalaisten työntekijöiden tappaminen sekä sivistyneen elämän häiritseminen koko Saksassa.”

Pommituksista huolimatta Saksa saavutti sotatuotannon huipputasonsa vuoden 1944 lopulla. Tuhot olivat joka tapauksessa siviileille ja kauniille saksalaisille kaupungeille valtavat. Tuhat vuotta vanha kaupunkikulttuuri tuhottiin. Hampurin pommitusten aikaansaamissa tulimyrskyissä ihmiset paloivat kuin soihdut tai sulivat kiinni asfalttiin. Yli 42 000 ihmistä kuoli. Ei ihme, että sivistynyt ja oppinut eurooppalainen Harvardin yliopiston professori Joseph Schumpeter oli valmis kertomaan kenelle tahansa "kuka ikinä halusi kuunnella", että ”Churchill ja Roosevelt olivat tuhoamassa enemmän kuin Tsingis Khan”. Kuuluisin teko oli Dresdenin tuhoaminen helmikuussa 1945. Royal Air Forcen virallisen historian mukaan:

"Saksan tuhoaminen oli jo sitä ennen ollut kauhun mitta-asteikolla samaa luokkaa Attilan tai Tsingis Khanin aikaansaaman tuhon kanssa."

Tässä vaiheessa täysin tarpeeton tuho alkoi nostaa jo kritiikkiä. Mitä sankarimme teki? Hän lähetti muistion yleisesikuntaan (Chief of Staffs):

”Minusta tuntuu, että on tullut aika jolloin kysymys Saksan kaupunkien pommituksista vain terroritarkoituksessa, vaikka muiden tekosyiden varjolla, olisi tarkistettava. Muutoin joudumme ottamaan hallintaan täysin tuhoutuneen maan. . . . Dresdenin tuhoaminen nostaa esille vakavat kysymykset liittoutuneiden pommituksista . . . Tunnen tarvetta keskittyä tarkempiin sotilaallisiin tavoitteisiin. . . eikä pelkkiin terroriin ja mielivaltaisiin tuhoamisiin niin vaikuttavalta kuin ne kuulostaakin...”

Sotilasjohtajat näkivät tämän pelkkänä Churchillin halpana juonena ja ymmärsivät että heidät aiottiin panna järjestykseen joten he kieltäytyivät hyväksymästä muistiota. Sodan jälkeen Churchill rennosti irtisanoutui siitä että tiesi Dresdenin pommituksista väittäen:

"Minä luulin että amerikkalaiset tekivät sen."

Ja silti pommitukset jatkuivat. Maaliskuun 16.päivänä 20 minuutin aikana Würzburg revittiin maan tasalle. Vasta huhtikuun puolivälissä, Berliinin ja Potsdamin pommitusten jälkeen operaatiot lakkasivat. Bernard ”Pommittaja” Harris totesi ettei Saksassa enää ollut mitä pommittaa. On tuskin tarpeen muistuttaa että Churchill tuki atomipommien pudottamista Hiroshimaan ja Nagasakiin. Kun Truman rakensi myytin jonka mukaan "500 000 pelastettiin" välttämällä hyökkäys Japanin kotisaarille oli korkein sotilaallinen arvio 46 000 kuollutta amerikkalaista. Churchillin väitteet ylittivät vielä Trumaninkin valheen: atomipommi oli pelastanut 1 200 000 ihmishenkiä, mukaan lukien 1 000 000 amerikkalaista, hän maalaili.

 

1945: Pimeä puoli

 

Ja niin tulemme vuoteen 1945 ja siihen alati säteilevään riemuun jossa Absoluuttinen Hyvä otti voiton Absoluuttisesta Pahasta. Myytin pimeää pimeää puolta oli kuitenkin mahdoton täysin tukahduttaa. Se on tarina sekä voittajien että heidän suojattien rikoksista ja julmuuksista. Koska Winston Churchill oli keskeisessä osassa liittoutuneiden voitossa oli se myös tarina rikoksista ja julmuuksista johon Churchill oli sekaantunut. Näitä ovat noin 2 miljoonan ihmisen pakkopalauttamiset Neuvostoliittoon. Näiden joukossa oli kymmeniä tuhansia, jotka olivat taistelleet saksalaisten kanssa Stalinin sortojärjestelmää vastaan. Tästä Alexander Solzhenitsyn kirjoitti Vankileirien Saaristossa :

”Omissa maissaan, Rooseveltia ja Churchilliä kunnioitetaan valtiomiesviisauden ruumiillistumina. Meille meidän Venäjän vankiloiden keskusteluissa, heidän johdonmukainen lyhytnäköisyys ja tyhmyys paljastui hämmästyttävän ilmeisenä. . . mikä sotilaallisesti tai poliittisesti paljastui heidän luovutettua Stalinin käsiin satoja tuhansia aseistettuja Neuvostoliiton kansalaisia jotka olivat päättäneet olla antautumatta.”

Eräs häpeällisemmistä oli kasakoiden luovuttaminen Stalinille. He eivät koskaan olleet edes Neuvostoliiton kansalaisia koska he olivat taistelleet puna-armeijan vastaan sisällissodassa ja sitten muuttivat pois Neuvostoliitosta. Stalin oli ymmärrettävästi erityisen innokas saamaan heidän kynsiinsä ja britit tekivät heille palveluksen. Solzhenitsyn kirjoitti Winston Churchillistä:

”Hän luovutti Neuvostoliitolle 90 000 kasakkamiestä. Yhdessä niiden mukana hän on myös luovutti vaunulasteittain vanhoja ihmisiä, naisia ja lapsia. . . . Tämä suuri sankari, jonka muistomerkkejä on kaikkialla Englannissa, määräsi että nekin on luovutettava kuolemaan.”

Ranskan ”puhdistuksissa” vuoti verta enemmän kuin suuressa vallankumouksessa eikä kosto rajoittunut vain niihin, jotka on tavalla tai toisella olivat auttaneet saksalaisia: mukana olivat kaikki ne jotka ranskalaisten vastarintaliikkeen kommunistien näkökulmasta katsottiin ”äärioikeistolaisiksi”. Tito, Churchillin suojatti, on lisättävä luetteloon: hän murhautti kymmeniätuhansia kroaatteja, eikä vain Ustasha-järjestöön kuuluvia, vaan ns. "luokkavihollista", klassiseen kommunistisen tyyliin. Titon ja hänen joukkojensa murhaamiin lukeutui myös noin 20 000 Slovenian kommunismin vastaista taistelijaa. Kun Titon partisaanit riehuivat Triestessä, jonka Tito yritti napata vuonna 1945 murhattiin myös tuhansia italialaisia.

Churchillin liittolaisen tunkeuduttua Keski-Euroopaan ja Balkaniin alkoivat joukkokarkotukset. Joillakin Britannian hallituksen jäsenillä oli tunnontuskia osavastuun vuoksi. Churchill ei tällaisia tuntenut. Esimerkiksi tammikuussa 1945 osoitti hän sen ulkoministeriölle:

"Miksi meidän pitäisi pitää yllä meteliä venäläisten suorittamista saksalaisten ja muiden karkotuksista Romaniassa? ... En näe että venäläiset tekevät väärin pannessaan 100 000 tai 150 000 heistä tekemään työtä .... En voi itse katsoa, että se on väärin jos venäläiset ottaa mihin tahansa väestöryhmään kuuluvia romanialaisia ja vievät heidät Venäjän hiilikaivoksiin. " Noin 500 000 saksalaista karkotettiin pakkotyöhön Neuvostoliittoon Churchillin ja Rooseveltin annettua suostumuksensa Jaltassa että orjatyövoimaa voitiin käyttää "korvauksena".

Pahinta oli noin 15 miljoonan saksalaisen karkottaminen heidän esi-isiensä seuduilta Itä-ja Länsi-Preussissa, Sleesiassa, Pommerissa sekä sudeettialueilla. Tämä tapahtui sen Teheranissa tehdyn sopimuksen nojalla, missä Churchill ehdotti Puolan "siirtymisestä länteen" sekä siksi että Churchill hyväksyi Tšekin johtajan Eduard Benes suunnitelman "etnisestä puhdistuksesta" Böömissä ja Määrissä. Puolestatoista kahteen miljoonaan Saksan siviiliä kuoli joukkomurhien, joukkoraiskausten ja yleisen kaaoksen keskellä. Unkarilainen liberaali Gaspar Tamas kirjoitti, että saksalaisten ajaminen ulos Itä-ja Keski-Euroopassa "jossa heidän esivanhempansa ovat rakentaneet katedraalit, luostarit, yliopistot ja rautatieasemien" merkitsi koko antiikin kulttuurin pyyhkimistä pois.

Kaiken huipennukseksi tuli vielä Nürnbergin ”oikeudenkäynti” jonka senaattori Robert Taft kuvasi oikeuden irvikuvaksi ja jossa Stalinin tuomarit ja syyttäjät, 1930-luvun puhdistusten veteraanit, olivat spektaakkelin keskeisiä hahmoja. Tultaessa vuoteen 1946 alkoi Churchill valitella paheksuvaan ääneen tapahtumista Itä-Euroopassa:

"Stettinistä Baltiaan ja Adrianmeren Triesteen on rautaesirippu laskeutunut ympäri Eurooppaa."

Göbbels oli tehnyt termin "rautaesirippu" tunnetuksi.

Euroopan mantereella oli nyt vain yksi mahti – Stalinin Neuvostoliitto. "Kun sodan välke postui", John Charmley kirjoittaa, "Churchillille alkoi hahmottua tehdyn virheen suuruus." Churchillin omat syvämietteellinen katumus on jyrkässä ristiriidassa hänen ihailijoidensa voitonriemun kanssa. Sodan jälkeen hän kertoi Robert Boothbylle:

"Historioitsijat ovat taipuvaisempia tuomitsemaan sodan ajan ministerit vähemmän voittojen kuin sodan poliittista seurauksista. Tuolla mittarilla en ole varma, että minä olisin suoriutunut hyvin. "

Toista maailmansotaa käsittelevän historian ensimmäisen osan esipuheessa Churchill selitti miksi hän oli niin levoton:

”Inhimillinen tragedia huipentuu kun kaikkien satojen miljoonien ihmisten uhrausten ja ponnistelujen jälkeen oikeuden voitettua emme ole vieläkään saaneet rauhaa ja turvallisuutta vaan suuremmat uhat kuin mistä selvisimme.”

Voitonpäivänä hän ilmoitti voiton "tuoneen vapauden jokaiseen maahan." Mutta yksityisesti sihteerilleen hän mainitsi: "Mitähän on Venäjän valkoisten hankien ja Doverin valkoisten kallioiden välissä?"

 

Millainen hän oli?

 

Oli siis hieman myöhäistä esittää tuollaisia kysymyksiä. Sen sijaan olisi aiheellisempaa kysyä mitä pitäisi ajatella sellaisesta valtiomiehestä, joka esitetään vieläpä ”kaikkien aikojen suurimpana” joka ei vaivautunut edes miettimään mitä maaninen pyrkimys Saksan tuhoamiseen - ”voitto millä hinnalla hyvänsä” - merkitsi esimerksi Euroopalle. Tuhoamalla Saksan tuhosi Churchill hengenheimolaisensa, toisen Saksan vihaajan, Rooseveltin kanssa luonnollisen tasapainottavan tekijän Venäjälle. Tämän kohtalokkaan virhearvion vuoksi piti herra Churchillin sotkea sitten USA pysyvästi kylmään sotaan ja Eurooppaan koska mitään muuta ei enää ollut jäljellä. Tämä muutti peruuttamattomasti myös Amerikan Yhdysvallat ja tämä olisi syytä aina muistaa maailman uusimmissa konflikteissa. Olivathan amerikkalaiset erittäin vastahakoisia ylipäätään liittymään koko sotaan ennen Pearl Harboria.

Välittömästi sodan jälkeisissä ensimmäisissä vaaleissa Churchill kärsi tappion. Kun konservatiivit palasivat valtaan vuonna 1951, "Churchill valitsi hallituksen, joka oli mitä ilmeisemmin historian vähiten konservatiivisin." Mutta nuo vuodet osoittivat ettei hän todellisuudessa oikein koskaan piitannut kovinkaan paljon sisäpolitiikasta. Se mitä hän rakasti oli valta ja tuon vallan suomat mahdollisuudet elää draaman ja kamppailun täyttämää elämää sekä ennen kaikkea käydä loputonta sotaa.

On houkuttelevaa tarkastella Winston Churchillia syvästi virheitä täynnä olevana ihmisenä, joka kutsuttiin kriittisellä hetkellä taistelemaan ainutlaatuisen kauhistuttavaa pahaa vastaan ja joka puutteistaan huolimatta sai kunniakkaan voiton. Tällainen tuomio olisi hyvin pinnallinen. Hänen uransa suora ja rehellinen tutkimus tuottaa toisenlaisen johtopäätökseen: kaikki mitä oli sanottu ja tehty osoitti että Winston Churchill oli verenhimoinen mies – Man of Blood - vailla mitään poliittisia periaatteita ja hänen ihaileminen ja palvominen turmelee vain politiikan ja historian tutkimuksen rehellisyyden.

 

Lähteet:

John W. Denson, The Costs of War

Ralph Raico - Rethinking Churchill

Eugene B. Sledge, The Old Breed and the Costs of War

Paul Fussell, The Culture of War

Paul Gottfried, Is Modern Democracy Warlike?


( Päivitetty: 02.04.2013 20:02 )

 - pelontorjunta | Kommentit (1)Kommentoi



 Narsismi
01.11.2010 10:49 | pelontorjunta

 

 

 

 

Uusi ihminen, narsisti, on ollut tunnettu jo ainakin viimeiset kaksi vuosisataa länsimaisessa kulttuurissamme. Kuitenkin vasta nyt hänestä on tullut suvaittu ja sallittu ihanne myös kuluttajana. Ja nyt riittää kaikille mitä kuluttaa. Kunniaan sitoutuneet narsistit olivat kyllä aikoinaan olleet aateliston ydin ja koko säädyn olemassaolo kytkeytyi paljolta sen miehisen jäsenten turhamaisuuteen ja valmiuteen nostaa itselleen kuuluvaksi edellytetty kunnia kaiken muun yläpuolelle. Mutta edes porvarillinen narsismi ei uskaltanut palvoa kulutusta sen itsensä vuoksi. Sitä ainakin peiteltiin vaikkapa kulttuurin kielellä.

Kulutusyhteiskunnassa kunnialla ei ole enää mitään käyttöä, ei liioin ylevällä puheenparrella. Narsisti vaatii nyt itselleen hyödykkeitä, palveluita, yltäkylläisyyttä, lyhyesti sanoen halujen tyydytystä kaikinpuolisesti. Ja yhteiskunta sallii tämän ja jopa tukee sitä voimallisesti. Kysymyshän on siitä, että kulutuksesta tuli nyt koko yhteiskunnan yleinen ja yhtäläinen merkitys. Kieltäytyjästä on tehty taas säälittävä hahmo, johon tuota tunnetta ei tosin ole käytännössä tuhlattu.

Entisen hyveellisen kieltäytyvän tuottajan rinnalla ja itse asiassa koko kulttuurin perimmäisenä tarkoituksena on nyt kaikinpuolin himokas ja kyltymätön kuluttaja. Nuorison vastakulttuuri nyrpeine kiljujineen, joiden äänet muistuttavat kaikkein alkeellisimmista villiheimoista silloin kun nämä sallivat hedelmällisyysriittien tapahtua, sopivat erinomaisesti yhteen tämän kokonaisuuden kanssa. Todelliiset protestit ovat jäänet vähäiseksi marginaali-ilmiöiksi ja normaalisti ne ovat aina tukeneet kulutus- ja nihilismikulttuurin kehittymistä loogiseen täydellisyyteen ja sen siirtymistä entisen korkeakulttuurin tilalle.

Kulutususkonnon kyky korvata oikea uskonto on ollut aika merkittävä, joskin näennäinen. Ihmisten yhteisyys, mystinen unioni tapahtuu arkisesti, mutta todellisesti hypermarketeissa, saippuasarjojen ääressä, villimusiikin tahdittamissa rituaaleissa, jotka keräävät enimmillään kymmeniä tuhansia ja television välityksellä satoja miljoonia yhdeksi huutavaksi massaksi. Ihmisten on yhä helpompi olla osa suurta kokonaisuutta. Se ei vaadi häneltä enää mitään muuta kuin omien kaikkein primitiivisempien vaistojen noudattamista. Häntä ei ajeta ulos yhteisöstä, vaikka hän tekisi mitä tahansa. Kaikki on sallittua.

Alkukantaisuuden näennäisesti ristiriitainen suosio näyttää perustuvan siihen, että siitä etsitään aitoutta, alkuperäisyyttä ja autenttisuutta. Renkaat nenässä rumpuja pärisyttävästä aarniometsien asukkaasta on tullut aikamme tärkeimpiä sankareita. Autenttisuutta viidakoista toki löytyy, mutta spontaani halujen tyydytys on juuri kulttuurin vastakohta siinä mielessä kuin se vielä hiljattain ymmärrettiin. Markkinaviihteen tarkoituksena on kiihoittaa aisteja eri tavoin, se on siis pornografiaa, maksullista kiihotusta. Sisältöinä voivat olla seksi, väkivalta, kauhu ja muut vastaavat elämykset. Kaikkein viisainta onkin virittää tarinat lähes esipuberteetti-ikäisten tasolle, silloin se löytää suurimman mahdollisen ostajalauman. Esim. bestsellereiden sisällöllinen heppoisuus on niille aivan välttämätön. Harry Potter tai Lady Gaga ovat kotonaan yhtä hyvin Tuupovaaran Öllölässä kuin Timbuktussakin.

Länsimaisen kulutussivilisaation vastajulistettu universalismi sai ensi kerran nyrkkiä naamaan sitten New Yorkin kaksoistornien romahtaessa. Jatkoa on seurannut Irakissa ja Afganistanissa, jolloin lopullisesti selvisi että läheskään koko maailma tule nielemään sellaisenaan ajatusta, jonka mukaan kulutussivilisaatio tulee olemaan maailman kulttuurin lopullinen päätepysäkki – happy end.

Kulttuurin rappion sinetti on, kun se menettää itsevarmuutensa, kun se pyytelee anteeksi pikemminkin kuin ylpeilee saavutuksillaan. Konkreettisesti se ilmeni mm. Irakissa, jossa vastakkain olivat kulutusyhteiskunnan piiristä tulleet palkkasotilaat, joiden sivistystaso ja käyttäytymisen törkeys alittivat normaalin ihmisen mielikuvituksen.. Toisella puolella oli fanaatikkoja, joiden sivistystaso on yhtä matala ja uskontunnus kiusallisen tolkuton, yhtä kaukana kulutusyhteiskunnan paratiisista kuin taivas maasta. Sodat Irakissa ja Afganistanissa vahvistivat myös kulttuurin rappion tunnusmerkin erään tuntomerkin: kieltäytyminen kuolemasta kulttuurin puolesta. Missä viipyvät kymmenet miljoonat länsimaiset urhoolliset ja innokkaat nuoret jonottamassa pääsyä Lähi-itään?

Asia on selvä. Kulttuurissa, jossa mielihyvän maksimointi on ainoa ja perimmäinen tarkoitus, ei mikään voi korvata sen menettämistä. Helleenis-kristilliseltä perustalta kasvaneen länsimaisen sivilisaation vastustuskyky ulkoisia kilpailijoitaan vastaan nykyisessä vaiheessaan vaikuttaa siis perin surkealta. Ja kun tiedämme demografisen kehityksen tuovan muutoksen, emme sittenkään ennusta aikamme sankarille, renkaat nenässä rumpuja pärisyttävälle aarniometsän asukkaalle lopullista voittoa.

 


( Päivitetty: 02.04.2013 19:57 )

 - pelontorjunta | Kommentoi



 Ja kaiken keskellä on - lapsi!
29.01.2013 14:48 | pelontorjunta

 

Taloustiede on viime vuosina pyrkinyt selittämään syytä sille miksi monissa vielä äskettäin kovan talouskasvun maissa kuten Japanissa, Saksassa ja jopa USA:ssa on jouduttu uuteen tilanteeseen viimeistään 2000-luvulla: talous ei kasva joko ollenkaan tai huomattavasti hitaammin kuin oli aiemmin totuttu. Japanilla oli vielä 1970-luvulla jopa keskimäärin 7-8%:n vuotuinen talouskasvu. Saksassa n. 5%:n. 1990-luvun alussa Japanin talouskasvu käytännössä loppui kokonaan eikä Saksan tilanne ole eleellisesti parempi. USA:ssa on viimeisen 5 vuoden aikana havahduttu samaa asian eteen. Huolimatta hyvistä yrityksistä on lähes kaikissa länsimaissa sekä Japanissa talouskasvu heikentynyt. Eräissä maissa talouden kehitys on jo suorastaan negatiivista. Jotakin hyvin peruuttamatonta on tapahtunut. Se yleisesti käsitetään. Sen sijaan käänteen syistä vallitsee erimielisyys.

Talouskasvu on talouden tuottamien tavaroiden ja palvelujen arvon lisääntymistä. Sitä mitataan tavallisesti reaalisen bruttokansantuotteen (BKT) prosenttimuutoksella. Reaalinen tarkoittaa, että hintojen nousun eli inflaation vaikutus on otettu huomioon.

Talouskasvua mitataan bruttokansantuotteen (BKT) positiivisella %-muutoksella vuodessa. Mikäli BKT:n muutos on negatiivinen, niin tällöin kyseessä on talouden supistuminen, talouden taantuma tai mahdollisesti jopa talouslama. Luotettavampi mittari kansantuotteella on kuitenkin asukasta (capita) kohti laskettu bruttokansantuote, BKT per capita, sillä se kuvaa keskimääräistä rahassa arvotettua taloudellista transaktiota henkeä kohden vuodessa. Vastaavasti useimmiten maiden välisissä vertailuissa käytetään asukasta kohti lasketun BKT:n muutosta. Lähes poikkeuksetta BKT/capita -mittarit korjataan vielä ostovoimapariteetilla (PPP), jotta maiden väliset hintaerot tulisi huomioitua vertailuissa.

Koska talouskasvua mitataan BKT:n muutoksella, on sillä myös mittarina kaikki BKT:n hyvät ja huonot puolet. Talouskasvua käytetään usein hyvinvoinnin vertailuun, koska sen ajatellaan kuvaavan keskimääräisen elintason muutoksia. BKT per asukas on yksinään kuitenkin vajavainen hyvinvoinnin kuvaaja. Kuitenkin BKT:n ja muiden elintason mittareiden välinen korrelaatio on positiivinen ja voimakas. Korkea BKT/capita -taso (korkea bruttokansantuotteen taso asukasta kohden) korreloi positiivisesti mm. alhaisen lapsikuolleisuuden, korkean lukutaidon & koulutuksen tason ja korkean eliniän odotteen kanssa. Tiivistetysti voidaan sanoa, että korkea BKT:n taso liittyy myönteisesti muihin aineellisen elintason mittareihin kuten terveydenhuollon ja koulutuksen tasoon. Myös inhimillisen kehityksen indeksi HDI on kehitetty ottamaan huomioon edellä mainittuja tekijöitä, mutta sen käyttö on toiseksi vähäistä.

Niin kutsuttu eläkepommi on ongelma vain tietyissä länsimaissa, joissa on olemassa toisen maailmansodan jälkeiset niin sanotut suuret ikäluokat. Suomen pankin pääjohtajan Erkki Liikasen arvion mukaan talouskasvu tulee hidastumaan Suomessa pitkällä aikavälillä. Väestönkasvun hidastuminen ja suurten ikäluokkien jääminen eläkkeelle vähentävät käytettävissä olevan työvoiman määrää, jolloin talouskasvu jää työn tuottavuuden kasvun varaan. Väestön ikääntyminen on erityisen suuri huolenaihe nimenomaan Suomessa, jossa on kookkaat suuret ikäluokat ja EU-maiden nopein väestön ikääntymisen vauhti. Asian korjaamiseksi on ehdotettu yksittäisen työntekijän työpanoksen lisäämistä työn tuottavuuden kasvun lisäksi yksittäisen työntekijän työhön käyttämän ajan määrää kasvattamalla. Eläkepommi tulee lisäämään kuntien vanhustenhoitomenoja.

 

”Kun väki vähenee niin pidot paranee”- vai paraneeko sittenkään?

 

Ei ole varmasti maailmassa pula taloustutkimuksista ja taloustiedettä harjoitetaan jotta löydettäisiin syy-seuraus suhteet niin kasvulle, kriiseille, taantumilla sekä ankarille talouslamoille. Monenlaista elvytyspolitiikkaa harjoittamalla voidaan hetkellisesti saada talouteen piristysruiske mutta pitemmän päälle muut tekijät alkavat kuitenkin painaa talouskasvua alaspäin. Toisen maailmansodan jälkeinen voimakas talouskasvu ei ollut pelkästään ”onnistuneen talouspolitiikan” ansioita vaikka ns. keynesiläisellä elvytyksellä pidettiin länsimaiden talouskasvu jokseenkin vakaana aina vuoteen 1973 asti. Ensimmäinen öljykriisi pysäytti jatkuvan kasvun vaiheen, mutta pysähdys oli tilapäinen. Kasvu jatkui myöhemmin 1980-luvulla osittain halventuneiden raaka-aineiden ja energian takia. Hitaan, lähes olemattoman talouskasvun vaihe alkoi vähitellen sitten 1990-luvulla. Ensin Japanissa, sitten Länsi-Euroopassa leviten sieltä sitten vuonna 2007 myös Yhdysvaltoihin. Nykyisin kasvu on enää vain murto-osa 30 vuoden takaiseen aikaan verrattuna. Miksi tämä kaikki tapahtui? Miksei valtava teknologinen buumi eteenkin informaatioteknologiassakaan kyennyt hiipumista estämään?

Tämän kysymyksen ratkaisemiseksi on syytä miettiä mitä länsimaisissa yhteiskunnissa tapahtui jo vuosikymmeniä ennen tätä. Suomessa kuulee usein vielä vanhan sanonnan jonka mukaan pidot vain paranevat kun väki vähenee. Itse asiassa länsimaissa ja Japanissa tapahtui suuri muutos eteenkin toisen maailmansodan jälkeisenä aikana suhtautumisessa sellaisiin instituutioihin kuin avioliittoon, parisuhteeseen, perheeseen – ja lapsiin.

 

Naisten ns. vapautuminen

 

Sodan jälkeisille vuosikymmenille oli ominaista naisten voimakas siirtyminen työelämään. Naiset rynnivät voimalla myös oppilaitoksiin mm. yliopistoihin niin että nykyisin heidän koulutusasteensa on jo selvästi miehiä parempi lähes kaikissa OECD- maissa. Monissa yliopistoissa on jo yli kaksi kertaa enemmän nuoria naisia kuin miehiä.

Naisten siirtyminen työelämään, kaupungistuminen, teknologinen kehitys ja muutamat muut keskeiset asiat johtivat siihen että sodan jälkeisinä vuosina Euroopassa, Japanissa ja Pohjois-Amerikassa koettiin ennennäkemätön talouskasvun kausi. Noin 4-5%:n vuotuinen talouskasvu oli yli sata kertaa suurempaa kuin mitä se oli ollut 1500-luvulla ja kymmenkertainen 1800-luvun alkupuoleen verrattuna.

Hyvin keskeiseksi yhteiskunnalliseksi normiksi muodostui perhe jossa molemmat vanhemmat kävivät töissä ja joissa oli korkeintaan kaksi lasta. Koulutuksen lisääntyminen, kaupungistuminen, työssäkäynti muutti koko käsitystä perheestä lopulta niin, että jopa tuosta normista yhä useampi lipesi. Väestömäärän pysyminen ennallaan edellyttäisi että jokainen synnytysikäinen nainen synnyttäisi keskimäärin 2.1 lasta. Jo 1960-luvulla tuo maaginen raja alitettiin jo useissa kehittyneissä maissa. Seuraavalla vuosikymmenellä lähes jokaisessa. Saksa, Japani, E-Korea, Italia ja Espanja alittivat jopa 1.4 syntyneen lapsen hedelmällisyysrajan. Vielä tässäkään vaiheessa poliittinen järjestelmä ei näyttänyt välittävät tästä mitään sillä väestön terveyden paraneminen, eliniän odotteen kasvu sekä siirtolaisuus korvasivat akuutin väestön vähenemisen.

Valitseva ideologinen ajattelu, eteenkin vasemmistossa mutta myös liberaalissa porvaristossa, suosi mahdollisimman matalaa syntyvyyttä. Korkea syntyvyys rinnastettiin köyhyyteen, takapajuisuuteen, primitiivisyyteen, edistyksen vastaisuuteen – siis suoranaiseen typeryyteen. Tätä ideologista mallia perusteltiin mm. väestöpommilla, luonnon saastumisella ja muilla ekologisilla uhkatekijöillä. Rooman Klubin sanoma 1970-luvun alussa tavoitti massat. Vallitsevia arvoja oli ”itsensä toteuttaminen”, ”naisten vapautuminen” ja monet muut itse asiassa merkille pantavan hedonistiset tavoitteet. Länsimaissa koko tapa ajatella perhettä muuttui. Kun aiemmin noin 75% talouksista oli sellaisia joissa oli lapsia niin nyt tuskin edes 30% talouksista on lapsiperheitä. Lapsiperheistä yhä suurempi osa on myös yksinhuoltajatalouksia.

Ideologia sinänsä tuskin sai muutosta aikaan sillä syntyvyyden lasku näytti olevan vääjäämätön seuraus vaurastumisesta, kaupungistumisesta sekä teknologian kehityksestä sekä koulutuksen lisääntymisestä. Punavihreä porvarillisella liberalismilla höystetty jargon vain jälkikäteen juhlisti jo muuttunutta käsitystä, jossa yksilö näytti nousevan keskeiseen sijaan, kun se ennen oli ollut nimenomaan perhe ja/tai suku.

 

Vanhat sanoivat: ”lapsi tuo leivän tullessaan”

 

Vanhassa agraariyhteiskunnassa arvot rakentuivat täysin toisella tavalla. Avioliitto oli nimenomaan normi jota ei kyseenalaistettu. Se ei usein rakentunut ainakaan pelkästään kahden aikuisen ihmisen rakkaussuhteeseen. Sen saneli järki ja ympäröivä yhteisö. Puolison oli syytä olla ”hyvä tekemään työtä”. Lapsettomuus oli yhteisön silmissä aikamoinen häpeä. Lapsi merkitsi tulevaa työvoimaa sekä myöhempää sosiaaliturvaa vanhuksille. Tämä on todellisuutta suuressa osassa maailman köyhimpiä maita myös tänään. Tällaisessa kulttuurissa kaikki rakentuu ikään kuin tiedostamatta lapsen ympärille vaikkei näissä yhteiskunnissa todellakaan lapsia hemmotella kuten vähälapsissa länsimaissa nykyisin. Mies ja nainen raatoivat pellolla ja metsissä ja tekivät sen itsensä ja nimenomaan lastensa takia. Joku lapsista peri maatilan ja jos mahdollista oli se voitiin jakaa useimmallekin lapselle. Mistään kvartaalitaloudesta ja lyhytjännitteisyydestä ei ollut tietoakaan.

Maapallon väestön varsinainen nopea kasvu alkoi aluksi juuri Euroopassa sekä valtaosaltaan eurooppalaisten asuttamissa merentakaisissa siirtokunnissa jo 1700-luvulla. Taloudellinen kasvu seurasi 1800-luvulla aluksi hitaammin ja sitten vuosisadan loppua kohden yhä nopeammin. Lisääntyvä väestö merkitsi paitsi kasvavaa työvoiman tarjontaa (joka hillitsi työvoimakustannusten liiallista nousua) myös kulutuskysynnän kasvua. Syntyi positiivinen kasvun kierre. Väestön huoltosuhde oli hyvä, sillä vaikka lapsia oli paljon oli huollettavia vanhuksia hyvin vähän. Niinpä sosiaaliturvan kustannukset olivat olemattomat. Ihmiset huolehtivat omista vanhuksistaan.

Malthusilainen teoria jonka mukaan ihmiskunta on tuomittu ikuiseen köyhyyteen ja kurjuuteen väestönkasvun ja ravinnon riittämättömyyden vuoksi ei romahtanut suinkaan 1900-luvulla vaan jo paljon aikaisemmin. Koko 1800-luku oli taloudellisen kasvun ja ihmisten jonkinasteisen vaurastumisen vuosisata. Euroopassa nälkäkatastrofit päättyivät oikeastaan jo 1860-luvulla. Suomen nälkäkatastrofi (rauhan aikana) oli lajissaan viimeisiä Euroopassa.

Olivatko vanhat sittenkin oikeassa uskoessaan että syntynyt lapsi tuo maailmaan tullessaan mukanaan leivän – siis talouskasvun?

 

Afrikka

 

Tässä vaiheessa useimmat heittävät vastineeksi surulliset esimerkit niin takavuosien Intiasta, Bangladeshista kuin nykyisestä Afrikastakin. Todellisuudessa kaikissa näissä nopean väestönkasvun maissa nälkäkatastrofit ovat vähentyneet. Intiassa ja Bangladeshissa ne ovat jokseenkin päättyneet kokonaan. Afrikassakin ne ovat suhteellisesti huomattavasti vähentyneet.

Se kuva mikä länsimaalaisilla on Afrikasta on syvästi pessimistinen, kyyninen, synkkä – poliittisesti paapovan punavihreän ajattelun tuote. Suomen väestöstä kuoli hirvittävänä nälkävuonna 1696-97 peräti n. 30%. Vielä 1860-luvun nälkäkatastrofissa kuoleman viikate niitti peräti 8% väestöstä. Afrikassa edes pahimmatkaan nälkäkatastrofit eivät ole olleet viime vuosikymmeninä noin julmia. Huolimatta noin 2,5%:n keskimääräisestä vuotuisesta väestönkasvusta Afrikka näyttää selviämän. Malthusin teoria kaatui myös Afrikassa.

2000-luku on näyttämässä länsimaille uudet Afrikan kasvot. Viime vuosina 10 nopeimmin kasvavasta maailman taloudesta jopa 7 on ollut Saharan eteläpuolisen Afrikan maita. Kasvu ei ole suinkaan johtunut vain raaka-aineiden hinnan noususta. Suurin tekijä on ollut Afrikan kaupankäynnin ja talouden yleisessä vilkastumisessa. Afrikan matkapuhelinmarkkinat ovat maailman nopeimmin kasvavat. Kasvu alkoi myös usein ennen kuin paljon puhuttu Kiinan harjoittama taloudellinen yhteistyö edes kunnolla käynnistyi Afrikan maiden kanssa. Afrikka hyötyy uudesta teknologiasta (mobiilit ja aurinkopaneelit) mutta se hyötyy nyt ennen kaikkea siitä kaivoksesta joka eteenkin läntisissä maissa on tyhjenemässä – Afrikalla on työvoimaa, lapsia, nuoria, kasvavaa kysyntää ja nälkä menestyksen perään. Kuinka moni suomalainenkaan tietää siitä, että Afrikasta saatetaan löytää innovatiivisempia mobiilisovelluksia kuin Suomesta? Kuinka moni tietää että Afrikka on alkanut viemään mobiilisovelluksia muihin maihin - Aasiaan ja jopa Itä-Eurooppaan. Kuinka moni tietää että työttömyyden runteleman Portugalin nuoria on hakeutunut kymmeniä tuhansia töihin esim. Angolaan ja Mosambikiin?

On suorastaan järjelle käsittämätöntä kuinka nälän, mm. AIDS:n sekä rikollisuuden keskeltä nousee Saharan eteläpuolinen Afrikka maailman kiinnostavimmaksi uudeksi taloudelliseksi tekijäksi. Miten tuo kaikki on selittävissä?

 

Korrelaatio väestönkasvun ja talouskasvun välillä?

 

Itse asiassa demografisen ja taloudellisen tekijän keskinäinen riippuvuus on tiedetty jo kauan. Adam Smith, historian huomattavimpia talousajattelijoita, koko nykyisen taloustieteen keskeinen luoja, näki selvästi kuinka väestönkasvu on hyvin keskeinen tekijä vaurauden luomisessa.

Toisen maailmansodan jälkeen eteenkin tilastomatematiikan kehitys mahdollisti tutkia talouskasvua eri mittareilla. Mutta vasta 1980-luvun lopulla havaitsivat ensimmäiset tutkijat merkittävän korrelaation talouskasvun ja väestökehityksen välillä. Näistä tutkijoista yksikään ei ollut taloustieteilijä. He kaikki olivat väestötutkijoita.

Nämä tutkijat vertasivat väestötilastoja ja taloudellista kulutusta ja havaitsivat että noin 48 vuotta sen jälkeen kun syntyvyys kääntyy pysyvään laskuun tapahtuu vastaavanlainen kulutuksen ja investointien kasvun taittuminen ja suoranainen väheneminen. Japani hyötyi ensimmäisenä sodan jälkeen talouskasvusta koska sillä ei ollut ns. vauvabuumia mutta sillä oli aiemmin syntynyttä väestöä työvoimana. Vuonna 1990 Japanin talouskasvu, kulutuskysyntä ja investoinnit pysähtyivät kuin seinään. USA:n väestötilastot osoittavat kuinka 1960-luvun alussa syntyvyys kääntyi selvään laskuun. Vuonna 2008 maa ajautui talouslamaan finanssikriisin takia. Sen jälkeen odotettua talouskasvua (n. 3-4% vuosittain) ei ole tullut. Vuonna 2013 USA:ta uhkaa edelleen talouden epätasapaino, julkisen sektorin vajeet. Ja USA on kuitenkin hyötynyt latinalaisesta Amerikasta ja Aasiasta virranneesta siirtolaisuudesta. Mutta nyt myös latinomaiden syntyvyys on voimakkaassa laskussa. Samoin on käynyt USA:n oman latinoväestön syntyvyyden kanssa. Kovan talouskasvun Kiina joutuu 2020-luvulla kohtaamaan myös yhden lapsen perhepolitiikan ikävät seuraukset. Odotettavissa on Kiinan talouskasvun huomattava hiipuminen.

Euroopan osa on vielä synkempi. Jo nyt väestö vähenee useimmissa itäisen Euroopan maissa. Syntyvyys on jopa 40% alle bruttouusiutumisluvun. Pahimmat talouslaman runtelemat EU-maat (Kreikka, Espanja, Italia, Portugali) ovat niitä joissa syntyvyys on ollut jo pitkään todella matalalla tasolla. Surkea huoltosuhde, kasvavat alijäämät, lisääntyvät terveydenhuollon kustannukset, sosiaalimenot, odotettavissa oleva heikko, jopa negatiivinen kulutuskysyntä ja investointitaso murtavat nuo taloudet. Pohjoisen Euroopan astetta parempi tilanne johtuu osittain siitä, että näissä maissa syntyvyys on ollut jo vuosikymmeniä 20-30% korkeampi kuin eteläisissä maissa. Liian matala se tosin on myös Britanniassa ja pohjoismaissa.

 

Liberaalin pillerisukupolven suuri harha?

 

Länsimaiden osalta tilannetta pahentaa myös avioerokulttuurin tavaton yleistyminen joka johtaa yksinhuoltajaperheiden lisääntymiseen. Tutkimusten mukaan näissä perheissä kasvaneilla lapsilla on selvästi enemmän ongelmia koulussa ja myöhemmin elämässä kuin sellaisissa perheissä joissa oli kaksi vanhempaa ja joissa ei ollut tapahtunut avioeroa. Eikä tässä kaikki. On myös havaittu ilmiö jossa eteenkin pitkälle koulutetut akateemiset naiset ovat kaikkein haluttomampia synnyttämään lapsia. Kärjistäen: ne joilla olisi parhaimmat edellytykset tarjoamaan lapsille hyvä kasvuympäristö eivät synnytä, ne joilla on heikommat taloudelliset edellytykset synnyttävät. USA:ssa yli 25%:lla koululaisista on nykyisin jo hyvin heikot oppimislähtökohdat juuri perhetaustojen vuoksi (köyhät yksinhuoltajaperheet).

Tilanne on kiinnostava. Darwinin ja evoluutioteorian mukaan vahvempien pitäisi syrjäyttää heikoimmat. Soveliaat korvaavat ei-soveliaat. Jos näin on niin miksi ihmisten osalta tämä näkyy siinä että älykkäät, koulutetut, varakkaat eivät halua lisääntyä? Miksi sosiaalisesti heikommassa asemassa olevat synnyttävät? Jo nyt tiedämme että joukossamme on ihmisiä jotka haluavat että lapsia syntyy. Hyvin usein he ovat uskonnollisia ihmisiä: ortodoksijuutalaisia, fundamentalistikristittyjä ja muslimeja. Ihmiskunta ei siis suinkaan ole katoamassa mutta katoaako ne jotka ovat maallistuneita? Evoluutioteorian kannalta nykyinen ihmisten maailma on kiinnostava poikkeus. Vai onko se poikkeus? Hoitaako evoluutiokehitys pois sen väestöaineksen joka ei edes käsitä niinkin keskeistä asiaa kuin väestön lisääntymisen tai edes jonkinasteisen uusiutumisen välttämättömyyden?

 

Länsimaiden tulevaisuus?

 

Hyvin monet merkit viittaavat siihen suuntaan jossa häämöttää länsimaiden (Eurooppa ja Pohjois-Amerikka) taloudellisen ja ehkä sitä kautta myös kulttuurisen painoarvon hiipuminen. Sellaiset yhteiskunnat jotka eivät kykene ylläpitämään edes väestönsä uusiutumista muuta kuin siirtolaisuuden avulla eivät kykene ylläpitämään omaa taloudellista hegemoniaansa. Länsimaiden osalta lienee edessä Rooman Imperiumin kohtalo. Jo Julius Cesar valitteli aikoinaan sitä kuinka roomalaisista on tullut niin hedonistisia etteivät he halua lisääntyä ja niinpä yhä suurempi osa suurvallan väestöstä tulee olemaan vieraita kansoja. Länsimaissa vallitseva monikulttuurisuusajatus on todellisuudessa selvä reaktio siihen mitä on jo tapahtumassa. Vastuu väestön uusiutumisesta jätetään uusille kulttuurienklaaveille sillä kantaväestö on norminsa ja arvonsa jo valinnut. Eurooppa muuttuu, samoin USA. Millaiseksi sen tietävät vasta tulevat sukupolvet. Mutta se on varmaa että syy länsimaisen kulttuurien todennäköiseen hiipumiseen on nyt tiedossa. Edistyksellisyyden nimissä huuhtoutui nimittäin lapsi. Sen mukana menee taloudellinen kasvu ja taloudellisen kasvun mukana myös yhteiskunnan rakenteet. Sellaisena kuin olemme länsimaisen kulttuurin ymmärtäneet tulee se näin ollen marginalisoitumaan, muuttumaan arvottomaksi ja todennäköisesti häipymään maailmankartalta kokonaan.

Harva ihminen eteenkin postmodernissa läntisessä maailmassa usein pysähtyy ajattelemaan miksi mies nosturissa, tehtaassa, rakennustyömaalla, miksi nainen sairaalassa, tehtaassa, toimistossa, kaupassa ym. tekee työtä. Tekeekö hän vain ja ainoastaan "itseään toteuttaen" ja omien kyltymättömien halujensa tyydyttämiseksi saatavan tulon takia? Tuskin. Näin ei hänen pitäisi toimia. Ei ainakaan pääsääntöisesti. Kulttuurimme keskiössä seisoo lapsi. Vain hänen vuoksi kannattaa ponnistella ja yrittää. Jos kultuurimme keskiössä ei seiso lasta on sellainen kulttuuri muuttunut täysin arvottomaksi ja joutaakin joutua muitten kulttuurien syrjäyttämäksi. 

 


( Päivitetty: 29.01.2013 15:07 )

 - pelontorjunta | Kommentoi



 Afrikkalainen Exodus
20.11.2012 18:46 | pelontorjunta

Ihmisen evoluutiolla tarkoitetaan ihmisen kehittymistä ja eriytymistä omaksi lajikseen ihmisen ja muiden apinoiden tai apinaihmisten yhteisestä kantamuodosta. Ihmisen evoluution tutkimukseen liittyy useita tieteenaloja, muun muassa fyysinen antropologia ja perinnöllisyystiede. Ihmisellä tarkoitetaan tässä yhteydessä ensisijaisesti ihmisten (Homo) suvun jäseniä, mutta ihmisen evoluution tutkimus käsittelee yleensä myös muita hominideja.

Uutta tietoa on saatu viimeisen kahdenkymmenen vuoden aikana fossiililöydösten myötä runsaasti. Ihmisten, apinaihmisten ja ihmisapinoiden kehitystä kuvaavat sukupuut näyttivät vielä jokin aika sitten varsin selkeiltä. Uusimpien löytöjen myötä sukupuu on kuitenkin muuttunut ”kehityspensaaksi”, johon pitäisi saada mahdutettua lukemattomat viime vuosina löydetyt uudet sukulaiset. Monet entiset käsitykset ovat osoittautuneet liian yksinkertaisiksi: ihminen ei ole suoraan kehittynyt nykyisenlaiseksi ihmisapinoista, vaan kehityslinjassa on ollut useita haaroja. Maapallolla on elänyt samanaikaisesti useita eri ihmis- ja apinaihmislajeja. Vasta noin 30 000 vuotta sitten neandertalinihmisen kuoltua sukupuuttoon syntyi nykyinen tilanne, jossa maailmassa on vain yksi ihmislaji, nykyihminen. Huomattavaa on myös se miten hidasta esim. Euroopassa eläneen neandertalilaisen ihmisen kehitys parin sadan tuhannen vuoden aikana lopultakin oli. Ja vaikka täyttä tieteellistä varmuutta ei vielä ole vaikuttaa myös siltä että yksikään nykyisin elossa oleva ihminen ei ole minkään muun kuin nykyihmisten jälkeläinen. Uusimmat tutkimukset ovat myös kyseenalaistaneet viime vuosina esitetyt väitteet neandertalilaisen ihmisen ja nykyihmisen risteytymisestä vaikka neandertalilaisgeeniä on havaittu ehkä 2% eurooppalaisissa (muttei afrikkalaisissa). Tämä johtunee siitä että neandertalilaisella ja nykyihmisellä on yhteinen ehkä puolen miljoonan vuoden takaa mutta joka ei näy enää afrikkalasissa. DNA-tutkimukset osoittavat ettemme ole neandertalilaisten jälkeläisiä. Itseasiassa neandertalilaiset olivat tuoreen brittitutkimuksen mukaan vähentyneet murtoosaan aiemmasta määrästään Euroopassa ennenkuin ensimmäiset nykyihmiset saapuivat Eurooppaan.

Noin 35 vuoden aikana on tieteellinen konsensus voimistunut siitä että kaikki nykyisin elävät yli 7 miljardia ihmistä on todellisuudessa yhden ainoa kerran eläneen afrikkalaisen äidin – todellisen ”Eevan” - jälkeläisiä. Useimmat vähänkin asiasta kuulleet ihmiset hyväksyvät tämä tieteellisen teorian mutta kaikesta huolimatta kertomus ”lisääntymisestä ja maan täyttämisestä” ihmisillä on epäilemättä eräs järisyttävimmästä ihmeistä. Täyttä tieteellistä varmuutta tapahtumaketjusta ei vieläkään ole mutta erään varsin todennäköisen skenaarion mukaan kaikki sai alkunsa Afrikan itäosissa, suurten järvien ja maanosan itärannikon välisellä seudulla.

 

Afrikka

 

Kaikki nykyisten Afrikan ulkopuolisten väestöjen (”rotujen”) ominaisuudet ovat kehittyneet selvästi alle 100 000 vuodessa. Yhden syntykodin hypoteesia tukevat fossiilit, arkeologiset löydöt sekä biokemialliset ja geneettiset todisteet. Vanhin nykyihmisten fossiili on noin 195 000 vuoden ikäinen. Yli 130 000 vuoden ikäisiä nykyihmisten fossiileja ei ole löydetty muualta kuin Afrikasta. Lisäksi Afrikan väestöissä on selvästi enemmän perinnöllistä muuntelua kuin muiden mantereiden väestöissä ja muiden mantereiden populaatioissa ei juurikaan ole geenimuotoja, joita ei olisi Afrikassa.

DNA-molekyylien perusteella on laskettu nykyihmisen kehittyneen omaksi lajikseen noin 200 000 vuotta sitten. Kehitys oli vaiheittainen ja noudatti evoluutiolle ominaista vaihetta jossa eri ihmislajit elivät rinnakkain kunnes nykyihminen syrjäytti kehittyneempänä aiemmat ihmislajit. Nämä kuolivat sukupuuttoon ensiksi Afrikassa, myöhemmin Afrikan ulkopuolella. Kaikki ihmisen kehityslinjan alkujuuret on löydettävissä vain Afrikassa. Nykyihminen kehittyi Afrikassa. Vain Afrikassa oli olemassa parhaat mahdolliset olosuhteet nykyihmisen kehitykselle.

 

Afrikkalainen ”Mitokondrio-Eeva”


Kaikkien nykyihmisten DNA-tutkimuksin osoittavissa oleva kantaäiti asui siis itäisessä Afrikassa n. 200 000 vuotta sitten. Seuraavan n. 50 000 vuoden aikana tapahtui ensimmäiset DNA-tuloksin hahmotetut haarautumat. Me perimme kummankin vanhempiemme DNA:n ja koska saamme ainutlaatuisen sekoituksen molemmilta jokainen meistä on aivan aavistuksen verran erilainen DNA-rakenteeltaan. Meidän oma DNA on kuin ainutlaatuinen sormenjälki. Kirjaimilla A, G, C ja T se voisi olla vaikka kuvattavissa näin:

 

vaihtoehto a ACTTTCAATGGGTGTATCCTAGGGTGTACATATTTACT

vaihtoehto b ACTTTCAATGAGTGTATCCTAGGGTGTACATATTTACT

vaihtoehto c ACTTTCAATGGGTGTATCCTAGGGTGTATATATTTACT

vaihtoehto d ACTTTCAATGAGTGTATCCTAGGGTGTACATACTTACT

 

Tutkijoiden onneksi on olemassa kaksi osaa DNA:sta jotka eivät uudelleen yhdisty. Tämän ansiosta voidaan jäljittää ihmisen perimää tämän muuttumattoman DNA:n osan tietojen perusteella. Niitä on kaksi. Mitokondrio sisältää DNA:ta (mtDNA), joka on noin 16 600 emäksen mittainen rengasmainen DNA-molekyyli. Mitokondriossa DNA:ta on kuitenkin huomattavasti vähemmän kuin tumassa. Jälkeläinen saa hedelmöityksessä mtDNA:n vain äidiltä (uniparentaalinen periytyminen), kun taas tuman DNA:n jokainen saa molemmilta vanhemmiltaan. Toinen jota voidaan hyödyntää on muuttumaton osa Y-kromosomia.

 

Ensimmäinen sukuhaara

 

Noin 135 000-160 000 vuotta sitten tapahtui Afrikassa ensimmäinen nykyihmisen jälkeenpäin DNA-tutkimuksin todennettavissa oleva ”sukuhaarautuma”. Kuten aiemmin ja tulevaisuudessa näissä muutoksissa merkittävää roolia näytteli ilmaston ja olosuhteiden muutos joka pakotti suhteellisen pientä, tuskin paria tuhatta yksilöä suuremman nykyihmisen populaation siirtymistä toisistaan erilleen jotta ihmiset ylipäätänsä saattoivat selvitä hengissä. Tälle ajanjaksolle ajoittui jääkausi joka laski mm. merenpintaa kaikkialla maailmassa jopa sadalla metrillä. Mm. Euroopassa se näkyi siten että ihminen olisi voinut kävellä suoraan Ranskasta nykyiseen Iso-Britanniaan. Ilmasto viileni paikoitellen jopa 6 asteella. Afrikassa, jossa ainoastaan asui nykyihmisiä, osa ihmisistä vaelsi kuivuuden ja huonontuneiden olosuhteiden vuoksi kohti nykyistä Etelä-Afrikkaa, osa Kongon aluetta ja osa läntistä Afrikkaa kohden.

Oli myös neljäs ryhmä joka aloitti siirtymisen kohti Itä-Afrikan rannikko seutuja nykyisen Etiopian, Kenian ja Tansanian aluetta. Tätä viimeksi mainittua haaraumaa nimitetään DNA-tutkimuksissa L3:ksi.

 

Pois Afrikasta – ensimmäinen yritys

 

Arkeologiset löydöt Lähi-Idässä (Israel ja Arabiemiraatit) osoittavat että n. 100 000 -125 000 vuotta sitten pieniä ryhmiä afrikkalaisia nykyihmisiä siirtyi ilmeisesti pohjoisen reittiä pitkin Siinain kautta Israeliin ja jopa Turkin ja Syyrin väliselle seudulle. Varmuudella tiedetään vain se, ettei DNA- tutkimusten perusteella yksikään nykyihminen Afrikan ulkopuolella kuitenkaan polveudu näistä ihmisistä. Todennäköisin syy siihen miksi näin ei käynyt johtui yksinkertaisesti siitä syystä että nämä Afrikan ulkopuolelle siirtyneet ensimmäiset nykyihmiset menehtyivät olosuhteiden huonontuessa. Alkoi jälleen aika jolloin pohjois-Afrikka aavikoitui, samoin Arabian niemimaa.

 

Maailman ensimmäinen ”osteriravintola”

 

Nykyihmisen sukuhaara L3 siirtyi ilmastonmuutoksen ja huonontuneiden olosuhteiden vuoksi n. 100 00 vuotta sitten itäisen Afrikan rannikkoseudulle. Arkeologisten löytöjen perusteella aikakautena jolloin merenpinta oli nykyistä 5-10 metriä korkeammalla löytyy vielä tänään mm. Eritrean alueelta rinteistä selvät merkit entisestä merenrannasta jossa on täynnä nykyihmisten käyttämiä ostereita. Ihmiset myös kalastivat tänä aikana pääravinnokseen. Ehkä korkeintaan muutamien satojen tai tuhansien ihmisten ravintona kala ja osterit olivat merkittäviä siksi että syntyi kokonainen rantojen keräämis- ja kalastamiskulttuuri. Tuollaisen ravinnon tiedetään myös olevan aivojen kehittymisen kannalta hyväksi.

On myös todennäköistä että aikansa ilmastossa rannikolla eläminen saattoi olla varmin tapa säilyä hengissä. Todennäköisesti populaatio myös jossain vaiheessa lisääntyi niin paljon että joukon oli pian pakko siirtyä muualle.

 

Historian merkittävin Exodus

 

Viime vuosien tutkimukset ovat osoittaneet että nykyihmisten määrä Afrikassa vajaat 100 000 vuotta sitten oli varsin vähäinen. Arviot liikkuvat 2000 ja 10 000 ihmisen välillä. Saattoi olla että ihmiskunnan tulevaisuus olisi ollut jopa vain noin 500 lisääntymiskykyisen naisen varassa. Elettiin ankaraa jääkautta, jonka huippukohta lienee ollut n. 80 000-85 000 vuotta sitten. Ei ollut mahdollisuutta siirtyä sisämaahan, koska alueet olivat pahasti aavikoituneita. Jo se että populaatio ylipäätänsä selvisi rannikolle oli jo osoitus evoluution etenemisestä. Nämä afrikkalaiset nykyihmiset olivat kykeneviä siirtymään pois kun elinmahdollisuudet heikkenivät. Rannikolla eläminen oli kuitenkin kalastuksen varassa. Entä jos saaliit vähenivät ihmisten määrän pysyessä ennallaan tai jopa kasvaessa? Tässä vaiheessa astui esiin ilmastonmuutoksen, tässä tapauksessa jääkauden mahdollistama avautunut ikkuna – merenpinnan huomattava lasku myös Punaisella merellä.

Runsaat 80 000 vuotta sitten laski Punaisen meren pinta ehkä jopa sadalla metrillä sen kapeimmassa kohdassa – Afrikan ja Jemenin rannikon välisessä salmessa. Monet myöhemmin paljastuvat arkeologiset löydöt sekä DNA-tutkimukset osoittavat että todennäköisin paikka jolloin ensimmäiset nykyihmiset siirtyivät Afrikan ulkopuolelle tapahtui juuri tässä ratkaisevan tärkeässä paikassa ja se tapahtui juuri siksi koska jääkausi aikaansai myös ilmiön ettei ihmiset muualta voineet edes päästä Afrikan ulkopuolelle. Sahara on vielä ankarammin autiomaa kuin tänään. Tie pohjoisen kautta Afrikan ulkopuolelle oli tukossa. Ainoaksi mahdollisuudeksi jäi kahlaaminen ja lautoilla siirtyminen vastarannalle nykyisen Jemenin alueelle.

Nykyisen tiedetään että diversiteetti Afrikkaan jääneiden ihmisten keskuudessa on huomattavan paljon suurempi kuin Afrikan ulkopuolella asuvien keskuudessa. Tämä ja useat muut tosiasiat kertovat saman viestin: se joukko joka todennäköisesti siirtyi Afrikan ulkopuolella oli lopultakin hyvin pieni. Tutkijoiden arvioit liikkuvat korkeintaan tuhannessa. Useimmat, kuten mm. Stephen Oppenheimer ovat päätyneet ehkä vain noin 250 ihmisen joukkoon. Tämä on uskottava arvio siksi koska afrikkalaiset eivät yleensä liikkuneet pienissä ryhmissä. Yli 200 ihmisen klaani koostui yleensä kymmenistä perheistä. Eikä tuona äärimmäisen ankarana aikakautena nykyihmisen kuoleminen sukupuuttoon ollut kaukana. Suurin osa nykyihmisistä jäi Afrikkaan (geneettisesti nimetty L1, L2, L4, L5 ja L6). Heitä asui hyvin pieninä erillisinä ryhminä maanosan keski-, etelä- ja länsiosissa. Heitä jäi myös itäosiin. Mutta osa jälkimmäisistä ylitti punaisen meren silloin kuin siihen vielä oli mahdollisuus. Ihmiskunnan historian merkittävin Exodus oli alkanut.

 

Pitkin rannikkoa kohti itää

 

Se mitä nyt tiedämme on hyvin hämärän peitossa. Ja syykin on selvä. Se rannikko jota myöten afrikkalaiset siirtyivät Jemeniin siitä pitkiin Arabian niemimaan etelärannikkoa, kauas, kaus kohti itää ei ole se missä tuon alueen rannikko tänään sijaitsee. He olivat rannikkojen keräilijöitä ja kalastajia. He olivat sen kulttuurin jälkeläisiä joka oli säilynyt hengissä läpi ankarat vuosituhannet pyydystämällä kaloja ja syömällä ostereita Afrikan itärannalla Punaisella merellä. On täysin selvää että tämä joukko – huomioiden sen että ympäröivä sisämaa ei kuivuuden takia tarjonnut parempaa mahdollisuutta – siirtyi silloin rannikkoa pitkin. Vauhti ei ollut edes kummoinen. 1-2 kilometriä vuodessa rannikkoa pitkin tarkoittaisi sitä että parissa tuhannessa vuodessa siirtyjien jälkeläisistä osa olisi jo Intian niemimaalla. 6 000 vuodessa oltaisiin siirrytty Arabian rannikolta aina Kaakkois-Aasiaan, Malesiaan, nykyisille Sumatran, Jaavan ja Borneon saarille asti. Voisiko todellakin olla mahdollista että esim 74 000 vuotta sitten näitä afrikkalaisten siirtolaisten jälkeläisiä olisi jo asunut Intiassa ja Kaakkois-Aasiassa?

Tutkimustulokset vahvistavat tämän. Arkeologiset kaivaukset paljastavat nykyihmisten työkaluja löytyneen kymmenistä eri paikoista. DNA-tutkimukset paljastavat myös sekä Intian että Kaakkois-Aasian alueella eristyksessä kauan eläneiden afrikkalaisia muistuttavien pienten ihmisryhmien olevan juuri tämän ensimmäisen muuttoaallon jälkeläisiä. Heidän sukupuunsa paljastuu L3N:ksi tai L3M:ksi. Heitä asui Arabian, Pakistanin, Intian, Bangladeshin, Malesian, Sumatran, Jaavan, Borneon ja muiden Kaakkois-Aasian saarilla. Tämä tukee teoriaa että oli olemassa vain yksi ”pois Afrikasta”-muuttoaalto joka jäi geneettisesti näkyviin aasialaisissa, eurooppalaisissa, australialaisissa sekä Amerikan ensimmäisissä ihmisissä. 

 

Toba-tulivuoren purkaus – 74 000 vuotta sitten

 

Varmin todiste siitä että afrikkalaisten jälkeläiset saapuivat viimeistään n. 74 000 vuotta sitten mm. Kaakkois-Aasian saarille oli Pohjois-Sumatran keskiosassa sijainneet Toba-tulivuoren purkaus. Tutkijoiden mukaan tämä maapallon historian hirvittävin tulivuorenpurkaus ainakin 2 miljoonaan vuoteen tapahtui tutkijoiden mukaan todennäköisemmin juuri 74 000 vuotta sitten.

Purkaus oli seuraamuksiltaan kaamea. Se synnytti mm. kymmeniä kilometrejä korkean tuhkapilven niin että laajat alueet aina Intiassa ja Pakistanissa peittyivät kymmeniä senttejä korkean tuhkan alle. Tuhka peitti kasvillisuuden, tuhosi sen. Arvion mukaan Toba-vuoren purkaus vaikkakaan ei synnyttänyt uutta jääkautta (eräiden tutkijoiden mukaan jääkausi oli jo alkanut hieman aiemmin) mutta se todennäköisesti hetkellisesti viilensi entisestään ilmaa. Se aikaansai laajan ekologisen tuhon ja vähensi radikaalista tuhoalueelta hyvinkin kaukana asuvien ihmisten määrää aikana jolloin nykyihmisten lukumäärä oli muutenkin hyvin alhainen. 

Toba-tulivuoren purkauksen seurauksena maapallolla vallitsi tuhansia vuosia tilanne jossa nykyihmiset asuivat kahdessa osassa maapalloa erillään toisistaan: Afrikassa ja Arabian etelärannikolla sekä Kaakkois-Aasiassa pieninä erillisinä ryhminä saarilla sekä Kiinan kaakkoisrannikolla. Intiassa, Pakistanissa sekä Malesiassa asutus näytti joko tuhoutuneet täysin ja jäljelle jäi hyvin vähäisiä pieniä yhdyskuntia. Vasta tuhansia vuosia myöhemmin mm. Malesia ja Intian niemimaa asutettiin jälleen uudelleen. Tällä kertaa todennäköisemmin idän suunnasta ”paluumuuttona”. Intian niemimaalle muodostui jälleen asutusta jolla on hyvin suuri merkitys Aasian ja Euroopan myöhemmälle asuttamiselle.

 

Ilmaston viileneminen – ikkuna Australiaan

 

Kuten aiemmin Afrikassa, myös Kaakkois-Aasiassa ilmaston voimakas kylmeneminen aikaansai tutun jääkauden seurauksen. Vettä sitoutui entistä enemmän jäätiköihin jolloin merenpinta laski. Tämä mahdollisti sen että muutenkin evoluution kautta merelliseen ympäristöön sopeutunut uusi väestön kykeni helpommin siirtymään saariryhmiltä toisille. Tämä ilmiön seuraus oli lopulta se, että väestöä siirtyi Timorin saaren kautta jopa Australiaan asti. Tämä tapahtui todennäköisemmin n. 65 000 vuotta sitten. Aiemmin se ei voinut tapahtua eikä esim. 50 000 vuotta sitten sillä silloin merimatka olisi muodostunut liian pitkäksi eikä esihistoriallisella ajalla tunneta tapausta jolloin olisi siirrytty yli 200 km:n matkoja meritse. Kuten aina esihistoriallisena aikana vesitse tehtävät siirtymiset tehdään silloin kun jääkauden ote on kireimmillään ja merenpinta matalimmillaan. Australiaan siirtyminen tapahtui todennäköisemmin siis n. 65 000 vuotta sitten. Arkeologiset löydöt vahvistavat tämän skenaarion. Australian alkuperäiskansat kuuluvat samaan DNA-haaraan kuin Kaakkois-Aasian alkuperäiskansat. He ovat L3M/L3N:n eli Afrikan itärannikolla asuneen ”toisen Eevan” jälkeläisiä.

 

Miksi ei heti Eurooppaan?

 

DNA-tutkijoiden ja nykyihmisen alkuperää tutkivien ihmisten suurin mysteeri on ollut kautta aikojen se, miksi modernin ihmisen (Homo Sapiens Sapiens) ensimmäiset Afrikan ulkopuolella tehdyt havainnot liittyvät varmuudella Intian valtameren rannikkoseutuihin, kuten Intiaan, Malesiaan, Jaavaan tai jopa Australiaan eikä Eurooppaan. Miten voi olla mahdollista että nykyihminen ei siirtynyt suoraan Eurooppaan kun tie olisi ollut sinne suorin ja lyhyin? Jotkut tutkijat ovat viime vuosiin asti uskoneet että nykyihmiset olisivat kuitenkin siirtyneet ehkä Lähi-Idän kautta Eurooppaan. Mutta näin ei ole tapahtunut. DNA-tutkimukset osoittavat että Eurooppaan tultiin aivan toista reittiä ja aivan eri ajankohtana. Kuten aiemmin mainittiin oli nykyihmiset saapuneet mm. Palestiinan alueelle ja jopa Levantiin aiemmin kuin vaikkapa Kaakkois-Aasiaan. Mutta he eivät koskaan selvinneet pitemmälle. Ja syy oli selvä – ankara ilmasto, kuivuus, mahdottomuus pysyä hengissä esti Eurooppaan tulon.

Sitten tapahtui ilmastollinen käänne. Noin 52 000 vuotta sitten alkoi aikakausi jolloin ilmasto eteenkin Intian niemimaalla, Pakistanissa, nykyisessä Iranissa sekä Persianlahdella muuttui nykyihmisille edullisemmaksi. Sateet tekivät entisistä autiomaista vehreitä ja uomat täyttyivät vedestä. Monsuuni Intiassa oli voimakkaampi kuin nykyään. Tämä avasi vihdoin ja viimein Intian niemimaalla asuvien nykyihmisten tien kohti luodetta, kohti nykyistä Kaukasusta, Turkkia - Eurooppaa.

Eurooppaan ensimmäisenä saapuneet ihmiset eivät siis suinkaan olleet Lähi-Idän asukkaita vaan tarkalleen määriteltynä Pakistanin niemimaan asukkaiden jälkeläisiä. DNA-tulokset osoittavat tämän. Sama geenikartta on havaittavissa mm. Espanjan baskialueilla tai Balkanilla asujaimistossa kuin Intian niemimaalla. Eurooppaa asutettiin myöhemmin myös toisestakin suunnasta mutta ensimmäisten eurooppalaisten geenikartta viittaa selkeästä Pakistanin suuntaan.

Toinen Eurooppaan suuntautunut muuttoaalto tapahtui hieman toista kautta. Muuttovirta kulki Indus-joelta Intiasta kohti Kashmiria ja sieltä Keski-Aasian alueelle. Tästä tuloalueelta siirtyi n. 40 000 vuotta sitten metsästäjiä Eurooppaan. Mutta tässäkin tapauksessa Euroopan pohjoisosat jäi asuttamatta sillä ilmasto kylmeni n. 45 000 vuotta sitten. Jääkautta kestikin sitten joitakin suhteellisia lämpöjaksoja lukuun ottamatta peräti yli 30 000 vuotta. Vain etupäässä maanosan eteläpuolisko asutettiin.

Ja jotta Euroopan nykyinen väestö tietäisi juurensa vielä selkeämmin on geneettisestä taustasta havaittavissa sekin mitä kaikkien muuttoaaltojen kokonaissaldo kertoo: 80% muuttajista oli metsästäjä-keräilijä kulttuurin ihmisiä ja viljelykulttuurista tulleet (kaikkein myöhäisemmät tulijat) muodostavat tuskin viidettä osaa. Geneettisesti Eurooppa on intialais-pakistanilainen DNA-sukupuun haara. 

Stephen Oppenheimer:

 

Europa was genetic daughter of R ('Rohani'), who was genetic daughter of Nasreen, who was the genetic daughter of the out-of-Africa L3. By what route, however, did the Europa maternal clan arrive in the Levant, and where was her daughter U5, who colonized Europe, born? Both the N ('Nasreen') and Rohani root types are unknown except in South Asia, where Nasreen root types are found at low rates and Rohani is found in great variety. Most Rohani types in India are found nowhere else, and the great diversity of Rohani in India allows us to estimate when her line began to expand. This was at least 55,000 years ago, thus predating the arrival of Rohani's daughter Europa in the Levant and making a strong case for South Asia as the ultimate ancestral home of European lines. Even this expansion date is likely to be an underestimate of the age of the Rohani clan. Rohani may well be older than 55,000 years in Asia: much older estimates of the ages of two Asian subgroups of Rohani have been obtained in China.

 

Aasian ja Amerikan mantereet

 

Samoin kuin eurooppalaiset myös Aasian sisäalueiden asuttaminen lähti liikkeellä Pakistanin ja nykyisen Iranin alueilta. Liikkuminen noudatti vanhaa sääntöä: pysy vesistöjen lähellä, todennäköisten sadealueiden tuntumasta, vältä aavikkoja ja kuivia paikkoja, seuraa jokia ja pidä mielessä pelin säännöt. Vesistöä seuraamalla ja sieltä ravinnon ottamalla afrikkalaisten jälkeläiset siirtyivät tuhansia kilometrejä aina Kaakkois-Aasiaan, Kiinan rannikolle ja Australiaan asti. Samalla periaatteella asutettiin Aasian sisäosat n. 40 000-45 000 vuotta sitten.

Keskiajalla tutkimusmatkailija Marco Polo havaitsi pian sen millaiset esteet siirtymisellä Aasiassa oli olemassa. Siirtyminen Euroopasta Aasiaan kulki myöhemmin Silkkitienä tunnetun reitin kautta. Vastaavasti idästä länteen siirryttiin samaa reittiä. Burmasta kulki reitit Tiibetiin. Pohjoisin reitti tunnetaan Venäjällä Altain-väylänä. Siperian asuttaminen tapahtui väestöllä joka kuten Euroopankin oli metsästäjä-keräilijöitä. He eivät kromosomirakenteen perusteella kovinkaan paljon sitten eronneetkaan eurooppalaisista. Itse asiassa mammutinmetsästyskulttuuri alkoikin kukoistaa ensimmäisenä juuri kaukana Keski- ja Itä-Euroopassa, ei suinkaan Siperiassa. Aasian pohjoisempien osien asuttaminen tapahtui 25 000-30 000 vuotta sitten.

Evoluutiokehitys ja sopeutumien uusille alueille oli johtanut tilanteeseen jossa ihminen alkoi kyetä (tietyin reunaehdoin) liikkumaan hyvinkin kylmillä alueilla. Ja juuri tästä väestöstä polveutui ne jotka asuttivat myöhemmin viimeisen tyhjillään nykyihmisistä olevan mantereen – Amerikan. Ensimmäisessä vaiheessa asutettiin Alaskaa n. 22 000 -25 000 vuotta sitten. Koostuiko tämä joukko Aasian pohjoisosien monikielisistä, monimuotoisista, monivärisistä ryhmistä jotka sekoittuivat keskenään? Tuskinpa vain.

Beringin alueella ollut ryhmät olivat toisistaan erillään. Todellisuudessa näet Amerikan alkuperäiskansat ovat geneettisesti hyvin monimuotoista joukkoa. Tulivat samansuuntaista reittiä mutta lähtöalueet olivat täysin eri puolilta Aasiaa. Ainakin ryhmät A, B, C, D ja X on havaittu DNA-tutkimuksissa. Erilleen toisistaan nämä ryhmät myöhemmin asettuivatkin uudella mantereella asumaan. Viimeisimmän jääkauden ankarin vaihe ajoittui 18 000- 22 000 vuotta sitten. Amerikan alkuperäiset asukkaat asuivat kaukana toisistaan Alaskassa rannikolla, kolmas havaittu seutu on ollut USA:n Suurten Järvien pohjoispuolella. Missään muualla ei ollut asutusta. Mantereen eteläosien asuttaminen alkoi n. 15 000 vuotta sitten.

 

Euroopan pohjoinen puolisko – viimeinen periferia

 

Maapallon viimeiset tutkimattomat laajat alueet nykyihmisille löytyivätkin sitten jääkauden päätyttyä Euroopan pohjoisosista. Noin 30 000 vuotta sitten oli maanosassamme aiemmin asunut neandertalilainen ihminen kuollut sukupuuttoon, koska ei kyennyt kilpailemaan hitaana, huonona juoksijana nykyihmisille. Ne eivät osanneet metsästää aukeilla ja kun jääkausi vähensi metsien määrää Euroopassa joutuivat ne yhä enemmän eristyksiin syrjäisille alueille tuhoisin seurauksin. Niiden kommunikointi ja ryhmässä toimiminen ei ollut kehittynyttä. On kuvaavaa kuinka tämä Eurooppaa asuttanut ihmislaji oli perin vähän kyennyt kehittymään satojen tuhansien vuosien aikana verrattuna Afrikassa kehittyneeseen nykyihmiseen. Afrikka oli siis ihmisen evoluutiokehityksen kärjessä kun taas Eurooppaa asutti katoava ihmislaji. Maanosan pohjoisin osa olikin sitten se viimeinen periferia jonka ihminen asutti. Tämä tapahtui n. 8 000 -10 000 vuotta sitten.

 

Miksi olemme kaikki ”afrikkalaisia” vaikka näytämme niin erilaisilta?

 

Ihon epidermiksen melanosyytit tuottavat pigmenttijyväsiä, melanosomeja, joiden sisältämä melaniini erittyy keratinosyytteihin. Melanosyyttien määrä eriväristen ihmisten välillä on miltei vakio, mutta vaaleaihoisilla melanosomit ovat keskittyneet tyvikerrokseen, kun taas tummaihoisilla niitä löytyy kaikista epidermiksen kerroksista. Lisäksi vaaleaihoisilla melaniini hajoaa nopeammin lysosomaalisen toiminnan johdosta.

Nykyihminen (Homo sapiens) kehittyi trooppisessa Afrikassa mustaihoisena. Evoluutio on tuottanut vuosituhansien kuluessa vaaleamman ihonvärin, sopeuman oloihin, joissa auringon UV-säteilyä on vähemmän. Vaalea ihonväri on kehittynyt ihmisille vasta heidän vaellettuaan Afrikasta viileämmän ilmaston vyöhykkeille. Toisaalta geenipoolissa on säilynyt mahdollisuus ihonvärin tummentumiselle, kun ihmiset ovat vaeltaneet Beringinsalmen kautta Etelä-Amerikkaan takaisin päiväntasaajalle. Yleisesti ottaen päiväntasaajalta poispäin mentäessä auringonsäteilyn määrä vähenee ja ihmisten ihonväri vaalenee. Ihonväri on kehittynyt suojaamaan Auringon haitalliselta UV-säteilyltä ja foolihapon hajoamiselta, mutta silti sallimaan D-vitamiinin muodostumisen iholla auringonvalon vaikutuksesta. Vaaleaihoiselle ihmisille ihosyöpävaara on korkeampi päiväntasaajan seudulla, kun taas tummaihoinen voi kärsiä pohjoisen pimeydessä D-vitamiinin puutoksesta. Keskimäärin naisilla on hieman vaaleampi iho kuin miehillä, mikä voi johtua suuremmasta kalsiumin tarpeesta raskauden ja imettämisen aikana. Melaniini on ihon väriaine.

Ihonväri on myös yksi silmiinpistävimmistä ihmisen ominaisuuksista. Aiemmin ihmisiä on eroteltu ihonvärin perusteella eri rotuihin.

Tohtori Nina Jablonski on suorittanut vuosikymmenien aikana uraauurtavaa työtä ihonvärin evoluution tutkimisessa. Hän on päätynyt arvioon jonka mukaan tummaihoisen ihmisen ihonväri muuttuisi vaaleaksi muuttuneissa olosuhteissa 15 000 – 20 000 vuoden aikana. Evoluutio, siihen liittyvät monet valinnat (mm. seksuaalinen), monenlaiset ilmastolliset olosuhteet, ravinto, mutaatiot ym vaikuttavat myös ihonvärin sävyn ohella kasvonpiirteisiin. Tämä näkyy paitsi maapallolla eri puolin päiväntasaajaa myös esim. Afrikan sisällä.

Erittäin todennäköisesti eurooppalaisten ja itäaasialaisten vaaleaihoisuus on kehittynyt toisistaan riippumatta erilaisin geneettisin mekanismein. Vaaleaihoisuus johtuu muutamista geeneistä (mm. ASIP, MATP, TYR, OCA2 ja MC1R). Erityisesti geeni SLC24A5 säätelee eurooppalaisilla tumman melaniinin määrää ihossa. SLC24A5-geenistä on kuitenkin vaaleilla itäaasialaisilla ja tummilla afrikkalaisilla sama versio, joten se ei yksinään voi selittää kaikkea ihmiskunnassa esiintyvää vaaleaihoisuutta.

Eurooppalaiset ihmiset ovat maapallolla vaaleaihoisimpia. Mutaationopeuden arvioinnin perusteella eurooppalaisten SLC24A5-geeniversio on syntynyt todennäköisimmin 5 300–6 000 vuotta sitten ja aikaisintaan 12 000 vuotta sitten. Vaaleaihoisuudesta tuli etu maanviljelyn levitessä Lähi-idästä Eurooppaan. D-vitamiinia on eläintuotteissa, erityisesti kaloissa, maksassa, munissa ja maidoissa, mutta viljalla ja juureksilla elävän ihmisen täytyy valmistaa D-vitamiininsa itse ihossaan. Metsästyksestä siirtyminen maanviljelyyn vähensi eurooppalaisten D-vitamiinin saantia ravinnosta ja auringonsäteilyn aiheuttama D-vitamiinin tuotanto ihossa tuli entistä tärkeämmäksi.

 

Rotuteorian loppu

 

Ei ole koskaan ollut mitään "keltaista" tai "valkeaa" rotua. Rotu ei perustu biologiaan vaan ideologiaan ja kulttuuriseen jaotteluun. Tieteellisesti on osoitettu jo niin vakuuttavasti että kaikki Afrikan ulkopuolella asuvat ihmiset ovat yhden ainoan Afrikassa kerran asuneen "kantaäidin" jälkeläisiä että vanhoja rotuteorioita on turha enää ylläpitää 21. vuosisadan maailmassa. Se että olemme kaikki suorastaan ällistyttävän samanlaisia geneettisesti vaikka näytämme usein niin erillaisilta on afrikkalaisen exoduksen ja evoluution tulos. Kun katsomme itseämme peilistä voimme lukea samalla tämän ihmiskunnan huikeimman kansainvaelluksen ja luonnonvalinnan omista kasvoistamme.

 


( Päivitetty: 24.11.2012 10:39 )

 - pelontorjunta | Kommentoi



 ”Ihana” 1970-luku
01.11.2012 16:29 | pelontorjunta

 

Sana nostalgia tarkoittaa menneen ikävöintiä, kaihoa ja haikeutta. Nostalgiaan liittyy usein menneen, eteenkin nuoruuteen liittyneen aikakauden ihannointia. Sananmukainen merkitys sanalle nostalgia on koti-ikävä, kotimaan kaipuu. Se on johdettu kreikan kielen sanoista nostos, kotiinpaluu ja algos, tuska.

Ihmisillä on varsin yleisesti tapa huijata itseään muistamalla menneestä aikakaudesta vain sen valoisimmat puolet. Ominaisuus lienee evoluution tulos. Tuskin kukaan jaksaisi elää mikäli aivot muistuttaisivat entisajan synkistä, harmaista päivistä. Nykyisin niin usein toistettu termi ”positiivinen ajattelu” puolustaa paikkaansa sillä ihminen joka suhtautuu yleensäkin elämään myönteisesti on keskimääräistä onnellisempi ja myös selviytyy elämästä paremmin synkistelijöihin verrattuna. Hänen elämänlaatunsa on parempi ja hänelle siunautuu myös elinpäiviä enemmän kuin ns. valittajille.

Joskus nuorempana kuvittelin että sodanjälkeen syntyneet sukupolvet eivät sortuisi nostalgian helmasyntiin edellisten sukupolvien tapaan. Olin väärässä. Nyt ikääntyvät ns. suuret ikäluokat, sekä jopa heitä nuoremmat huokailevat menneen nuoruuden päiviin ja huijaavat itseään uskomaan noiden aikojen olleen muka riemukkaimmat, turvallisemmat, valoisammat ja jopa tasa-arvoisemmat kuin 2000-luvun uusliberalismin ja kiihtyvän eriarvoisuuden ajat. Yhä useammin kuulen väitteen jonka mukaan esim. 1970-luvulla Suomi olisi mukana elänyt eräänlaista Kekkosen Suomen renesanssiaikaa, jossa vain ehkä suomettuneisuus olisi ollut jonkinlainen kauneuspilkku. Nöyristelimme mutta siitä meille maksettiin hyvin ja näin ollen Kekkosen ajan ”menestyskertomus” on muuttunut myytistä todellisuudeksi niiden mielissä jotka elivät 1970-luvun. Tämä väite voidaan kuitenkin tutkia käyttämällä tilastotietoja vertailtaessa Suomea ja suomalaisten elämää 1970-luvulla ja elämää nyt 2010-luvun uusliberalistisessa Suomessa. Eräänlainen ajankuvaus 1970-luvun alun Suomesta oli dokumenttielokuva Perkele! Kuvia Suomesta (1971).

 

"Tukholma on Suomen neljänneksi suurin kaupunki"

 

Valitettavan yleinen on käsitys jonka mukaan ulkomaalainen on paras kuvailemaan Suomea ja suomalaisia. Ainakin se on mielenkiintoista vaihtelua, ellei muuta. Mutta kun sellainen henkilö, joka on perehtynyt dokumenttielokuvansa aiheeseen, on luvassa varmasti enemmän ajatuksia herättävä katselukokemus. Suomalaisia ja muunkin maalaisia ihmisiä, ihmissuhteita, yhteiskuntaa, politiikkaa ja ties mitä urallaan kuvannut Oscar-voittaja Jörn Donner oli vuosina 1970-1971 kuvatun Perkele! Kuvia Suomesta -dokumentin johtohahmo, vaikka ei tietystikään dokumentin ainoa luova tekijä. Hänen lisäkseen mukana olivat Jaakko Talaskivi ja Erkki Seiro.

Heti Perkeleen alusta lähtien on selvää, että sen tarkoituksena oli ennen kaikkea herättää keskustelua ja nostattaa tunteita. Se esittelee Suomen sellaisena, miten dokumentissa haastateltavat henkilöt sen näkevät; paskana maana, jossa ei kannata tehdä töitä, kun palkkaa ei tule tarpeeksi. Ruotsi on paljon mielenkiintoisempi paikka useiden haastateltavien mukaan. Vaikka filmin tekijät kuvasivat elokuvaansa vuoden ajan (maaliskuu 1970- tammikuu 1971) eri puolilla Suomea eivät he löytäneet kunnon syitä siihen, miksi asiat olivat tuolloin miten ne olivat. Sen sijaan he löysivät Tampereen teatterissa Shakespearen näytelmässä esiintyneen Tapani Pertun ja tivasivat häneltä, miksi teatterissa esitetään Shakespearea, kun komedia puree yleisöön paremmin. Lisäksi eräästä baarista he löysivät neidon, joka oli valmis makaamaan ilmeisesti varsin pienen kuvausryhmän jäsenten kanssa 200 markasta. Donnerin tyyliin tässä leikkaamattomassa versiossa ns. rakkauskohtaus on mukana.

Perkele! Kuvia Suomesta on kirjaimellisesti mustavalkoinen kuvaus Suomesta, joka on saattanut aikanaan nostattaa suuria tunteita, mutta joka ei tänä päivänä enää säväytä. Silti se ei ole missään nimessä huono, vaan pikemminkin mielenkiintoinen juuri siitä syystä, että nyt yli 40 vuotta filmin valmistumisen jälkeen voidaan verrata sitä, miten Suomi on muuttunut noista ajoista.

 

Suomalainen todellisuus – surkeat palkat, työttömyys, harmaa arki

 

Donnerin, Taalaskiven ja Seiron dokumenttielokuva kertoi maasta joka oli 1960-luvun lopussa ja 1970-luvun alussa täysin kykenenemätön työllistämään n. 100 000 ihmisen suuruisia suuria ikäluokkia. Kekkosen menestyskertomuksesta on silmiinpistävästi juuri tämä osa häivytetty taustalle. Tosiasiassa Ruotsi pelasti Suomen noina vuosina suorastaan helvetilliseltä yhteiskunnalliselta kaaokselta. Teollisuus, kauppa ja palvelut kykenivät työllistämään ehkä vain 70-80% uudesta työvoimasta vaikka poliittisella päätöksellä alettiin rakentamaan ns. hyvinvointi-Suomea julkisen sektorin kasvavine palveluineen. Vuonna 1967 Suomi joutui turvautumaan yli 30%:n devalvaatioon parantaakseen vientiteollisuuden kilpailukykyä. Työmarkkinasopimuksissa devalvaatiota ei koskaan täysin kompensoitu palkansaajille joten palkkojen osuus kansantulosta laski vuosikymmenen lopulla.

Tyypillinen suomalaisen työntekijän kuukausipalkka vuonna 1970 oli 500-1000 markkaa kuukaudessa. Tilastokeskuksen taulukko kertoo mitä suomalainen tuolla palkallaan sai.

 

Elinkustannusindeksi:

 

1970 223

1980 651

1990 1 248

2000 1 501

2010 1 751

2011 1 812

 

Palkansaaja joka tienasi esim. 500 markkaa kuukaudessa vuonna 1970 sai siis palkkaa jonka ostovoima vastasi vuonna 2011 n. 680 euron kuukausipalkkaa. Hän tienasi siis käytännössä sen mikä on tänään lähellä kansaneläkkeen perusosaa. Duunareiden aatelisto puolestaan tienasi vähemmän kuin kaupan alan kaikkein matalapalkkaisimmat työntekijät tänään. Myyjien palkat vuonna 2011 olivat reaalisesti selvästi paremmat kuin paperitehtaan duunarien palkat 40 vuotta sitten.

Vielä hätkähdyttävämpi on tilasto joka kertoo miten suuri osa palkasta meni esim. ruokaan 1970-luvun lopulla. Eräiden peruselintarvikkeiden hinnat euroina vuosina 1980 ja 2010:

 

Voi: 2,00 € (v. 2010 2,33 €)

Vehnäjauhot 2kg: 1,35 € (1,21 €)

Kahvipaketti: 2,60 € (4,25 €)

Jauheliha: 4,04 € (8,74 €)

Hienosokeri: 1,00 € (sama hinta)

Kananmunat: 1,82 € (3,25 €)

 

Useissa muissa peruselintarvikkeissa nimellishinnatkin nousivat hyvin vähän 1970-luvun lopulta tähän päivään verrattuna. Kun lapsiperheeseen osti äiti vaikkapa appelsiinin niin se usein syötiin porukalla, lohko sinulle, minulle ja hänelle. Palkansaajat maksoivat siis vain hieman vähemmän elintarvikkeista 1970-luvun lopulla kuin tänään mutta saivat esim. teollisuudessa keskimäärin 20,20 markan tuntipalkan (1980). Sen ostovoima vastaa tänään n. 9,13 euron tuntipalkkaa. Ja lisäksi vuosina 1970-79 oli niin teollisuuden kuin muidenkin alojen reaaliansiot sentään nousseet huomattavasti. Edes kiristyneellä verotuksella ei voida selittää näin huomattavia eroja. Verotuksella mahdollistettiin se, että kaikkein köyhimmät suomalaiset saivat 1970-luvun puolivälistä lähtien lapsilleen täysin ilmaisen perusopetuksen sekä lapsilleen ja itselleen perusterveyspalvelut. Niin – ja ilmaisen aterian. Progressiivinen verotus paransi selvästi 1970-luvulta lähtien juuri kaikkein pienituloisimpien kotitalouksien asemaa.

Palkan reaalisella ostovoimalla ja heikoilla sosiaalisilla palveluilla arvioituna 1970-luvun alun suomalaista duunaria voidaan verrata tänään vain niihin täysin rikollisilla asenteella toimiviin ulkolaisiin työnvälitysfirmoihin jotka käyttävät hyväkseen hädänalaisessa tilanteessa olevia köyhistä maista Suomeen tulleita pimeän työn tekijöitä. Se joka saa tänään työstään esim. 8 euroa tunnilta tekee yleisen arvion mukaan ”paskaduunia”. Tällä mitta-asteikolla lähes kaikki työntekijät ja osa toimihenkilöistäkin eivät tehneet 40 vuotta sitten mitään muuta kuin paskaduunia. Ruotsissa hän ansaitsi lähes kaksinkertaisen palkan ja sai paremmat sosiaalipalvelut.

 

”Räkää syövät rajaseutujen suurperheiden lapset”

 

Jos oli elämä harmaata, ankeaa ja etupäässä työssä puurtamista surkeilla palkoilla oli elämä suomalaisella maaseudulla vielä ankeampaa. Kaikesta maaseuturomantiikasta huolimatta oli suomalainen maaseutu 1970-luvun alussa (suurtiloja lukuun ottamatta) yhden sortin elävä helvetti tämän päivän arvoasteikolla. 1960-luvulle asti käytiin rajaseudulla taistelua täitä ja muita syöpäläisiä vastaan. Vielä 1970-luvun lopulle asti ei kaikkiin syrjäkylän mökkeihin tullut edes sähköä. Hämmästyttävän monissa maalaistaloissa ei ollut edes jääkaappia. Pyykkikone puuttui eteenkin pienissä mökeissä asuvilta. Astianpesukoneesta useimmat tuskin olivat kuulleetkaan. 1970-luvulle asti Itä- ja Pohjois-Suomessa eli perheitä jotka talvella pesivät pyykkiä avannoissa.

Juuri noilta ajoilta kerrottiin hiuksia nostattavia kertomuksia rajaseutujen ”räkää syövistä suurperheiden lapsista”. Koululuokissa heidät tunnista lehmän sonnan hajusta. Toisaalta eipä pikkukaupunkien vuokra-asunnoissa elämä ollut aina kovin hääviä. Useat vanhat vuosikymmeniä vanhat puutalot olivat lahoja paskoja joita usein lämmitettiin vain haloilla. Onnellinen se joka pääsi asumaan uusiin moskovalaistyylisiin harmaisiin betonilähiöihin. Niissä oli sentään lämmintä ja eikä lämpimän veden tulo kraanasta ollut uhattuna. Nämä nykyisin niin parjatut betonihirviöt olivat kuin taivaan lahja tuon aikakauden lapsiperheille.

Suomalainen maaseutu pysyi pystyssä vain tulosopimuksien avulla. Tehottomalla suomalaiselle maataloudelle mahdollistettiin korkeat tuottajahinnat. Laskun maksoi kaupunkilaiset. Kaikesta tästä iltalypsystä huolimatta maaseudun nuorison tulevaisuus oli kaupungeissa ja Ruotsissa. Vain aloitekyvyttömimmät ja alkoholisoituneimmat jäivät pientiloillensa. Maatilojen määrä on nykyisin enää 15% 40 vuoden takaisesta määrästä. Tästäkin huolimatta ei suomalainen maatalous kannata, eikä tule koskaan kannattamaankaan. Kiitos teknologisen kehityksen ei suomalainen maatalous ole enää kaupunkilaisillekaan sellainen kiviriippa kuin se oli 1970-luvun alussa.

 

Itsemurhia, juurettomuutta ja yhdenmukaistavaa tiedonvälitystä

 

Nykyinen ns. keltainen lehdistö ja iltapäivälehdet mässäilevät ankeilla yksittäistapauksilla suomalaisilla paikkakunnilla. Verrattuna 1970-luvun Suomeen ovat asiat kuitenkin menneet huomattavasti parempaan suuntaan. Itsemurhat ovat vähentyneet n. 40%:lla. Erityisesti suomalainen nuoriso näyttää voivan nykyisin selvästi paremmin kuin sitä edeltänyt. Suurilta ikäluokilta puuttui nykyiseen nuorisoon verrattuna kommunikointikyky. Kaikin osin he eivät sopeutuneet kaupunkioloihin vaan jostain käsittämättömästä syystä kaihosivat maaseudulle eteenkin siinä vaiheessa kun elintaso oli jo kohonnut niin paljon että ankea, harmaa lapsuus huuhtoutui jo mielistä. Maaseudun kaipuu näkyi lomakausina ruuhkana valtateillä. Avioerotilastojen huippua edustaa pariskunnat jotka menivät vihille vuonna 1975.

Huolimatta jälkijättöisestä teoriasta jonka mukaan maamme tiedostava nuoriso teki Suomesta kansainvälisemmän maan 1970-luvulla on syytä arvioida että väite ei pidä paikkaansa. Suomalainen kulttuurielämä ja suomalainen älymystö oli itse asiassa hämmästyttävän suomalaiskansallista tuona aikana. Tiedonvälitys oli äärimmäisen keskittynyttä. Radiossa ja tv:ssä oli aina 1980-luvulle asti vain kaksi kanavaa. Suomi eli ahtaassa YYA:n määrittelemässä viitekehyksessä. Ulkomaalaisia täällä oli tuskin edes nimeksikään. Tie Eurooppaan kulki interrailin kautta. Muualla Euroopassa Suomea pidettiin Neuvostoliiton satelliittina. Maamme silloinen älymystö teki kaikkensa jotta tuo eurooppalaisten näkemys olisi ollut mahdollisimman todenmukainen. Internet-aikakauden ihmisten on suorastaan mahdoton käsittää miten rajoittunut maailmankuva sittenkin 40 vuoden takaisella suomalaisella oli. Tieto on oli suorastaan kaivettava esim. Sex Pistolsin esiintyminen tv:n pääuutislähetyksessä tammikuussa 1978 muodosti monille tuon ajan nuorille suorastaan euforisen kokemuksen. Tuon lapsellisen kapinayhtyeen työluvan kielto alleviivasi koko 1970-luvun suomalaisen holhousmentaliteetin naurettavuuden.

Suomalaisen yrityselämän ja politiikan huipun muodostivat aina viime vuosiin asti suurten ikäluokkien kasvatit. Vasta heidän jälkeensä on huipulle alkanut nousta sukupolvi joka on jo juurtunut kaupunkilaiseen kulttuuriin ja jonka kyky kommunikoida kansainvälisesti on selvästi kehittyneempää kuin suurten ikäluokkien kasvateilla. He ovat suuria ikäluokkia selvästi kansainvälisempiä. On kaikki syy uskoa, että niin politiikan kuin yrityselämän johtamiskulttuuri parantuu. Koulutuksen taso on parantunut, nuorisomme on älykkäämpää kuin koskaan Suomen historiassa.

 

Kaipaako kukaan 1970-lukua?

 

Viime vuosina olen kuullut mainittavan kuinka 1970-luvusta on tulossa retroa. Jos tämä on totta, on syytä hämmästyä. Tuon aikakauden päävärisävyt olivat nimittäin musta, valkea ja harmaa. Se oli joko-tai- aikakausi. Joko olit puolellamme tai olit meitä vastaan. Ymmärrän toki tiedostavan nuorison asenteen. Maamme oli hyvää vauhtia jo 1930-luvulla ottamassa kiinni muiden eurooppalaisten sivistysmaiden etumatkaa taloudellisesti ja sosiaalisesti. Sota katkaisi kehityksen. Vuonna 1970 oli maamme vaurauden suhteen yhtä kaukana esim. naapurimaastamme Ruotsista kuin puoli vuosisataa aiemmin. Maamme väkiluku oli muuttotappion vuoksi jopa vähentynyt edellisvuonna. Näytti siltä että Suomi oli tuomittu olemaan ikuinen eurooppalainen periferia johon kaikki uudet aatteet, virtaukset sekä kehitys tulevat tuskastuttavalla viiveellä. Se sekä taistelu opiskelupaikoista ja työstä aiheutti tietynlaista kuohuntaa jossa oli aimo annos muiden länsimaiden apinointia. 1970-luvun taistolainen aate teki renessanssista suoranaisen parodian joka nykyisin aikaansaa lähinnä vain noloutta.

Toinen ihmeellinen väite on nykyisin se, että uskotaan että 1970-luvulta aina 1980-luvun loppuun olisi vallinnut eräänlainen suomalaisen hyvinvointivaltion kultakausi ja että 1990-luvun lama olisi kääntänyt kehityksen huonompaan suuntaa. Tosiasiassa maamme hyvinvointipalvelut ovat nyt selvästi monipuolisemmat ja laadukkaammat kuin ne olivat 1980-luvun lopulla. Ja 1970-luvun alun hyvinvointipalveluista puhuminen on jo huonoa pilaa tai osoitus dementiasta.

Olimmeko onnellisia 1970-luvulla? Jos vastaamme kielteisesti olemme uskottavia jo pelkästään taloudellis-sosiaalisten tosiasioiden perusteella. Tämän päivän mittapuun mukaan elämä vuoden 1970 Suomessa olisi suorastaan vastenmielisen harmaata. Tänään useat ihmiset tulisivat hulluiksi ilman internetiä, sosiaalista mediaa, joutumista elämään kansainvälisen Suomen sijasta kansallisessa Suomessa jonka yksitoikkoisuuden katkaisisi vain Paavo Noposen isänmaallinen selostus tai banaali Kanarian Saarten matka. Kuka kaipaa Suomea jossa opettaja huusi kuin hullu luokan edessä ja nolasi heikoimmat oppilaat? Kuka kaipaa koulun aamuhartauksia jossa seisottiin suorana riveissä ja joissa aina joku oksensi lattialle? Kuka haluasi elää olosuhteissa joissa puolet palkasta meni ruokaan ja suuri osa lopusta tympeän asunnon vuokraan, sähkölaskuun ja vesimaksuun. Ei puhettakaan ”shoppailusta”. Kaikkein parasta 1970-luvussa on sittenkin se, että se onnellisesti takanapäin. Siitä ei ole syytä tehdä yhtään onnellisempaa kuin se tosiasiassa olikaan. Syy miksi suuri osa suomalaisista saattoi silloin uskoa ”huomiseen” johtui siitä että kehitys oli ollut kohti parempaa Suomea vallalla jo sukupolvien ajan. On kuitenkin syytä torjua esim. kirjailija Heikki Turusen käsittämätön väite jonka mukaan 1960-luvun loppuun ja 1970-luvun alkuun sijoittunut aikakausi olisi ollut paras aika Suomessa. Turusen mukaan ennen 1960-luvun oli kaikesta ollut aina pulaa ja että 1970-luvun jälkeen kaikkea olisi ollut liikaa. Hän itkee sitä kuinka suomalainen maaseutu kuoli 1970-luvulla eikä muista sitä tuhansia vuosia vallalla ollutta tosiasiaa korkeissa kulttuureissa joissa ”kaikki lopulta muuttavat kaupunkeihin”.

Suomalainen menestyskertomuksessa ei ole mitään uutta ja ihmeellistä. Ihmiset ovat aina halunneet muuttaa pois maaseudun yksitoikkoisesta tylsyydestä kaupunkeihin muiden ihmisten seuraksi. Maaseudulla ja maaseutuhenkisillä paikkakunnilla ei nimittäin sanan varsinaisessa merkityksessä luoda mitään korkeampaa kulttuuria. Suomen ja suomalaisten onni on sen kaupungistumisessa ja kansainvälistymisessä. Se viime kädessä on jo tehnyt suomalaisista selvästi tasapainoisempia ja elämäänsä aidosti tyytyväisempiä kuin heitä edeltäneet suomalaissukupolvet. Menneisyyttä on aivan turha romantisoida.

 


( Päivitetty: 01.11.2012 16:51 )

 - pelontorjunta | Kommentit (2)Kommentoi



 Ihan tavallinen äärivasemmistolainen väärinkäsitys
13.09.2012 14:52 | pelontorjunta

 

Sotahistorian tutkija Jussi Jalonen on yhtenä harvoista suomalaisista käsittänyt ehkä parhaiten miksi presidentti Sauli Niinistön nuorten syrjäytymisen vastainen kamppanja on joutunut eteenkin maamme ”edistyksellisen” älymystön, ns. intellektuellien yleisen pilkan ja suoranaisen panettelun kohteeksi. Näin Jussi Jalonen:

”Presidentti Niinistön syrjäytymisen vastainen kampanja on herättänyt parin viime päivän aikana hieman hämmennystä. Tietyille tahoille presidentin projekti näyttää olevan herkkä ja aatteellisista syistä jalustalle nostettu asia. Osaltaan tätä kuvastaa käynnissä oleva dialogi EVA:n johtajan (Matti Apunen) ja tamperelaisen free-lance-toimittajan (Emilia Kuokkala) välillä. Asiaan on puuttunut myös Kokoomusnuorten virkaheitto puheenjohtaja (Wille Rydman). Väittely on noussut suorastaan maailmankatsomukselliselle tasolle, ja meneillään on todellinen henkien taistelu.

Niinistön kampanjan tavasta sivuuttaa sosiaalipolitiikka ja sitä koskevat aloitteet on kirjoitettu paljon, eikä minulla ole siihen oikeastaan mitään lisättävää. Kampanjassa on kiistatta puutteensa, ja toisin kuin vaikkapa presidentti Ahtisaari aikoinaan, on Niinistö selkeästi laiminlyönyt mahdollisuutensa käyttää arvovaltaansa poliittisiin aloitteisiin. Tästä huolimatta kampanjassa on kuitenkin myös ajatusta. Oivalsin itse eilen Pyynikillä ulkoillessani, että kriitikot ovat kenties katsoneet Niinistön kampanjaa osin väärästä perspektiivistä.

Tavallisia-sivuston evästyksiä on moitittu siitä, että ne ovat luonteeltaan keskiluokkaisia ja jättävät huomiotta syrjäytymisriskin alla olevan yhteiskunnan pohjakerroksen. Mielestäni tässä juuri on asian ydin. Niinistön ohjelma tunnustaa ongelmaksi suomalaisen porvariston rappion. Keskiössä on se tosiasia, että suomalainen keskiluokka -- siis vahvimmin Kokoomusta äänestävä kansanosa -- on laiminlyönyt jälkikasvunsa, ja tämä kanavoituu sitten hyvinvoivissa perheissä vallitsevana pahoinvointina.”

Suomalainen julkinen keskustelu kuvaa liian usein suomalaisten kyvyttömyyttä käydä keskustelua. Kansainväliset tutkimukset osoittavat suhteellisen vakuuttavasti että huolimatta maamme verrattain korkeasta koulutustasosta julkisista hyvinvointipalveluista on maamme yllättävän korkealla tasolla eräissä ikävissä tilastoissa. Tällä viikolla kirjoitti mm. Hufvudstadsbladet artikkelin jossa paljastui kuinka eräät osat Suomea ovat väkivaltatilastoissa jopa samalla tasolla kuin Afrikan maat. Mm. Lapin henkirikostilastot olivat korkeammat kuin Länsi- ja Keski-Afrikan maissa keskimäärin (rauhan oloissa). Tilastot voivat antaa virheellisiä tuloksia eri mittaustulosten luottavuuden vuoksi. On kuitenkin luultavaa että rikostilastoissa Suomi kuuluu pikemminkin korkean rikollisuuden itäeurooppalaisiin kuin länsieurooppalaisiin maihin. Koska sosiaalipolitiikkaamme ei voi haukkua EU:n surkeimmaksi ja koulutustamme kehutaan kaikkialla on synkät tilastot nähtävä sittenkin kulttuurimme taustoista tai jopa geneettisen perimän kautta.

Eräissä tutkimuksissa on todettu esim. itä- ja pohjoissuomalaisissa olevan matalan verensokeripitoisuuden tason sekä matalan serotoniinituotannon verrattuna maan länsiosassa asuviin. Kun tällaiset ihmiset nauttivat runsaasti alkoholia kasvaa riski äärimmäiseen väkivaltaiseen käyttäytymiseen. Suomen väkivaltatilastot ovat 2-3 kertaa korkeammat kuin muissa pohjoismaissa. Lappi, Kainuu ja ja Pohjois-Karjala ovat maakuntina maamme väkivaltaisimmat. Vähiten väkivaltaa on länsirannikon ruotsinkielisillä seuduilla. Amerikkalaistutkimus on paljastanut sen kuinka lapsi jolle ei ole luettu pienenä kirjoja joutuu muita selvästi useammin väkivaltaisiin tilanteisiin. Tämän selitettiin johtuvan siitä että hänen heikko verbaalinen taito ja verbaalinen ymmärrys johtaa fyysiseen reaktioon verbaalisen kommunikoinnin sijasta.

On vaikea sanoa luetaanko suomalaisille lapsille kirjoja nykyisin enemmän tai vähemmän kuin ennen. Hyvällä koulutuksella voidaan ennaltaehkäistä syrjäytymistä mutta tämä onnistuu tietenkin vain jos oppilas itse on motivoitunut koulunkäyntiin ja opiskelua on jo kotona motivoitu. Lapsi suhtautuu myönteisesti koulunkäyntiin jos hänen vanhempansa arvostavat koulunkäyntiä. On melkoisen uskottavaa olettaa, että suomalaisten vanhemmat arvostavat keskimäärin enemmän koulutusta 2000-luvulla kuin vaikkapa vuosisata sitten.

Kaikki ei ole kuitenkaan hyvin suomalaisissa perheissä. Ei näin hyvien taustatekijöiden (koulutukseen ja sosiaalipalveluihin panostaminen) vallitessa pitäisi näin huomattavaa syrjäytymistä olla. Syitä on etsittävä suomalaisten kulttuurisista taustoista, joihin voi myös vaikuttaa tietyt geneettiset ominaisuudet. Voisiko syyt olla kulttuurisessa arvomurroksessa, joita ruokkivat mm. mainitut geneettiset ominaisuudet suomalaisissa (eteenkin itä- ja pohjoissuomalaisissa)?

Kysymyksiä voidaan esittää lisää. Miksi kaikesta ”vapautumisesta” huolimatta suomalaisten juomakulttuuri on primitiivistä ja jopa brutaalia? Miksi suomalaiset paljastuvat esim. yritysmaailmassa kyvyttömiksi kommunikointiin ja muita yleisemmin suosivat - kuten politiikassakin - ”ainoan vaihtoehdon” toimintaperiaatetta? Puuttuuko suomalaisilta yleisesti uskottava kyky aitoon yhteisöllisyyteen sekä elämäniloon?

Näitä kysymyksiä on syytä esittää muistaen maamme nykyisin korkean elintason sekä kehutun koulujärjestelmämme. Jostakin kertoo sekin, että maamme on lasten kasvatuksen suhteen epäonnistunut siitäkin huolimatta vaikka meillä on enemmän kasvatustieteen ammattilaisia kuin muilla pohjoismailla yhteensä. Vai olisiko kasvatustieteen ammattilaistemme todellinen tieteellinen taso kyseenalaistettava? Tuskin.

On luultavaa että nopeasti 1900-luvulla vaurastunut Suomi on mennyt toivottoman köyhyyden kautta eurooppalaiseen vaurauteen uhraamalla tiettyjä asioita mammonan alttarille. Jussi Jalonen saattoi osua lähelle napakymppiä todetessaan presidentti Niinistön nuorten syrjäytymisen vastaisen kampanjan kuvastavan juuri ahdinkoon joutuneen keskiluokkamme (porvaristo) ongelmista. Suomessa on USA:n jälkeen OECD-maiden korkeimmat avioerotilastot. Suomalainen keskiluokkainen ”porvarillinen idylli” muuttuu iltapäivälehtiemme lööpeissä kauhutarinoiksi kun ”onnellisen perheen” isä tappaa vaimonsa, lapset ja lopulta itsensä koska ei kyennyt nousemaan ylös umpikujastaan. Emansipoitunut suomalainen nainen, tämä ”sisko”, näyttää lähtevän lisääntyvässä määrin samalle örveltämisen tielle toteuttamaan itseään. Keskiluokan elämä lähiön omakotialueella saattaa näyttää pintapuolisesti varsin mainiolta idylliltä. Mutta liian monissa tapauksissa näistä perheistä näyttää puuttuvan ne ns. henkiset arvot, korkeamman kulttuurin harrastuneisuus. Puheet ”laatuajasta” jota annetaan lapsille kertovat juuri lasten laiminlyönnistä.

Niinistön työryhmän aikaansaannoksien pilkkaaminen eteenkin kulttuuriväen (kulttuurivasemmisto?) taholta ei ainakaan paranna asiaa. Elämässä on nimittäin olemassa joitakin perusasioita, joita vanhempien olisi syytä opettaa lapsille. Matti Apunen:

”Miten Vinon vaatimat ”poliittiset päätökset” parantavat sen lapsen elämää, joka on sotkenut päivärytminsä ja samalla koulunkäyntinsä? Millaisen armeijan sosiaalityöntekijöitä tarvitsemme ovien taakse päivystämään ja valvomaan, jos vanhempien ja sukulaisten jokapäiväiset keinot ovat mitättömiä ja naurettavia?”

Vaikuttaa siis siltä, että äärivasemmistolainen kulttuurieliittimme on masinoinut presidentin työryhmän vastaisen myrskyn vesilasissa koska ei tajua että työryhmä puuttuu ”ihan tavallisissa asioissa” etupäässä juuri keskiluokan ongelmiin, joiden taustat löytyvät suomalaisesta latteasta keskinkertaisuudesta, jolla on ehkä komeatkin kulissit – hieno omakotitalo, katumaasturi sekä jokavuotinen sosiaalidemokraattinen tasapäistävä Kanarian Saarten unelmaloma – mutta jonka perheen elämänsisältö on murentumassa piinaavaan harmauteen sekä kalvavaan pelkoon koko kulissin romahtamisesta. Myös Suomessa on keskiluokka joutumassa globalisaatioaseen kiikaritähtäimeen. Suomessa tilanteen tekee vielä tukalammaksi se, että uhrilampaista liian monet ovat rakentaneet maailmankuvansa ja ihanteensa muulle kuin kulttuurin pohjimmaisille tavoitteilla: pyrkimykseen totuuteen, hyvyyteen ja kauneuteen. Kymmenet tuhannet keskiluokan lapset ovat tiedostaneet tämän elämänmuodon onttouden ja kulissimaisuuden. He oirehtivat. Siksi presidentti reagoi ja niin teki älymystömme vasemmistolaisin fragmentti, sillä heidän pahoinvointiteesinsä tulevat Karl Marxin ajattelumaailman perspektiivistä eli keskittyvät yhteiskunnan alaluokkaan. Presidentti kyllä tiesi, että todella köyhien lapsiperheiden ongelmaan tarvitaan selvää rahaa. Sen lisäksi hän tiesi, että keskiluokan lasten kriisiin ei rahan syytäminen tepsi. Heidän ongelmansa keskipisteestä löydämme länsimaisen kulttuurin rappion, mammonan ja kiimaisen kilpailukyvyn ylikorostamisen kovan hinnan.


( Päivitetty: 08.10.2012 13:28 )

 - pelontorjunta | Kommentoi



 "Vietnamin syndrooma" - media, myytit ja todellisuus
16.04.2012 19:25 | pelontorjunta

(Kuva. Scott Camil vas.ylh, Charles Stephens oik.ylh, Murphy Lloyd vas.alh, Evan Haney oik.alh, Martin Luther King ylh.kesk ja Norman Morrison alh.kesk)

On jokseenkin satoja kertoja todistettu että kansakunnan manipulointi puolustamaan sotaa on huomattavan helppoa vallanpitäjille. Yhtä selvä asia on, että kansakunta kääntyy sitä sodanvastaisemmaksi mitä pitemmän aikaa sota kestää ja mitä enemmän siviilit saavat informaatiota esimerkiksi sodasta palaavilta sotilailta.

Tämän vuosituhannen alun ihmisiä saattaa tosiasiassa hämmästyttää se, kuinka pitkään lopulta meni ennen kuin USA:n väestön selvä enemmistö kääntyi Vietnamin sotaa vastaan. Ero esim. Irakin sotaan on huikea. Vuoden 2003 alussa, ennen amerikkalaisten hyökkäystä Irakiin, USA:ssa oli jo sangen laaja sodanvastainen vähemmistö, maailmalla laaja enemmistö. Enemmistö amerikkalaisista vastusti Irakin sotaa jo siinä vaiheessa kun amerikkalaisuhrien määrä laskettiin muutamassa tuhannessa. Vietnamin sodassa enemmistö väestöstä kannatti sotaa vielä siinä vaiheessa kun amerikkalaisia oli jo kuollut n. 25 000. Käänne tapahtui vuonna 1968. Silloin amerikkalainen suuri yleisö ensimmäisen kerran laajalti alkoi kyseenalaistamaan maan Indokiinan politiikan ja sodan oikeutuksen. Jotain hyvin ratkaisevaa tapahtui. Mikä saa aikaan muutoksen?

Suurelle yleisölle on jäänyt Vietnamin sodan vastaisesta liikkeestä kuva eräänlaisena valkoisen opiskelevan nuorison joukkoliikkeenä. Samoin Indokiinan sodan jälkeen USA:n poliittinen eliitti ja media pyrki luomaan kuvan, jossa maa irrottautui sodasta pääasiassa taloudellisten syiden vuoksi. Sota varmaankin rasitti USA:n taloutta, mutta verrattaessa maan puolustusbudjettia Vietnamin sodan aikaan maan bruttokansantuotteeseen ei se ollut korkeampi kuin kylmän sodan vuosina yleensäkään. USA veti taistelujoukkonsa Vietnamista käytännössä vuoden 1972 lopulla. Vajaa vuosi myöhemmin käyty Israelin ja arabimaiden ns. Jom Kippur-sota seurauksineen aiheutti tuntuvan energian kallistumisen. Yhdessä harjoitetun yleisen inflatorisen politiikan seurauksena maailmantalous syöksyi ensimmäiseen tuntuvaan lama-aikaan sitten II maailmansodan vuonna 1974. Mutta niin kauan kuin USA kävi taistelujoukoilla sotaa Indokiinassa ei ollut erityisiä taloudellisia miksi USA:n olisi pitänyt irtautua sodasta. Todelliset syyt olivat siis jossain muualla.

 

Myytti ääripatrioottisesta amerikkalaisesta työväestöstä

 

Sodanvastaisuus kasvoi Yhdysvalloissa asteittain. Monet unohtavat myös sen että Washingtonin hallinto tutki kaikenaikaa mielipideilmastoa väestön keskuudessa. Ja tutkimukset paljastivat kiinnostavia asioita. Vastoin yleistä luuloa sodanvastaisuus oli kaikkein voimakkainta erityisesti sodan alkuvuosina maan afroamerikkalaisten, muiden etnisten vähemmistöjen, matalapalkkaisen työväestön, naisten ja yli 50-vuotiaiden keskuudessa. Sodan innokkaimmat kannattajat löytyivät puolestaan valkoisen hyvätuloisen väestönosan keskuudesta. Mitä korkeammin koulutettu väestö, sitä todennäköisemmin se kannatti sotaa. Ja innokkaimpia sodan kannattajia olivat valkoiset hyvin koulutetut nuoret ihmiset.

Julkisuus antoi mielenosoituksien kautta usein vaikutelman että sotaa vastustivat etupäässä keskiluokan intellektuellit. Kun New Yorkin eräät (harvat) rakennusalan työntekijät hyökkäsivät opiskelijamielenosoittajia vastaan, esitettiin uutisfilmiä innokkaasti eri puolilla maata useilla tv-kanavilla. Kuitenkin lukuisissa kaupungeissa joissa asui poikkeuksellisen paljon työväestöä, oli sodanvastaisuus voimakasta. Esimerkiksi autoteollisuudestaan tunnetussa Dearbornissa Michiganissa kannatti 41% kaupunkilaisista jo vuonna 1967 USA:n sotajoukkojen vetämistä Vietnamista. Valtakunnallisesti vetäytymistä kannatti tuohon aikaan vain n. 25% amerikkalaisista. Keväällä 1971 Madisonin teollisuuskaupungin äänestäjistä 65% vaati amerikkalaisjoukkojen vetämistä välittömästi Indokiinasta.

Patrioottisen duunari-USA:n myytin kumoaa jo sodan alkuaikoina vuonna 1966 tehty Michiganin yliopiston tutkimus. Sen mukaan 27% lukion käyneistä amerikkalaisista oli sitä mieltä, että USA:n pitäisi vetää välittömästi joukkonsa Vietnamista. Vain peruskoulun käyneiden keskuudessa välitöntä vetäytymistä kannatti sen sijaan jo 41% vastanneista.

American Social Reviewissä vuonna 1968 julkaistussa artikkelissa Richard F. Hamilton teki samoja havaintoja. Mieltymys kannattaa voimapolitiikkaa on yleisintä seuraavissa väestönryhmissä: korkeasti koulutetut, niillä joilla on korkean statuksen ammatti, joilla on korkea tulotaso, nuoremmat ihmiset sekä sanoma- ja aikakauslehtiä paljon lukevat. Harlan Hahn, poliittinen tutkija, havaitsi ilmiön useissa kaupungeissa tehdyissä tutkimuksissa: matalan tulotason väestö kannatti muita enemmän USA:n asevoimien nopeaa vetäytymistä Vietnamista. Bruce Andrews, yleistä mielipidettä tutkiva opiskelija Harvardissa,  havaitsi selvän ilmiön niissä jotka vastustivat sotaa: he olivat afroamerikkalaisia, naisia ja yli 50-vuotiaita. Jo niinkin aikaisessa vaiheessa kuin 1964, jolloin Vietnam oli vielä pieni uutinen mediassa,  lukion käyneiden keskuudessa valmius lähettää joukkoja Vietnamiin sai 53%:n kannatuksen kun taas vain peruskoulun käyneiden keskuudessa kannatus oli vain 33%.

 

Hyvätuloisten, korkeasti koulutettujen sota?

 

Tutkimukset näyttävät siis osoittavan korkean tulotason ja korkean koulutuksen lisänneen alttiutta kannattaa amerikkalaisten sotaa Vietnamissa. Korkean koulutuksen ja korkean elintason väestö lukee sanoma- ja aikakausilehtiä muuta väestöä enemmän. Näytti siltä, että media, jonka toimittajat ja johto koostui juuri korkeasti koulutetuista ja suhteellisen hyvätuloisista (valkoisista) amerikkalaisista itse muokkasi hallinnon luomaa kuvaa siitä ketkä olivat sodanvastaisia ja ketkä ”yltiöisänmaallisia”. Media loi kuvan äärimmäisen patrioottisesta amerikkalaisesta duunarimiehestä ja toisaalta pasifistisesta ylemmän keskiluokan intellektuelleista. Tosiasiassa duunarit, afroamerikkalaiset ja etelävaltioiden köyhät valkoiset vastustivat enemmän sotaa kuin hyvätuloiset keskiluokkaiset valkoiset amerikkalaiset.

Lisäksi tutkimukset näyttävät viittaavan siihen, että korkeasti koulutetut ja valtamediaa enemmän seuraavat näyttivät muita herkemmin uskovan USA:n hallinnon viralliset liturgiat Vietnamin sodan päämääristä ja perusteista. Median kritiikittömyys ja toimittajien henkinen laiskuus sodan taustojen, syiden ja seurausten kriittiseen tutkimiseen oli sidoksissa toimittajien yhteiskunnalliseen asemaan, koulutukseen ja arvoihin. Vaikka monet luulevat toimittajakunnan kunnostautuneen Vietnamissa analysoidessaan tapahtumia kriittisesti niin totuus oli hyvin päinvastainen. Toimittajat toistivat maan poliittisen johdon virallisia teesejä hämmästyttävän uskollisesti ällistyttävän myöhäiseen vaiheeseen asti. Oikeastaan mediaväki yhteiskunnallisen taustansa, koulutuksensa ja arvojensa takia, joitakin harvoja toimittajia lukuun ottamatta, oli yhtenä viimeisistä ryhmistä puoltamassa sotaa kun enemmistö amerikkalaisista oli jo kääntynyt mieletöntä tuhoamista ja tappamista vastaan. Sikäläinen media toimi siis enemmän vallan sylikoirana kuin vahtikoirana.

 

Afroamerikkalaiset ja kansalaisoikeusliike

 

Mustien kansalaisoikeusliikkeen jo 1950-luvulla aloittama taistelu afroamerikkalaisten kansalaisoikeuksien puolesta rasismia ja diskriminointia vastaan ei voinut olla näkymättä myös Vietnamin sodan vastustamisessa. Afroamerikkalaisia sotilaita näkyi taistelukentillä enemmän kuin muissa aiemmin USA:n käymissä sodissa. Kutsuntajärjestelmä sekä mm. tuomioistuinten pyrkimys painostaa sosiaalisissa ongelmissa olevia nuorukaisia asepalvelukseen sovittamaan mahdollisia tuomioita johti juuri vaatimattomista olosuhteista kotoisin olevien valkoisten, mustien ja latinoiden suureen osuuteen taistelujoukoissa. USA:n Vietnamissa kaatuneiden sotilaiden tilastoissa vähemmistöjen sekä pienituloisten ihmisten osavaltioiden (esim. etelävaltiot) nuorison osuus painottuu selvästi.

Jo sodan alkuvaiheessa oli olemassa juopa kansalaisoikeusliikkeen ja maan hallinnon välillä. Presidentti Johnsonin teesi elokuussa 1964 kohtasi mustien todellisuuden kotimaassa. Kun presidentti ilmoitti tapahtumista Tonkinin lahdella kokoontui joukko mustia ja valkoisia kansalaisoikeusliikkeen jäseniä Philadelphiaan Mississippiin muistamaan aiemmin murhattuja kolmea kansalaisoikeusliikkeen työntekijää. Yksi puhujista vertasi katkerana Johnsonin harjoittamaa väkivaltaa Pohjois-Vietnamia kohtaan siihen mitä mustat olivat kokeneet Mississippissä:

Kenenkään Mississippin neekerin ei pitäisi taistella Vietnamissa valkoisen miehen vapauden puolesta ennen kuin Mississippin neekerit ovat vapaita...

Mississippin poikien ei pitäisi kunnioittaa kutsuntoja täällä. Äitien pitäisi rohkaista poikiaan olemaan menemättä...

Kenelläkään ei ole oikeutta vaatia meitä riskeeraamaan elämäämme ja mennä tappamaan toisia värillisiä ihmisiä Santo Domingoon ja Vietnamiin, niin että valkoinen amerikkalainen voi tulla yhä rikkaammaksi...”

Kun puolustusministeri McNamara vieraili Mississippissä ja ylisti senaattori John Stennisiä, merkittävää paikallista rasistia, hänen ”ainutlaatuisen suuruutensa takia”, mustat ja valkoiset opiskelijat marssivat mielenosoituksessa kantaen kylttejä joista yhdessä luki: ”poltettujen vietnamilaisten lasten muistoksi”. Georgian osavaltiossa kuusi Vietnamin sotaa vastustanutta SNCC:n aktiiveja vangittiin kesällä 1966 ja tuomittiin useaksi vuodeksi induktiokeskukseen tehdyn hyökkäyksen vuoksi. Saman osavaltion edustajahuoneeseen valittu SNCC:n edustaja Julian Bond puhui avoimesti sotaa ja kutsuntoja vastaan niin että hänen toimintansa edustajahuoneessa estettiin. Korkein oikeus palautti hänen edustajahuoneen asemansa perustellen että Bondilla on perustuslaillinen oikeus lausua mielipiteensä.

Kansalaisoikeusliikkeen johtaja Martin Luther King vastusti alusta lähtien sotaa. New Yorkin Riversiden kirkossa vuonna 1967 pitämässään puheessa hän totesi:

Jotenkin tämän hulluuden on loputtava. Meidän on se lopetettava. Puhun Jumalan lapsena ja kärsivien vietnamilaisten veljenä. Puhun niiden puolesta joiden maat on hävitetty, kodit tuhottu ja kulttuuri kukistettu. Puhun köyhien amerikkalaisten puolesta, jotka maksavat kaksinkertaisen hinnan kotimaassa murskatuissa toiveissa sekä Vietnamin kuolemassa ja rappiossa. Puhun maailmankansalaisena maailman puolesta tyrmistyneenä siitä tiestä jolla olemme. Puhun amerikkalaisena maamme johtajille. Aloite on meillä. Se aloite on sodan lopettaminen. ”

 

Sotilaat

 

Sitä mukaa kun sodassa palvelleita sotilaita palasi Vietnamista (yleensä palvelusaika oli miehillä noin yksi vuosi) alkoi väestön keskuuteen kantautua hälyttäviä tietoja Vietnamin sodankäynnistä ja luonteesta. Vielä alkuvuosina kotiin palanneita yritettiin toisen maailmansodan hengessä juhlia sotasankareina ainakin lähipiirissä. Varsin pian veteraanit kuitenkin havaitsivat että sodasta ja sen luonteesta oli väestön enemmistöllä täysin väärä käsitys. Lisäksi kulutusyhteiskunta näytti vähemmän edes kiinnostuvat henkisesti pahasti traumatisoituneista sotilaista. Suurin osa Vietnamissa palvelleista sotilaista ei tosin ollut varsinaisissa taistelujoukoissa palvelleita joten heillä ei saattanut olla henkilökohtaisia pahoja kokemuksia itse taisteluista. Mutta lähes kaikki näkivät sodan todellisen luonteen.

Useimmat sodasta palanneet sotilaat kertoivat sotilaiden yleisen suhtautumisen esim. vietnamilaisiin olleen hyvin ylimielisen, rasistisen ja törkeän. Kysymys ei ollut vain vihollistaistelijoista.

William Hatton palveli merijalkaväen 3.divisioonassa ja kertoi tuhansien muiden veteraanien tavoin kuinka

...teimme kaikkemme tehdäksemme kaikista vietnamialaisista ali-ihmisiä ja nöyryyttäksemme heitä...”

 

Kenneth Campbell, merijalkaväen 1.divisioona:

...kaikki vietamilaiset olivat 'vinosilmiä' [engl. 'gooks']... Me ajattelimme olevamme sivistyneitä ihmisiä, amerikkalaisia,...emme välittäneet paskaakaan noista ihmisistä...”

Sodassa paljastui koko se amerikkalainen eetos, ylemmyydentunne, törkeä rasismi ja täydellinen empatian puute Vietnamin tapaisen kehitysmaan värillistä väestönosaa kohtaan. Ilmiö oli tuttu jo 1800-luvun Amerikan asuttamisessa ja sodassa intiaaneja vastaan. Virallinen Amerikka puhui ”sydänten ja mielten voittamisesta Vietnamin kansan keskuudessa”, mutta sotilaiden, upseerien ja ylempien komentajien suhtautuminen on täysin toinen. Kyseessä oli imperialistinen sota rodullisesti alempiarvoiseksi koettujen vietnamilaisten maassa, sillä asevoimat alkoivat jo aikaisessa vaiheessa nähdä periaatteessa kaikki vietnamilaiset, jos ei vihollisina, niin ainakin potentiaalisina vihollisina. Pian ei ollut mitään väliä oliko tapettu vietnamilainen vihollinen, myötämielinen tai neutraali ihminen.

Eteenkin taistelujoukoissa palvelleet ja sodan tuhoja läheltä seuranneet sotilaat tulivat enemmän tai vähemmän traumaattisena sodasta. Kotona kulutusyhteiskunta ei pienen tervetulotoivotuksen ja lattean ”wellcome-back-to-home-heroe”-juhlan jälkeen juuri ollut kiinnostunut nuorista miehistä, jotka olivat kokeneet jotain aivan kamalaa sodassa, jonka motiivit alkoivat tuntua yhä kummallisimmilta. Tuhannet eivät yksinkertaisesti voineet olla hiljaa. Ja koska suuri osa ihmisistä ei tosiasiassa käsittänyt tilanteen vakavuutta, jäivät veteraanit "tyhjän päälle".

Oli kuitenkin yksi ryhmä joka ei suhtautunut välinpitämättömästi sodasta palanneisiin veteraaneihin – USA:n kasvava Vietnamin sodan vastainen rauhanliike. Vasta sodasta palattuaan kymmenet tuhannet entiset sotilaat alkoivat vähitellen hahmottaa koko sodan asetelmaa. Monet heistä vertasivat itseään Vietnamissa koulukirjoissa mainittuihin Yhdysvaltojen vapaussodan englantilaisiin ”punatakkeihin” eli siirtomaaisännän sotilaisiin. Vapaustaistelijat löytyivät vihollissotilaista.

Juuri valtaväestön passiivisuus, naiivius ja toisaalta rauhanliikkeen aktiivien halukkuus käydä jopa kärjekästä mutta reilua keskustelua veteraanien kanssa käänsi kotiin palanneiden asenteita. Aiemmin hyvinkin patrioottisesti sotaan suhtautuneet nuoret miehet muuttuivat sodan kyseenalaistajiksi, inhoajiksi, vastustajiksi. Rohkeimmat ja ne joiden oli kertakaikkisesti oman mielenrauhansakin takia pakko puhua ”suunsa puhtaaksi” puhuivat. Viikko toisensa jälkeen, jopa päivittäin, alkoi sanomalehtiin ja uutiskanaviin ilmestyä entisiä sotilaita, jotka kertoivat mitä olivat kokeneet. Heidän kokemuksensa olivat kauhistuttavaa luettavaa. Eräät kertoivat avoimesti tappaneensa naisia, lapsia ja vanhuksia sekä polttaneensa näiden kylät. Ja kun yksi puhui, alkoivat muutkin puhua. Suuri yleisö alkoi varsinkin käänteentekevänä vuonna 1968 miettiä ensimmäisen kerran Vietnamin sotaa uudessa valossa. Jotain aivan ratkaisevaa oli tapahtumassa.

 

Mitä maan poliittinen johto todella pelkäsi?

 

Lyndon Johnsonin jälkeen USA:n presidentiksi valittu Richard Nixon ilmoitti suurelle yleisölle oman sodan ”vietnamisointiohjelmansa” yhteydessä usein, ettei hänen päätökseensä yleinen mielipide ja vielä vähemmän maan rauhanliike vaikuttanut yhtään. Päätös asteittaisesta joukkojen vetämisestä Vietnamissa perustui Nixonin mukaan aivan toisiin syihin. Ja tätä Washingtonin virallista näkemystä maan media ja koko muut poliittinen koneisto säesti innokkaasti. Tämä teoria ei kuitenkaan kestä kriittisempää tarkastelua.

Rauhanliikkeen, sodasta palanneiden veteraanien yhteistoiminta sekä mustien kansalaisoikeusliikkeen painoarvo alkoi kasvaa voimakkaasti Vietnamin sodan suuresta käännekohdasta, vuodesta 1968 lähtien. Mutta jo sitä ennen olivat viranomaiset panneet kasvaneella huolella eräitä aluksi yksittäisiä mutta myöhemmin yhä laajemmalle levinneitä ilmiöitä.

Marraskuun 2.päivänä 1965 valeli Norman Morrison, 32-vuotias pasifisti ja kveekari, itsensä polttoaineella ulkoministeri Robert McNamaran työasunnon edustalla ja sytytti itsensä tuleen ilmaisten tällä tavalla vastustuksensa Vietnamin sodalle. Samana vuonna 82-vuotias Alicy Hertz teki saman Detroitissa ”niiden kauhujen vuoksi joita Indokiinassa tapahtui”. Molemmat tapahtumat herättivät huomiota mutta eivät vielä vaikuttaneet paljon yleiseen mielipiteeseen.

Sotilaiden keskuudessa sodanvastuisuus kasvoi aluksi yksittäistapauksista massiiviseksi ilmiöksi. Joitakin esimerkkejä. Kesäkuussa 1965 kieltäytyi eräs Richard Steinke-niminen West Pointin upseerikoulun suorittanut sotilas astumasta lentokoneeseen, joka olisi vienyt hänet kaukaiseen vietnamilaiseen kylään. ”Vietnamin sota ei ole yhdenkään amerikkalaisen sotilaan hengen arvoinen”, hän totesi kuulusteluissa. Hänet joutui sotaoikeuteen ja erotettiin armeijasta. Seuraavana vuonna kolme sotilasta: yksi afroamerikkalainen, yksi puertoricolainen ja yksi liettualais-italialaista syntyperää oleva kieltäytyivät lähtemästä Vietnamiin koska tämä sota oli heistä ”moraalitonta, laitonta ja epäinhimillistä”. Heidät tuomittiin sotaoikeudessa.

Alkuvuonna 1967 armeijan lääkintäkapteeni Howard Levy Etelä-Karolinasta kieltäytyi opettamasta ”vihreille bareteille”. Levyn mukaan vihreät baretit olivat ”naisten ja lasten murhaajia” ja ”talonpoikien tappajia”. Hänet haastettiin sotaoikeuteen koska hän ”levittää tyytymättömyyttä väitteillään sotilaiden keskuuteen”. Eversti, joka johti oikeudenkäyntiä totesi, että ”väitteiden todenperäisyys ei ole mikään peruste tässä oikeudenkäynnissä”. Levy tuomittiin vankilaan.

Yksittäiset teot seurasivat toisiaan. Afroamerikkalainen sotilas kieltäytyi Oklandissa nousemasta lentokoneeseen, joka olisi vienyt hänet Vietnamiin. Hänet tuomittiin 11 vuodeksi pakkotyöhön. Laivaston luutnantti sairaanhoitaja Susan Schnall haastettiin sotaoikeuteen, koska oli marssinut rauhanmielenosoituksessa univormu päällä sekä oli pudottanut sodanvastaisia lehtolehtisiä laivaston lehtokoneesta maahan. Norfolkissa, Virginiassa, laivaston sotilas kieltäytyi kouluttamasta hävittäjälentäjiä, koska Vietnamin sota oli hänestä moraalitonta. Armeijan luutnantti pidätettiin alkuvuodesta 1968 pääkaupunki Washingtonissa, koska oli kantanut kylttiä jossa luki: ”120 000 amerikkalaista uhria, miksi?” Kaksi merijalkaväen afroamerikkalaista sotilasta, George Daniels ja William Harvay saivat pitkät tuomiot (Daniels 6 vuotta ja Harvay 10 vuotta) koska olivat puhuneet muille merijalkaväen mustille sotilaille Vietnamin sotaa vastaan.

Sodan jatkuessa karkuruus asevoimien keskuudessa kohosi nopeasti. Tuhannet menivät Länsi-Eurooppaan, vielä useammat Kanadaan (eri arvioiden mukaan 50 000 – 100 000) . Vielä useammat olivat karkureina USA:ssa. Eräät piileskelivät jopa maan kirkoissa. Karkuuden ja kieltäytymisten todellista määrää Vietnamin sodan aikoina ei varmasti tiedä kukaan. Pentagonin omien tilastojen mukaan yksistään vuosina 1966-71 kirjattiin 503 926 karkuruuteen viittaavaa tapausta. Vuoteen 1971 mennessä 17,7% sotilaista oli ollut ainakin kerran ”puntiksella” (pakoillut palvelusta). Pentagonin tiedoista poimitaan myös tapauksia ”upseerien tapoista” (teon tekijät omia sotilaita). Vuoteen 1971 mennessä jo kokonaiset yksiköt Vietnamissa kieltäytyivät lähtemästä taistelutehtäviin. Varsinaisten sotilaskarkurien määrä kasvoi vuoden 1967 47 000:stä vuoden 1971 noin 89 000:een.

Sotilaiden sodanvastaisuus levisi myös kotona USA:ssa. Demokraattisen puolueen puoluekokouksen yhteydessä Chicagossa kesällä 1968 kieltäytyivät Ft. Hoodin afroamerikkalaiset sotilaat ”mellakantorjuntatehtävistä”. Kukin heistä sai 18 kuukauden tuomion. Mellakoita puhkesi USA:n sotilasvankiloissa tuon tuostakin. Tuhannet saivat vankeustuomion kieltäytyessään taistelemasta Vietnamissa. Sodanvastaisia kahviloita nousi siellä täällä amerikkalaisissa varuskunnissa. Kaikkiaan arviolta 300 sodanvastaista lehteä tai erityyppistä pienjulkaisua ilmestyi näissä kahviloissa ja kasarmeissa. Vietnamissa toimi jopa maanalainen sodanvastainen radioasema, joka soitti sellaista pop-musiikkia, jota asevoimien omat radioasemat eivät suostuneet soittamaan. Näitä kiellettyjen listalla olevia kappaleita olivat mm. suositut Animalsin ”Gotta Get Out Of This Place”, CCR:n ”Fortunate Son” ja Kenny Rogersin ”Ruby Don't Take You Love To Town”. Jouluaattona 1969 noin 50 amerikkalaissotilasta järjesti Saigonissa jopa sodanvastaisen mielenosoituksen.

USA:ssa perustettiin ”Veteraanit Vietnamin Sotaa Vastaan”-yhdistys. Yli sata siihen kuulunutta veteraania todisti kokemistaan ja näkemistään julmuuksista sekä sotarikoksista kuulemistilaisuudessa Detroitissa talvella 1971. Heidän haastattelunsa nauhoitettiin USA:n edustajainhuoneen eräiden edustajien toivomuksesta ja niitä käytettiin Vietnamia käsittävässä kongressin kuulusteluaineistossa.

Näkyvien yksittäisten sotilaiden ja joukko-osastojen kieltäytymisten lisäksi alkoi ilmestyä selvää sotatoimien tietoista sabotointia. Työtehtävä, joka koetaan epämiellyttäväksi ja moraalittomaksi tehdään hyvin haluttomasti, hyvin hitaasti tai sitä ei tehdä ollenkaan. Vietnamin suurimman vankilan Long Binhin ottivat mustat amerikkalaissotilaat hallintaansa kahdeksi kuukaudeksi. Kaksi laivaston merimiestä kaappasi ammuslaivan, jonka oli tarkoitus vielä ammuksia Thaimaassa sijaitsevaan laivaston lentotukikohtaan. Neljäksi päiväksi he ottivat laivan hallintaansa ja ohjasivat sen Kamputsean vesille. AP kirjoitti vuonna 1972: ”Viisi sodanvastustajaa pidätetty ratatielaitteiston sabotoinnista lähellä ammustehdasta, joka valmistaa Vietnamissa käytettävien pommien osia.

Vuoden 1969 lokakuun suurten mielenosoitusten aikoina sotilaat Vietnamissa eräät sotilaat alkoivat pitää mustaa surunauhaa käsivarrella. Uutiskuvaaja paikanpäällä kertoi Da Nangin lähellä partioineen joukkueen sotilasta puolella olleen mustat surunauhat käsivarrellaan. Cu Chissa ollut sotilas kirjoitti ystävälleen 26.10.1970 että ”erillisiä komppanioita on perustettu niille sotilaille, jotka kieltäytyvät menemästä taisteluun” ja jatkoi:

Se ei ole enää mikään suuri juttu täällä jos kieltäytyy menemästä taisteluun.”

Wallace Terry, afroamerikkalainen Time-lehden reportteri nauhoitti satoja mustien sotilaiden haastatteluja Vietnamissa. Hän havaitsi katkeruutta asevoimien keskuudessa olevasta rasismista, inhoa sotaa kohtaan sekä hyvin matalalle vajonnutta moraalia sotilaissa. Yhä enemmän alettiin raportoida tapauksista, joissa upseereita oli kuollut ”tapaturmaisesti”,  kun sotilaat ovat vierittäneet ammuksia niiden upseerien telttojen viereen, jotka vaativat heitä osallistumaan taistelutehtäviin. Pentagon ilmoitti pelkästään vuodelta 1970 ainakin 209 tällaisesta ”onnettomuudesta”.

Raportti Phu Baista huhtikuussa 1972 kertoi kuinka partiotehtävään määrätystä 142 amerikkalaissotilaasta 50 kieltäytyi lähtemästä vedoten mm. että:

Tämä ei ole meidän sotamme.”

New York Times kirjoitti 14. heinäkuuta 1973 kuinka Vietnamissa sotavankeina olleiden amerikkalaissotilaiden johtamat upseerit olivat kehottaneet muita sotavankeja olemaan tekemättä yhteistyötä vihollisten kanssa. Tällöin sotilaat olivat huutaneet heille takaisin:

Kuka on vihollinen?”

Vastenmielisyys koko sotaa kohtaan saavutti vuonna 1972 jopa B-52 pommitustehtäviin osallistuneet sotilaat, joista ainakin muutaman miehistön tiedettiin kieltäytyneen pommitustehtävistä.

 

Taistelu Mekong-joella vai Mississippi-joella?

 

Pentagonin ja laivaston tiedottajat ilmoittivat sodan loppuvaiheessa, että kun USA vetäytyy sodasta Indokiinassa aikoo laivasto puhdistaa itsestään ”ei-toivotun aineksen”. Tutkimusten mukaan Tyynenmeren laivastossa tällaisia sotilaita olisi ollut n. 6 000. Raportin mukaan ”huomattava osa heistä mustia.”

Tämä ja lukuisat muut Vietnamin sodan vuosilta kerätyt tiedot viittaavat siihen, että juuri USA:n asevoimien mustat, latinot, aasialaiset ja intiaanisotilaat muita sotilaita aiemmin ja vahvemmin kyseenalaistivat sodan oikeutuksen, moraalin ja vaistosivat valkoisia herkemmin sodan rasistisen perusolemuksen. He vertasivat omaa elämäänsä kotona USA:ssa ja vietnamilaisten kokemaa julmuutta ja nöyryytystä amerikkalaisten taholta. Ja vaikka etniset vähemmistöt muodostivat asevoimista Vietnamissa ehkä vain 20% oli niillä oleellinen merkitys tilanteessa jossa jo muutenkin asevoimien mahdollisuus rekrytoida uusia sotilaita yhä epäsuositummaksi koettuun sotaan oli suurissa vaikeuksissa. Sodan loppuvaiheessa halukkaita ei riittänyt enää alkuunkaan edes West Pointin upseerikoulutukseen.

USA:n poliittinen johto pelkäsi kuitenkin vuodesta 1968 lähtien jotain paljon pahempaa. Eräs amerikkalainen eversti kuvasi tilannetta myöhemmin siten että USA:n asevoimat olivat Vietnamin sodan käännekohdasta (1968) lähtien luisumassa kohti kehitystä, joka muistutti Venäjän tsaarin armeijan sisäistä luhistumista ensimmäisessä maailmansodassa. Sotilaat yksinkertaisesti alkoivat kasvavassa määrin kieltäytyä tottelemasta upseereita eivätkä halunneet taistella.

Keväällä 1968 NLF:n ja pohjoisvietnamilaisten suuroffensiivin jälkeen oli USA:n poliittiselle johdolle täysin selvää, että USA ei kykene enää sotilaalliseen ratkaisuun Vietnamissa. Kenraali Westmoreland pyysi tässä akuutissa tilanteessa presidentti Johnsonilta 200 000 sotilasta lisää Vietnamiin. Presidentti pyysi pieneltä ryhmältä erityisavustajiaan silloin analyysin tilanteesta. Näiden mielestä ”200 000 sotilasta lisää amerikkalaisia täysin ”amerikkalaistaisi” sodan, eikä se vahvistaisi Saigonin hallintoa ja sen kykyä hankkia kannatusta väestöltä.” Raportin mukaan kiihtyvä sota ”lisäisi amerikkalaisen verojen ja uhrien määrää” ja:

 

This growing disaffection accompanied as it certainly will be, by increased defiance of the draft and growing unrest in the cities because of the belief that we are neglecting domestic problems, runs great risks of provoking a domestic crisis of unprecedented proportions.”

 

Tämä varmasti kasvava tyytymättömyys lisääntyvien kutsuntojen uhmaamisten takia ja kasvava levottomuus kaupungeissa johtuen käsityksestä että olemme unohtamassa kotoiset ongelmamme tulee entisestään provosoimaan kotoiset ongelmamme ennennäkemättömiin mittasuhteisiin.

 

USA:n poliittisen johdon oli vetäydyttävä Vietnamista koska se muodosti sille pahimman mahdollisen uhan – USA:n kotirintaman ajautumisen hallitsemattomaan yhteiskunnalliseen kaaokseen. Tälle uhkaavalle analyysille löytyi jo lähikuukausina katettu kun maan merkittävimmät poliitikkot kuten Martin Luther King ja Robert Kennedy murhattiin pelottavan ilmapiirin vallitessa.

Virallisen historiankirjoituksen tehtävä on kirjoittaa historia establishmentin haluamalla tavalla. USA:n poliittinen ja taloudellinen eliitti analysoi Vietnamin sodan ”virheenä” vaikka kysymys oli rikollisesta ja moraalittomasta sodasta. Eliitti halusi myöhemmin, eteenkin 1980-luvulta lähtien, luoda myytin ”Vietnam-syndroomasta” siis eräänalaisesta tartuntataudista, joka olisi tuhottava pois. Tuon syndrooman mukaan intellektuellien joukko pakotti USA:n sotimaan Vietnamissa ”toinen käsi sidottuna” ja media pelasi ”vihollisen pussiin”. Populaarikulttuurin kautta muokattiin käsitystä veteraanien ja intellektuellien välisestä vihasta ja kaunasta. Kaikenalaiset ”Rambot” loivat käsitystä patrioottisesta työväenliikkeestä, sen piiristä tulleista sotilaista sekä epäisänmaallisista sotaa vastustavista ylemmän keskiluokan hyypiöistä. Media itse loi käsityksen itsestään ”hyytävän realistisena” sodan kuvaajana vaikka tosiasiassa USA:n valtamedia toisti virallista Pentagonin jargonia. Vain muutama kriittinen toimittaja yleensä pienissä julkaisuissa pystyi analysoimaan syyt, seuraukset ja sodan hämäykset.

Vietnam syndrooman” teesit kaatuvat omaan mahdottomuuteensa. Media ei pelannut ”vihollisen pussiin” vaan tosiasiassa toimi Pentagonin haluamalla linjalla. Amerikan ns. älymystöön kuuluvat ihmiset, niin liberaalit kuin konservatiivitkin, olivat jokseenkin koko sodan ajan USA:n sotatoimien innokkaimpia kannattajia. Koska he lukivat muita enemmän ”laatulehtiä” joutuivat he muita todennäköisemmin myös virallisen poliittisen sotapropagandan huijaamaksi. Vietnamin sodan vastaisen liikkeen kasvattivat sen sijaan ennennäkemättömiin mittasuhteisiin juuri Vietnamista palaavat tai sodasta kieltäytyvät sotilaat, USA:n kansalaisoikeusliike ja matalan tulotason amerikkalaiset, jotka ymmärsivät ettei Vietnamin sota ollut sen paremmin ”yhdenkään amerikkalaissotilaan hengen arvoinen” kuin yhdenkään vietnamilaisen hengen arvoinen spektaakkeli. Enemmän kuin tappiota Mekong-joen suistolla Valkoinen talo ja Pentagon pelkäsivät lopulta kuitenkin tappiota Mississippin suistoalueella. 


( Päivitetty: 08.10.2012 13:27 )

 - pelontorjunta | Linkki



 ”Ammu kaikkea mikä liikkuu” - USA:n rikollinen sota Indokiinassa 1960-1975
08.04.2012 12:36 | pelontorjunta

(Kuva: Bernard Fall ylh. vas., toimittaja Alex Shimkin alh vas., kenraali Julian Ewell ylh oik. ja kenraali William Westmoreland alh oik. Hänen vieressä USA:n puolustusministeri Robert McNamara)

 

 

 

Get the Flash Player to see this player.

 

 

 

 

Yhdysvaltojen puolustusministerinä vuosina 1961-68 toiminut Robert McNamara kirjoitti muistelmissaan "Retrospect" ("Jälkikäteen"):

Me Kennedyn ja Johnsonin hallinnossa päätöksentekoon osallistuneet toimimme sen mukaan mitä pidimme tämän kansakunnan periaatteina ja perinteinä. Teimme päätökset näiden arvojen valossa. Mutta olimme väärässä, pahasti väärässä. Olemme tuleville sukupolville selityksen velkaa. Uskon todella, että teimme virheen - emme aikomusten ja arvojen takia – vaan arvioitimme ja valmiuksiemme takia.”

McNamarasta kehittyi vuosien mittaan Vietnamin sodan ”arkkitehti” ja ”ideologi”. Tämä arvio on virheellinen. Vastoin yleistä luuloa McNamara ei suinkaan ollut sodan pääideologi. Hänen henkilöhistoriaansa vähänkin tarkemmin tutustuneet havaitsevat varsin pian, että Robert McNamara oli pohjimmiltaan vain rajoittunut teknokraatti, ”pikku insinööri”, josta tuli USA:n jo II maailmansodan loppuvaiheista lähtien hahmottuneen Indokiinan politiikan työmies. Hänen muistelmansa paljastavat miten vähän hän lopulta edes itse taisi tietää mistä Vietnamissa lopulta oli kyse. Hänestä tehty dokumenttielokuva ”Fog Of War” (”Sodan sumu”, 2003) vahvistaa tätä havaintoa.

Hänen vakaumustaan USA:n ”arvoista” Indokiinan sodassa voidaan kuitenkin pitää – McNamaran ehkä itse koskaan sitä tajuamatta – oikeasuuntaisena. Todellakin: jos jotkut yrittävät olla USA:lle tottelemattomia, heidät murskataan ja teurastetaan. Nämä ovat McNamarankin julistamat Amerikan Yhdysvaltojen ”arvot”. Nämä arvot ovat jatkumo siinä perinteessä mikä oli vallalla jo maan asuttamisessa ja intiaanisodissa. Vietnamissa, Laosissa ja Kamputseassa ei tapahtunut mitään erityisen uutta ja erikoista. Näyttämö, periaatteet ja metodit vaikuttivat tutulta jokaiselle joka aikoinaan oli katsellut vanhoja Hollywoodin lännenfilmejä. Oli ”raakalaismaiset alkuasukkaat”, pahikset ja sivistyksen ilosanomaa levittävät uudisasukkaan ja näiden kärjessä tietä edistykselle raivaamassa voitokas ratsuväki.

 

Bernard Fall

 

Amerikkalaisten harjoittama sodankäynti Vietnamissa, pääasiassa sen eteläisessä osassa, hahmottui jo kauan ennen USA:n merijalkaväen saapumista maahan 8.maaliskuuta 1965. Presidentti Kennedy (1961-63) harjoitti suoraa terroria vietnamilaista siviiliväestöä kohtaan. Tämä edelsi varsinaista aggressiota (v. 1965-1973). Tammikuussa 1965 USA laajensi radikaalisti pommituksia Vietnamin eteläosissa. Myös pommitukset pohjoisessa alkoivat (uudestaan), mutta juuri etelässä pommitusmäärä kolminkertaistui nopeasti.

Oli yksi henkilö joka oikeastaan lähes ainoana aikalaisena kuvasi selkeästi ja tarkasti mitä juuri tuona ajanjaksona tapahtui. Hän oli ranskalainen sotahistorioitsija, kirjailija ja Indokiinan todellinen asiantuntija Bernard Fall. Hän oli kiinnostava persoona siinäkin mielessä että McNamara mainitsi hänet useasti kirjassaan ja suorastaan ihaili häntä. Fall oli ns. ”haukka”, vastusti kommunismia sekä kannatti Ranskaa ja USA:ta. McNamaran kannalta hän oli siis ”meidän miehiämme”.

Mutta Bernard Fall erosi kaikista sodan alkuvaiheen paikalla olleista reporttereista, kirjailijoista ja sodan kuvaajista monessakin mielessä. Hän tiesi alueen ja sen kansojen historiasta, kulttuurista, menneisyydestä eikä hän halunnut tuon kokonaisen osan maailmankulttuuria tuhoutuvan. Vuonna 1965 Bernard Fall kirjoitti että suurin päätös sodassa ei ollut Pohjois-Vietnamin pommitukset (1964-65), eikä amerikkalaisjoukkojen lähettäminen myöhemmin (maaliskuusta 1965 lähtien) vaan juuri Etelä-Vietnamin massiivinen pommittaminen paljon suuremmassa mittakaavassa kuin mitään muita alueita. Hän muistutti vuotta 1965 myös edeltäneistä vuosista, jolloin USA oli yrittänyt massiivisesti pommittaa ns. ”Vietkongia” napalmilla ja oksennusta aikaansaavilla kaasuilla ym. aseilla ja totesi tämän olevan rikollista.

Fall tiesi mistä kirjoitti. Hän toimi amerikkalaisten neuvonantajana ja liikkui amerikkalaisjoukkojen mukana siellä missä sotilasoperaatioita tapahtui. Hän kuvaili hyvin havainnollisesti kuinka helikopteri- ja muissa hyökkäyksissä pommitettiin Vietnamin eteläosien kyliä ja tuhottiin sairaaloita. Hän oli tästä raivoissaan mutta hän kuvasi kaikkea mitä hän koki.

McNamara mainitsi kirjoissaan Bernard Fallin tiedot ja kuvaa niitä ”rohkaiseviksi”. Päinvastoin kuin Fall ei McNamara kuitenkaan sanallakaan mainitse Etelä-Vietnamin kylien massiivisia pommituksia vaan ohittaa ne. Hän siteraa Fallin artikkeleita, toteaa hänen olevan osaavan henkilön ja hienon analyytikon sekä kertoi tämän olleen hyvin vaikuttuneen siitä mitä amerikkalaiset tekivät. McNamara arvioi Fallin uskovan amerikkalaisten homman onnistuvan. Tässä McNamaran väitteessä oli tietynlaista totuutta. Bernand Fall havaitsi ja totesi näiden amerikkalaisten olevan niin murhanhimoisia mielipuolia että he saattavat todella onnistua tuhoamaan maan. Tässä suhteessa siis Fall uskoi amerikkalaisten ”homman toimivan”.

Mutta sitten McNamaralla on kirjassaan alaviite. Hän mainitsee kuinka kaksi vuotta myöhemmin, syksyllä 1967, hän näkemyksensä muuttuivat pessimistisemmäksi amerikkalaisten voiton suhteen. Entä mitä kirjoitti Bernard Fall tuona samana vuonna 1967, juuri ennen kuolemaansa? Hän toteaa että Vietnam ja sen koko kulttuuri on kirjaimellisesti tuhoutumassa sellaisessa amerikkalaisten suorittamassa hyökkäyksessä mitä yksikään maa ei ole koskaan aiemmin kokenut. Nämä Fallin näkemykset McNamara luki, jonka jälkeen – hänen omien sanojensa mukaan – hänen mielipiteensä siitä että ”sota on voitettavissa” muuttui. Mutta koskaan McNamara ei todennut että amerikkalaisten ”arvoissa” ja ”aikomuksissa” olisi ollut mitään moraalitonta tai väärää.

 

My Lai kuukaudessa”

 

Myöhään vuonna 1969 paljasti freelance-toimittaja Seymour Hearsh tietolähteittensä avulla ns. Americal-divisioonaan kuuluneen C-komppanian My Lai-nimisellä vietnamilaisella kylällä Quang Ngain maakunnassa suorittamasta n. 350-500 siviilin massiivisesta joukkomurhasta (tapahtuman ollessa mediassa esillä puhuttiin tosin usein esim. 130 tapetusta siviilistä). Vaikka jälkimaailmalle on media usein jättänyt kuvan My Lain verilöylystä Vietnamin sodan suurimpana yksittäisenä tapauksena tiesivät kotimaahansa palanneet tai Vietnamissa vielä taistelleet joukot lukuisista tämän kaltaisista tapauksista. Sen sijaan USA:n poliittinen ja sotilaallinen johto vielä pitkään sodan jälkeen esitti My Lain poikkeuksellisena yksittäistapauksena.

Tapahtuman tausta oli varsin tavanomainen. Amerikkalaisyksikkö, jatkuvien vihollisjoukkojen yllättävien iskujen, tarkka-ampujien, miinojen ym tapahtumien seurauksena oli kärsinyt tuntuvia tappioita. Kylä jolle luutnantti William Calleyn joukko-osasto saapui sai maksaa siitä hyvästä että turhautuneet amerikkalaiset olivat kärsineet miesmenetyksiä.

Muutamia kuukausia myöhemmin, toukokuussa 1970, kirjoitti eräs ”huolestunut kersantti” luottamuksellisen kirjeen silloiselle armeijan esikuntapäällikölle kenraali William Westmorelandille. Kirjeessään kersantti kertoi omakohtaisista havainnoistaan ja kokemuksistaan USA:n armeijan 9.Divisioonan toiminta-alueella Mekong-joen suistossa usean kuukauden ajalta vuodenvaihteessa 1968-69. Hän mainitsi lukemattomista amerikkalaisten suorittamista siviilien joukkosurmista ja kylien massiivista tuhoamisista. Hän mainitsi mm. seuraavaa:

Herra kenraali. 9.Divisioona ei tehnyt mitään tappamisen estämiseksi vaan pyrki tappolukujen (engl. Body-count) kasvattamiseen niin kovaa vauhtia, että meidät määrättiin tappamaan monta kertaa enemmän vietnamilaisia kuin mitä tapahtui My Laissa ja hyvin pieni prosenttiosuus tappamistamme vietnamilaisista tiesimme olevan vihollisia...

Jos ette usko, niin tarkoitin juuri että hyvin paljon vietnamilaisia tapettiin tällä tavalla ja voin antaa teille jonkinlaisen kuvan kuinka paljon. Pataljoona tappaisi tällä tavoin ehkä 15-20 päivässä. Neljän pataljoonan prikaati tappaisi näin ehkä 40-50 päivässä tai helposti 1200-1500 kuukaudessa. (Eräs pataljoona väitti tappaneensa yhden kuukauden aikana lähes tuhat). Jos olen edes 10%:sti oikeassa se merkitsisi, ja uskokaa minua – se on paljon enemmän, niin yritän kertoa 120-150 murhasta tai My Laista joka kuukausi vuoden ajan...

Tarkka-ampujat ampuivat päivässä 5 tai 10 ja jokaisella pataljoonalla oli mielestäni tarkka-ampujajoukkueita. Se tarkoittaisi 20 päivässä tai 600 kuukaudessa. Eli jos olisin jälleen 10%:sti oikeassa olisivat tarkka-ampujat ampuneet My Lain verran joka toinen kuukausi.”

Tässä kirjeessä sekä kahdessa muussa seuraava vuonna korkea-arvoisille upseereille lähetetyssä kirjeessä kersantti kertoi tuhoa aiheuttaneista tykistö-, ilma- ja helikopteri-iskuista taajaan asutetuille alueilla. Kaikki mitä tarvittiin, hän kertoi, oli vain joku yksittäinen laukaus kylästä tai metsänreunasta ja joukot tilasivat aina tykistö- tai ilmatulitustukea. ”Monta kertaa”, hän kertoi, ”pyysimme ja saimme tulitukea, vaikka meitä kohti ei edes ammuttu”. Hyökkäykset tehtiin, hän kertoi, koska alueet oli julistettu vapaasti tulitettaviksi.

Kersantti kertoi yksikön toimitapana olleen ampua ei vain ”Vietkongin” sotilaita vaan kaikkia jotka juoksivat. Tämä oli yleisin tapa aseettoman ampumisessa. Kersantti kertoi kuinka helikopterit lensivät yli alueiden niin että ihmiset kauhuissaan alkoivat juosta jolloin tarkka-ampujat ja helikopterit tulittivat maanviljelijöitä ja kasvattivat tappolukemiaan tällä tavalla. Hän kertoi kuinka oli tavallista pidättää aseettomia ja panna heitä kävelemään yksikön edellä vihollisen ansojen ja miinojen laukaisemiseksi. ”Kukaan meistä ei halunnut tulla räjäytetyksi”, hän kertoi mutta ”ettei ollut oikein laittaa siviilit räjäyttämään miinat”.

Hän selitti myös omituista epäsuhdetta tapettujen vihollisien korkean lukumäärän ja sotasaaliiksi saatujen aseiden vähäisen määrän välillä.

 

Verratkaa niitä [tapettujen vihollisten] lukemia saamiemme aseiden määrään. Suuren taistelun jälkeen emme saaneet mitään asekätköjä vain yhden kuolleen ”Vietkongin” aseensa kanssa. Kenraalin täytyi tietää vääristä tappolukemista aseiden määriin nähden. Jos ilmoitimme saaneemme haltuun aseita, ne oli luovutettava ja tuhottava joko luodeilla tai pudottamalla ne riisipelloille ja kanaviin. Kuivalla kaudella ennen monsuunia oli paljon seutuja joissa pellot ja kanavat olivat kuivia. Kenraalin täytyi tietää että näin tehtiin.”

 

Huolestuneen kersantin” mukaan kaikki nämä tappamiset tapahtui yhdestä syystä: ”Kenraalit ja korkeat komentajat vaativat jatkuvasti meitä saamaan korkeita tappolukemia.”Hän kertoi:

Kukaan ei koskaan antanut meille suoraa määräystä ampua siviilejä. Mutta lopputulos ei olisi ollut yhtään erilainen kuin ... jos meille olisi annettu tällainen määräys. Kuolleet vietnamilaiset olivat ”body count”-systeemin uhreja eikä kukaan välittänyt tarpeeksi lopettaakseen sen.”

 

Operaatio Speedy Express

 

Vietnamin eteläosissa oleva Mekong-joen suistoalue oli 1960-luvun puolivälissä Etelä-Vietnamin riisimalja vehreine riisipeltoinen, patoineen ja koti noin 6 miljoonalle vietnamilaiselle. Se on myös kumouksellisen vietnamilaisen liikkeen vankimpia tukialueita Vietnamin sodan aikana. Huolimatta sen äärimmäisen tärkeästä sotilaallisesta merkityksestä USA:n sotilasviranomaiset olivat ”syvästi huolissaan” suurien amerikkalaisjoukko-osastojen tuomisesta alueelle sen tiheän asutuksen vuoksi, sillä siviiliuhrien määrää olisi täysin mahdotonta tuollaisissa operaatioissa rajoittaa.

Tästä ja vuonna 1968 Pariisissa alkaneista rauhanneuvotteluista huolimatta USA:n sotilasjohto aloitti massiivisen sotilasoperaation juuri tällä alueella tavoitteena ”rauhoittaa” eli saattaa mahdollisimman suuri osa alueista Saigonin eli Etelä-Vietnamin hallituksen hallintaan. Joulukuusta 1968 aina toukokuuhun 1969 USA:n armeijan 9.Divisioona ja sitä tukeneet divisioonaan kuulumattomat yksiköt helikoptereista aina ilmavoimien B-52 pommikoneisiin suorittivat suuroperaatioita joiden seurauksena sotatoimista vastannut 9.Divisioonan sotilasjohto tiedotti hämmästyttävän menestyksellisistä tuloksista joiden mukaan peräti 10 889 vihollisen taistelijaa olisi surmattu amerikkalaistappioiden ollessa kaatuneina vain 267 sotilasta. Vaikka NLF:n taistelijoilla tiedettiin olevan runsaasti aseita alueella ilmoittivat amerikkalaiset saaneensa vain 748 asetta haltuunsa. Useimmat mediatoimittajat eivät havainneet tätä valtavaa epäsuhtaa väitettyjen vihollistappioiden ja haltuun saatujen aseiden välillä mutta muutamat kiinnittivät siihen myöhemmin huomiota.

 

Mekong-suiston teurastaja

 

USA:n ja Saigonin hallituksen kannalta vaikealla Mekong-jokisuiston alueella operoineen USA:n 9.Divisioonan komentajana toimi helmikuusta 1968 aina huhtikuuhun 1969 kenraali Julian Ewell. Hänen komentajakautena divisioona saavutti ällistyttävän korkean virallisen ”tapposuhteen” verrattuna muihin amerikkalaisyksikköihin. Noiden divisioonan julkaisemien raporttien mukaan divisioona tappoi jokaista taisteluissa kaatunutta omaa sotilasta kohden peräti 62 vihollistaistelijaa.

Ja vaikka Ewell ei ollut lajissaan ainoa, hänellä oli äärimmilleen kehittynyt pakkomielle tätä ns. body-count-järjestelmää kohtaan. Tämän pakkomielteen jakoi Ewellin kanssa hänen alaisuudessaan silloin toiminut prikaatinkomentaja eversti Ira ”Jim” Hunt.

Huolestunut kersantti” kirjoitti:

Huntilla, joka oli jonkin aikaa prikaatinkomentajana ja sen jälkeen avustavana komentajana divisioonassa, oli tapana karjua komentohelikopteristaan radioon ja puhua 'hemmetin vinosilmistä' ja hän vaati tuliasemia ja helikoptereita ampumaan noita 'huoranpenikoita' – 'tämä on tulivapaata aluetta'.

Hunt ei välittänyt yhtään vietnamilaisista siviileistä tai meistä. Kaikki kaikessa oli 'body count'. Hän oli aina huutamassa radioon ja kehottamassa ampumaan juoksevia vietnamilaisia silloin kuin sotilaat eivät tienneet ovat nämä sotilaita vai siviilejä, onko näillä aseita vai ei.”

Kersantti kirjoitti tapauksesta jossa tykistön tulenjohtaja oli kertonut kersantin komppanian päällikölle ettei voi määrätä tulta kylään joka on ääriään myöten täynnä siviilejä.

Silloin pataljoonan komentaja suuttui ja vaati tulta kylään koska yksikkö on joutunut tulikosketukseen vihollisen kanssa. Minä olin silloin siellä tapahtumapaikalla eikä mitään taistelukosketusta viholliseen ollut. Tulenjohtaja ja komppaniani päällikkö yrittivät turhaan vedota tulituksen lopettamiseen.”

Kersantin mukaan pataljoonan komentaja ei edes halunnut kuunnella tulenjohtajaa. Deborah Nelsonin tekemässä haastattelussa v. 2006 Ira Hunt väitti ettei divisioona koskaan tulittanut kylien läheisyyteen. Hän myös kiisti painostuksen ”body countin” kasvattamiseksi. Huntin mukaan ”kukaan ei väitä etteikö viattomia siviilejä tapettaisi sodassa mutta me pyrimme pitämään siviiliuhrien määrän mahdollisimman vähäisenä – siviiliuhrit ovat sodan kirous. Teimme parhaamme suojellaksemme siviilejä.”

Mutta useat Speedy Express-operaatioon osallistuneet haastatellut, todistajalausunnot sekä tilastot vahvistavat ”huolestuneen kersantin” kirjeessä esittämät väitteet. Kersantin kirjeessä mainitsema pataljoonan komentaja David Hackworth vahvisti myöhemmin muistelmissaan (”Steel My Soldiers Hearts”) että ”monet siviilit teurastettiin koska Ewell ja Hunt pyrkivät mahdollisemman korkeaan tappotilastolukemaan”. Hän myös mainitsi kirjassa kuinka Hunt kunniamaininnoissa viittasi viholliselle aiheutettujen tappiolukemien suureen lukemaan mutta jätti tietoisesti mainitsematta kiusallisen vähäisen vallattujen aseiden määrän.

Majuri William Taylor Jr näki myös Huntin toiminnassa Speedy Expressin aikana ja toisti ja vahvisti kersantin kirjeessään kertomia havaintoja. Taylor muisteli lentoja riisipeltojen yllä Huntin kanssa:

Hän [Hunt] sanoi äkkiä jotain lentäjälle ja pian helikopterin oviampuja avasi tulen konekiväärillä. Kysyin Huntilta että mitä tämä on. Hän sanoi: ”Näetkö nuo mustat pyjama-asuiset tuolla alhaalla pellolla. Ne ovat vietkongeja. Tapoimme niitä äsken kaksi.” Sitten hän puhui taas lentäjälle. Hän puhui 'body countista'. ”Raportoi 'body countista'”. Myöhemmin kysyin kuinka hän voi tunnistaa vietkongin sotilaan kilometrien päästä näkemättä asetta tai kohtaamatta tulta. Hän vastasi: ”Koska heillä on mustat pyjamat”. Sanoin, että tiettävästi kaikilla työntekijöillä on mustat pyjamat. Hän vastasi: ”Ei täällä. Täällä mustat pyjamat ovat vietkongilaisia.”

Kuten Hackworth myös Taylor alleviivasi haastattelussa ”body countyn” merkitystä. ”Se oli menestyksen mitta ja se tuli henkilökohtaisella esimerkillä divisioonan komentajalta Julian Ewelliltä.”, hän kertoi. ”Näin sen suoraan. ”Body count” oli kaikki kaikessa.”

Divisioonassa taistelulääkintämiehenä ollut Gary Nordström kertoi ”body count”-ajattelun kulkeneen upseerikunnassa hierarkiassa ylhäältä alas.

”Hanki body count. Hanki body count. Hanki body count. Se oli yleistä kaikkialla. Se kulki upseereilta ylhäältä alas. Näin useita kertoja kuinka vietnamilaisia tulitettiin vain sen takia että he juoksivat.”

Kenraaliluutnantti Robert Gard, joka komensi 9. Divisioonan viittä tykistöpatteristoa Vietnamissa vuosina 1968-69. Hän kertoi haastattelussa kuinka Ewellillä on tapana painottaa voimakkaasti body countin merkitystä. Ewell oli lisäksi todennut kuinka hänelle ei ole koskaan ilmoitettu tulituksen rajoittamisesta.

Eräs amerikkalainen joka todisti verilöylystä Mekongin suistoalueella oli everstiluutnantti John Paul Vann. Hän lensi helikopterien mukana yöllisiä taistelulentoja. Yksikkö käytti ensimmäisiä pimeänäkölaitteita ja Vannin mukaan joukot valikoivat kohteiksi ketä tahansa ihmisiä tai vesipuhveleita. Ei edes yritetty selvittää olivat uhrit siviilejä vai taistelijoita.

Louis Janowski toimi suistoalueella neuvonantaja Speedy Expressin aikana ja laati vuonna 1970 murskaavan sisäiseen kiertoon tarkoitetun loppuraportin siitä mitä oli havainnot. Siinä hän nimitti suistoalueen helikopterioperaatioita, ns. Phantom-ohjelmia, valikoimattomaksi terrorismiksi:

Olen lentänyt Phantom III-ohjelmia, nähnyt lääkittäviä ihmisiä ja lapsia ja olen vakuuttunut että vietkongilaisten (sissien) osuus uhreista on sama kuin heidän osuutensa viljelijäväestöstä. Eli jos 8% alueen väestöstä on vietkongilaisia niin tappamistamme ihmisistä 8% on ollut vietkongilaisia.”

Jeffrey Record toimi myös neuvonantajana suistoalueella ja todisti massiivisesta siviiliväestöön kohdistuneesta terrorista. Vuonna 1971 Washington Montlyssa julkaistussa artikkelissa Record kertoo kuinka oli mukana todistamassa Phantom-ohjelmaan kuuluneessa operaatiossa jossa helikopteri avasi tulen kohti vesipuhvelilaumaa. ”Sekunnissa tyyni, seesteinen riisipelto muuttui veren ja lihan tahraamaksi liejuksi”, Record kirjoitti. ”Kuolleet pojat ja vesipuhveli lisättiin viralliseen tapettujen vietkongilaisten sotilaiden luetteloon.”

 

Armeija salasi sotarikokset

 

Huhtikuussa 1969 Julian Ewell sai ylennyksen II Field Forcen, silloin suurimman USA:n Vietnamissa olleen taisteluyksikön komentajaksi. Ira Hunt siirtyi 9. Divisioonan komentajaksi. Samassa kuussa Hunt puolusti AP:ssa julkaistussa kirjoituksessa ”body count”-järjestämää jota syytettiin ”hirvittäväksi menestymisen mittariksi”. Kertomuksessa lainattiin upseeria joka kiisti siviilien tahalliset tappamiset, vaikka Hunt myönsi että niitä oli 9. Divisioonan sotatoimien yhteydessä tullut. ”Olemmeko tappaneet viattomia siviilejä? Totta helvetissä. Mutta niin on tehnyt Etelä-Vietnamkin.”

Keväällä 1970 kun Ewell valmistui lähtemään Vietnamista Pariisin rauhanneuvotteluiden sotilaallisen neuvonantajan tehtäviin, luki armeijan lakiasianjohtaja R. Kenley Webster ”huolestuneen kersantin” kirjeen Stanley Resourin pyynnöstä. Muistion mukaan Webster kirjoitti tuolloin, USA:n Kansallisarkistoissa olevien asiakirjojen mukaan, että hän oli ”vaikuttunut sen [kirjeen] voimallisuudesta” ja ”vilpittömyydestä” joka tuli arvostetulta Vietnamin veteraanilta. Tuo raportti vahvisti ”huolestuneen kersantin” väitteen:

On yleisesti tiedetty että upseerin ura voi saa vauhtia tai tuhoutua Vietnamissa. Erityisesti jos tällaisissa olosuhteissa kannustimet ovat pysyminen aloillaan eli ”lepo ja rentoutuminen” tai sitten kunniamerkkien jakaminen, joka perustuu 'body count”-lukemiin, paine tappaa valikoimattomasti tai ainakin raportoida jokainen kuollut vietnamilainen vihollistaistelijaksi on aivan vastustamaton.”

Kesäkuussa 1970 Webster lähetti muistion, jonka selostuksessa hän esittää että hän neuvottelesi kenraali Westmorelandin (Vietnamin joukkojen komentaja vuoteen 1968) ja kenraali Creighton Abramsin (Westmorelandin seuraaja Vietnamissa) kanssa. Armeijan dokumenttien mukaan Resor ja Abrams keskustelivat asiasta mutta mihinkään jatkotoimenpiteisiin ei ryhdytty.

Uutiset julmuuksista Mekongin suistoalueella olivat levinneet julkisuuteen. Talvella talvella 1971 Detroitissa pidetyssä Winter Soldier-tutkimuksissa todistajalausuntoja antaneet 9.Divisioonan sotaveteraanit vahvistivat esimerkein mitä Speedy Express-operaatiossa oli tapahtunut. Huhtikuussa 1971 USA:n Edustajainhuoneen Robert Dellumsin johtamassa kuulemistilaisuudessa West Pointin upseerikoulun käyneet Vietnam-veteraanit todistivat kenraali Julian Ewellin ”body count pakkomielteestä”.

Toukokuussa John Paul Vann kirjoitti Westmorelandin entiselle sijaiselle, silloin RAND-Corporationin palveluksessa olleelle Robert Kromerille:

USA on hyvin huteralla pohjalla sekä Phantom-operaatioiden että muiden ilmasta suoritettavien tappotehtävien suhteen. Satoja kauheita tapauksia ovat dokumentoineet raivostuneet neuvontajat, sekä sotilaat että siviilit.”

Ira Hunt oli tässä vaiheessa palannut Vietnamissa ja kuin sattuman oikusta johti My Lain verilöylyyn kaulaansa myötä kiinni jääneen eversti Oran Hendersonin tapauksen käsittelyä. Vaikka Hunt suositti vain lievää rangaistusta Hendersonille – tämä haastettiin sotaoikeuteen. Toukokuun 24.päivänä Henderson pudotti pommin. Hän ilmoitti että ”joka ainoassa prikaatinkokoisessa yksikössä on oma My Lai piilotettuna.” Ainoa syy miksi tapaukset ovat jääneet pimentoon johtuu siitä että ”jokaisessa yksikössä ei ole omaa Ridenhouria”. Henderson viittaa Ron Ridenhouriin, joka lähetti kymmeniä kirjeita eri sotilas- ja siviilihenkilöille, jolloin My Lain vyyhti alkoi vähitellen purkautua.

Ron Ridenhourin ja ”huolestuneen kersantin” välillä oli kuitenkin tietty ero. Ridenhour ei pitänyt My Lain tapausta ”armeijan sisällä” kuten ”huolestunut kersantti”. Westmorelandin toimisto tunnisti vähitellen kersantin henkilöllisyyden. Kersantille lähetettiin kirje jonka mukaan hänen antamiansa tietoja tutkitaan. Tutkimuksia ei koskaan tehty. Tapaus haudattiin nopeasti vedoten siihen että armeija ei tutki nimettöminä annettuja lausuntoja, vaikka tässä tapauksessa syyt olisivat olleet vielä ilmeisemmät ja rikoksen koko huomattavasti suurempi kuin My Lain tapauksessa.

 

Kauhu oli pahempaa kuin My Laissa ”

 

Newsweekin Vietnamissa olleen toimittajan Alex Shimkin oli työssään huomattavan tarkka, riittävän epäluuloinen ja kriittinen. Hänen silmiinsä osui vuoden 1971 alussa jotain hälyttävää: 9.Divisioonan lukemat tapetuista vihollisista sekä näiden lukemien valtava epäsuhta saatuihin vihollisen aseisiin nähden. Shimkin aloitti tiiviin MACV:n (USA:n Vietnamin sotavoimien) dokumenttien tutkimisen. Newsweekin Saigonin toimistopäällikkö Kevin Buckleyn kanssa he alkoivat kaivaa tapausta esille.

He haastattelivat sotilasviranomaisia, sairaalahenkilökuntaa, sotilaista ja hengissä säilyneitä vietnamilaisia. He kampasivat 9.Divisioonan toiminta-alueen tapahtumia Speedy Expressin ajalta ja kokonaiskuva alkoi hahmottua. ”Kauhu ole pahempaa kuin My Laissa”, totesi eräs amerikkalainen 9.Divisioonan operaatioissa mukana ollut upseeri. ”Useimmat uhreista kuolivat ilmasta tapahtuvissa iskuissa ja yöllä. Ne tulivat komentajan vaatimuksesta kasvattaa ”body count”-lukemaa.”

Vanha mies Kien Hoasta:”Amerikkalaiset tuhosivat kylän jokaisen talon tykistöllä, ilmapommituksilla tai polttamalla ne tupakansytyttimellä. Sata kyläläistä kuoli. ”Toinen mies herra Hien kertoi kuinka ”amerikkalaiset ampuivat helikoptereilla aluetta jopa päivänvalossa, koska pelloilla työssä olevat ihmiset pelkäisivät ja alkaisivat juosta.”

Marraskuussa 1971 Buckley lähetti kirjeen MACV:lle jossa toi esille saamiaan tietoja Operaatio Speedy Expressin aiheuttamasta tuhosta. MACV myönsi, että suuri osa uhreista olisi kuollut ilmaiskuissa ja yöllä, mutta kiisti tiedot joiden mukaan huomattava osa uhreista olisi ollut siviilejä. MACV:n mukaan kuolleet olisivat olleet pääasiassa ”aseettomia vietkongin taistelijoita”.

Newsweek ei koskaan kulkaissut sellaisenaan Buckley ja Shimkinin n. 5000 sanaa käsittänyttä tutkimusta Speedy Expressistä. Juttu typistyi lopulta 1800 sanaiseksi selostukseksi josta eliminoitiin mm. silminnäkijöiden haastattelut ja Julian Ewellin keskeinen osuus. Juttu ei saavuttanut kovinkaan paljon huomiota. USA:n Vietnamissa toimineet asevoimat yhdessä median kanssa latisti koko tapauksen.

John Paul Vann kuoli muutama päivä Newsweekin julkaiseman Speede Express-kirjoituksen jälkeen helikopterionnettomuudessa Vietnamissa.Toimittaja Shminkin kuoli sotatoimialueella heinäkuun 12.päivänä 1972. Julian Ewell jäi asevoimista eläkkeelle vuonna 1973.

Vuonna 1974 julkaistussa Vietnam-tutkimuksessa ”Sharpening The Combat Edge” jäi Ewelillä ja Huntilla ikäänkuin viimeinen sana sanottavana Operaatio Speede Expressistä. Vaikka he jättivät operaation nimen pois kirjasta, kuvasivat he siinä operaation mittasuhteita ja sen brutaalisuutta laajalti. Kirjan viimeisillä sivuilla he ottivat kantaa toiminnan herättämään arvosteluun. ”Yhdeksättä divisioonaa [ja II Field Forcea] on arvosteltu pakkomielteestä ”body countiin” ja että se olisi ollut joko väärin tai johtanut ei-toivottuihin menettelytapoihin.” He kiistivät body count-politiikan olleen toiminnassa keskeisintä ja väittivät jopa että heidän menetelmänsä olisivat päättäneet sodan brutaaleimman vaiheen.

Viralliseksi amerikkalaiseksi totuudeksi näytti jäävän että My Lai oli yksittäinen tapaus, poikkeus. Armeijan "huolestuneeksi kersantiksi" tunnistama mies oli nimeltään George Lewis. Hän asui Sharpsburgissa Kentuckyssä ja kuoli 56-vuotiaana vuonna 2004. 

 

Body Count-ideologia

 

Vietnamin sodassa keskeiseen osaan noussut sotilaallisen onnistumisen mittari - ”body count” - kuvasti sitä teknokraattista ajattelutapaa joka vallitsi USA:n sotilaallispoliittisen eliitin keskuudessa kylmän sodan aikana. Mutta ideologian juuret on jäljitettävissä jo ainakin II maailmansodan aikaisesta amerikkalaisesta sotilaallisesta suunnittelusta ja eteenkin strategisten pommitusten analyyseistä, mittausmenetelmistä ja monista siinä käytetyistä kalkyyleistä.

Ei liene sattuma, että Vietnamin sodan aikana USA:n puolustusministerinä toiminut Robert McNamara palveli II maailmansodan aikana USA:n ilmavoimien strategisten pommitusten tehokkuutta arvioivassa, suunnittelevassa ja kehittävässä organisaatiossa. Kuten myöhempi kriittinen tutkimus on voinut osoittaa jo heti sodan jälkeen voitiin havaita etteivät strategiset pommitukset, atomipommeja lukuun ottamatta, olleet tosiasiassa vihollisen vastarinnan ja taistelukyvyn murtamisessa läheskään niin tehokkaita kuin luultiin. Vastoin yleistä luuloa ei esimerkiksi Saksan sotateollisuustuotantoa kyetty suinkaan nujertamaan pommituksilla ja lisäksi voitiin havaita että saksalaisten taistelutahto tosiasiassa ehkä jopa vahvistui pommituksista huolimatta tai jopa niiden takia.

Sodan voittanut osapuoli yleensä väistää vallitsevaa ajattelutavan vastaiset tosiasiat. McNamara Vietnamin sodan aikaisena puolustusministerinä yhdessä hengenheimolaistensa kanssa toi kuitenkin strategisen pommitusideologian sekä matemaattisen body count-mallin USA:n asevoimien keskeiseksi onnistumisen mittareiksi. Teknokraattina ja kapeakatseisena ”pikkuinsinöörinä” hän luuli sotatoimien oltavan sellaisenaan numeroina analysoitavissa. Hän lanseerasi peliteoreettisen ajattelun ja ns. ”body count” laskentaperusteen Pentagonille Yhdysvaltojen lähtiessä Vietnamin sotaan.

McNamara ei ollut ajattelutavoiltaan poikkeus. USA:n sotatoimien ylin johto kenraali Westmorelandista divisioonien ja prikaatien komentajiin olivat kaikki II maailmansodan veteraaneja ja tuon aikakauden sotilaallisen teknoajattelun tuotteita. Indokiinassa teknokraatit ja vanhat sotilaat joutuivat kuitenkin sellaiseen sotaan jonka sisäistämiseen Julian Ewellin ja Ira Huntin tapaisilla ammattisotilailla ei ollut älyllistä kapasiteettia.

Niinpä lopputulos oli arvattavissa. Operaatio Speedy Express, My Laista nyt puhumattakaan, ei ollut yksittäinen poikkeus. Koko USA:n sodankäynti Indokiinassa johti käytännössä kansanmurhaan. Nuorista vauraan länsimaan asevelvollisista ja vapaaehtoisista sotilaista koottu sotavoima joutui sotaan joka oli hyvin kaukana II maailmansodan rintamasodankäynnistä. Psykologisesti ja emotionaalisesti tällä oli hirvittävä vaikutus nuoriin amerikkalaisiin sotilaisiin. Se mitä asevoimilla oli tarjottavana toinen toistaan järkyttyneimmille rivisotilailla oli lähinnä vanhat kuluneet poliittiset latteudet, mitäänsanomaton viihde sekä pöyristyttävä rasistinen suhtautuminen ei vain ns. vihollistaistelijoihin vaan kaikkiin vietnamilaisiin. ”Body count”-ideologia seurauksineen johti lopulta USA:ssa ennen kokemattomaan sodanvastaisuuteen. Tämän ilmapiirin synnyttämisessä sodasta palanneet veteraanit ja etniset vähemmistöt näyttelivät ratkaisevan tärkeää osaa. 


( Päivitetty: 09.04.2012 08:20 )

 - pelontorjunta | Kommentoi



 Vietnamin sota
04.04.2012 19:05 | pelontorjunta

 

Indokiinan alue ei ole ollut enää vuosiin – onneksi - maailmanpolitiikan polttopisteessä ja niinpä useimmille ihmisille Vietnamin sota, tai kuten vietnamilaiset itse sitä nimittävät Amerikan sota, on nykyisin karmea ajanjakso jostain hyvin kaukaisesta menneisyydestä. Sodan syyt ja muut taustat ovat useimmilta hukassa tai ne perustuvat virheellisiin lähinnä USA:n virallisiin doktriineihin, joissa sotaa perusteltiin ”viileän analyyttisesti” vain osana kylmän sodan hegemoniakamppailua ”idän” ja ”lännen” välillä. Tosiasiassa sota oli pikemminkin pohjoisen sota etelää vastaan. Aivan kuten useimmat myöhemmät sodat joita USA on käynyt. Vietnamin sota on kuitenkin siinä mielessä hyödyllinen tutkimuskohde, että se selittää miksi nykyisin USA pyrkii mahdollisimman ”pehmeisiin maaleihin”. Periaatteena voidaan pitää sitä, että sellaisen kimppuun ei hyökätä joka voi iskeä takaisin. Vietnam sota on ollut viimeinen USA:n käymä sota jossa amerikkalaisten kipukynnys tuli vastaan kun omia sotilaita oli kuollut jo kymmeniä tuhansia. Kohdemaan uhreista USA ei silloin kuin ei nykyäänkään juurikaan välitä. Varsin uskottavan arvion mukaan Vietnamissa tapettiin USA:n invaasion seurauksena n. 4 miljoonaa ihmistä, joista ylivoimainen enemmistö täysin viattomia siviilejä.

Yleinen amerikkalainen näkemys vuosien 1954-1975 sodasta Vietnamissa (sekä laajennettuna Kamputseassa ja Laosissa) perustui väitteeseen jonka mukaan vietnamilaiset sotivat vietnamilaisia vastaan ja amerikkalaiset tulivat ikään kuin vahingossa ”vedetyksi mukaan” konfliktiin ”erehdyksessä” mutta ”kunniallisesti”. USA:n pyrkimykset selitetään yhä vilpittömiksi ja tämän näkemyksen USA:ssa (ja osin muuallakin lännessä) jakavat niin ”haukat” kuin ”kyyhkytkin”. Näin perusasetelma esitettiin ja esitetään valitettavan usein yhä mediassa.

Oletus on väärä, virheellinen ja epärehellinen. 1900-luvun pisimmässä sodassa USA tosiasiassa soti sekä Pohjois- että Etelä-Vietnamia vastaan. Sekä kommunisteja että ei-kommunisteja vastaan. Se oli invaasio vietnamilaisia vastaan aivan samalla tavalla kuin myöhempi neuvostoliittolaisten invaasio Afganistaniin. Kumpikaan ei suinkaan perustunut mihinkään ”virheeseen”. On vain niin että sotilaallinen tavoite (vastustajan sotilaallinen tuhoaminen) johti myöhemmin selityksiin ”virheestä”. Monet ovat väittäneet että media myötävaikutti USA:n tappioon Vietnamissa, koska media olisi muka ollut sotaa vastaan. Kuten myöhemmin tulemme huomaamaan kaikki osa-alueet tässä väitteessä ovat pielessä. Media ei ollut sotaa vastaan sinänsä ja monissa keskeisissä analyyseissään sodasta se oli pihalla kuin lumiukko.

Konteksti jossa Vietnamin väitettiin luisuneen Neuvostoliiton vaikutuspiiriin on kriittinen. Vietnam oli nimittäin lähestynyt vuosien ajan USA:ta saadakseen taloudellista apua yhteiskuntansa rakentamiseen. Toinen maailmansota (Japanin miehitys) sekä erityisesti Ranskan toimet heti sodan jälkeen (ns. ensimmäinen Vietnamin sota 1945-54) olivat olleet äärimmäisen raskas koettelemus maalle. Jopa presidentti Roosevelt oli todennut kuinka ”Ranska oli vuosisadan ajan lypsänyt maata”, että ”Vietnamin kansa ansaitsisi jotain parempaa” ja että ”USA tukisi Vietnamin itsenäisyyttä ja itsemääräämisoikeutta”. Kommunistijohtaja Ho Chi Minh (kuvassa kesk.) piti amerikkalaisista ja iloitsi ”amerikkalaisten avoimuudesta”.

Ho Chi Minh oli yhdessä asiassa vastakohta muille kommunistijohtajille. Hän halusi omien kansalaistensa avautuvan muille yhteiskunnille, sosialistisille, kapitalistisille ja puolueettomille. Jugoslavian Titon tavoin hän tiesi tämän suuntauksen olevan ainoan mahdollisuuden Vietnamin yhtenäisyydelle. Itseasiassa niin halukas Ho Chi Minh oli lähestymisessään USA:n suuntaan että peräti 12 kertaa hän lähestyi näissä tarkoituksissa joko presidentti Rooseveltia, tämän ulkoministeriä Cordell Hullia tai senaatin ulkoasianvaliokuntaa. Majuri Patti (CIA:ta edeltäneen organisaation yhdysupseeri) kirjoitti myöhemmin että Ho ei vedonnut sotilaallisen tai taloudellisen avun puolesta vaan

 

" ymmärryksen, moraalisen tuen vuoksi ja jotta [Vietnam] voisi saada äänen läntisten demokratioiden joukossa. Mutta USA ei lukenut hänen viestejään koska, kuten minua informoitiin, Vietnamin Demokraattista Tasavaltaa ei USA:ssa huomioitu ja että olisi ”alentavaa” (improper) presidentille tai muille auktoriteeteille tunnustaa moinen kirjeenvaihto.”

 

Ho Chi Minh oli ollut 15 vuoden ajan yhteyksissä Moskovan kommunistihallintoon ja hän tiesi miten hatara ja ehdollinen Neuvostoliiton ”ystävyyden” luonne oli. Hän kertoi majuri Pattille:

Tukeudun mieluummin USA:han itsenäistymisessä kuin Neuvostoliittoon.”

Kun USA niputti Vietnamin samaan porukkaan kommunistisen Kiinan ja Neuvostoliiton kanssa ei Ho Chi Minhille jäänyt muuta mahdollisuutta kuin kääntyä näiden puoleen.

Toisen maailmansodan aikana Minh oli toiminut yhteistyössä amerikkalaisagenttien kanssa amerikkalaislentäjien pelastamiseksi japanilaisilta. Sodan päätyttyä otti Britannian siirtomaakomentaja kenraalimajuri Douglas Gracey (kuvassa vas.) syyskuussa 1945 vastaan japanilaisten antautumisen Saigonissa mutta aseisti välittömästi uudelleen nämä kukistamaan Vietminh, joka oli jo asettanut hallinnon Vietnamin eteläisiin osiin. Kuten Vietminh pohjoisessa, se oli hyvin suosittu poliittinen liike etelässä katolilaisten, buddhalaisten, pienyrittäjien, kommunistien ja maanviljelijöiden keskuudessa, jotka näkivät Ho Chi Minhin ”kansakunnan isänä”. Brittien ja kenraalimajuri Graceyn ansioista ranskalaiset saattoivat palata valtaan Saigonissa.

Saadakseen ranskalaiset pois Vietnamista lähestyi Ho Chi Minh jälleen USA:ta. Minh vetosi Pattiin ja amerikkalaisiin todeten ettei ole kommunisti sillä tavoin kuin asia USA:ssa ymmärretään. Hän toisaalta varoitti olevansa pakoitettu hakemaan liittolaisia sieltä mistä niitä on saatavilla, sillä muutoin vietnamilaisten on lähdettävä (taisteluun ranskalaisia vastaan) yksin. Vasta kommunistien nousu valtaan Kiinassa v. 1949 avasi Vietminhille mahdollisuuden lyödä ranskalaiset kun avoimen rajan yli voitiin saada aseistusta, koulutusta sekä piilopaikkoja.

Olemassa olevien dokumenttien kautta on selvästi havaittavissa että Ho Chi Minh ja Vietminh vetosivat nimenomaan USA:han Vietnamin itsenäisyyden ja yhtenäisyyden tuen saamiseksi. Vasta sen jälkeen kun amerikkalaiset toistuvasti olivat torjuneet Minhin vetoomukset kääntyi tämä neuvostoliittolaisten ja kiinalaisten puoleen. Miksi USA torjui Vietnamin ylivoimaisesti merkittävimmän ja suosituimman poliittisen liikkeen tarjouksen yhteistyöstä?

Selitys on löydettävä USA:n pyrkimyksestä globaaliin maailmanvaltaan. Ho Chi Minhin ja Vietnamin kohtalo ei ollut kommunismi, tai mikään muu yleisesti luultu poliittinen syy. Vietminhin Vietnam edusti amerikkalaiselle poliittiselle eliitille sellaista pyrkimystä riippumattomuuteen, suvereniteettiin ja itsenäisyyteen joka ei sopinut globaaliksi maailmanvallaksi juuri nousseelle USA:lle. Kaakkois-Aasia kokonaisuudessaan edusti aluetta johon liittyi strategisia resursseja, tukikohtia ja muita etuja. Oli pelättävissä että menestyksellinen itsenäinen kehitys radikaalin johtajuuden alla saattaisi muodostaa syyn ”mädän leviämiselle”, syövyttäisi USA:n hegemonian alueella ja muodostaisi uhan että Japani liittyisi mukaan suljettuun järjestelmään josta USA on pelattu ulos. Ajatus jonka mukaan USA:n globaaleilla suunnittelijoilla olisi kansallisia imperialistisia motiiveja on sietämätön opilliselle järjestelmälle, joten tällaista aihetta olisi syytä piilottaa julkiselta keskustelulta.

Julistaessaan opin kommunismin eristämisestä pumppasi USA:n hallitus Ranskalle vuonna 1950 10 miljoonaa dollaria jotta se saisi Vietnamin pohjoisia provinsseja takaisin hallintaansa. Neljän seuraavan vuoden aikana USA maksoi 78% Ranskan sotamenoista Indokiinassa. Näitä samoja ranskalaisia presidentti Roosevelt oli arvostellut aikoinaan. Sodan käännyttyä ranskalaisille tappiolliseksi päädyttiin Geneven rauhanneuvotteluissa kesällä 1954 VÄLIAIKAISEEN sopimukseen jossa maa jaettiin kahteen osaan. Ranskan tappio Dien Bien Phun taisteluissa johti siihen, että USA antoi tappion lievitykseksi Ranskalle mm. kaksi atomipommia. Geneven sopimuksessa jaetut osat Vietnamista yhdistettäisiin kaksi vuotta myöhemmin (1956) pidettävien vaalien jälkeen. Kiina osallistui Geneven neuvotteluihin paitsi murtaakseen diplomaattisen eristyksensä myös ollakseen mukana ”valvomassa takapihaansa”.

Noita sovittuja vaaleja ei koskaan pidetty. Presidentti Eisenhowerin (tiedustelulta saaman) arvion mukaan Ho Chi Minh olisi voittanut presidentinvaalit aivan ylivoimaisesti jos ne olisi pidetty (todennäköisesti yli 80% äänistä). Itseasiassa koko Vietnamissa Vietminh oli ainoa todella merkittävä organisoitunut poliittinen liike. Vietnamin eteläosiin pystytettiin hallinto jonka johtoon USA nosti Ngo Dinh Diemin.

 

Amerikkalaiset ”neuvonantajat”

1950-luvun lopun ja 1960-luvun alun amerikkalaiseen poliittiseen toimintaan kuului CIA:n liikkeelle laskemat erityyppiset hiuksia nostattavat uutiset Vietnamin pohjoisosissa tapahtuvista verilöylyistä ja siitä kuinka pohjoisosien vietnamilaisia on pakotettu pakenemaan etelään. Tarkoituksena oli motivoida amerikkalainen yleisö vaatimaan että ”jotain täytyy tehdä”. Vietnamin eteläosissa Vietminhin kannattajat perustivat NFL:n (Kansallinen Vapautusrintama) vuonna 1960. Muutamaa vuotta myöhemmin tähän itse asiassa huomattavasti enemmän poliittiseen kuin sotilaalliseen ruohonjuuritason järjestöön kuului ehkä 300 000 peruskannattajaa. Provinsseissa se oli ylivoimaisesti merkittävin ja suosituin poliittinen organisaatio joka organisoi kyläyhteisöt omaehtoisiksi yksiköiksi kouluineen, terveys- ja hallintajärjestelmineen. Juuri tässä vaiheessa USA:n presidentti John F. Kennedy (kuvassa oik.) aloitti USA:n sotilaallisen väliintulon Vietnamissa. Kolmen vuoden kuluttua maassa oli jo yli 14 000 amerikkalaista sotilasta, joita kutsuttiin ”neuvonantajiksi”. Väitteet siitä että John F. Kennedy olisi voinut estää Vietnamin sodan laajenemisen jos olisi saanut elää ovat hyvin kyseenalaisia. Todellisuudessa hän varsinaisesti aloitti USA:n sotilaalliset toimet Vietnamissa. Hänen kabinettinsa koostui samoista henkilöistä jotka runsas vuosi myöhemmin alkoivat vain tuoda lisää amerikkalaista sotavoimaa maahan. Kennedyn kuoleman aikoihin USA:n tukema koneisto Vietnamin eteläosissa oli murhannut jo n. 80 000 ihmistä.

Presidentti Diem julisti Etelä-Vietnamin, vastoin Geneven neuvotteluja, itsenäiseksi valtioksi. Diemin ylellinen hallinta, nepotismi ja korruptio nosti kapinaliikkeen Etelä-Vietnamin asevoimien sisällä. Ilman USA:n tukea kapinaliike ei olisi koskaan kuitenkaan kukistanut Diemiä. Keskustiedustelupalvelu CIA:n organisoima salaliitto josta presidentti Kennedy oli hyvin tietoinen syrjäytti ja tappoi Diemin.

Diemin syrjäyttämisen jälkeen seurasi joukko salaliittoja ja kenraalien syrjäyttämisiä Etelä-Vietnamin johdosta. USA:ssa asioita perusteltiin yleisölle valtataisteluna. Todellisuudessa sotilasjohtajien syrjäyttämisen taustalla oli CIA eli USA itse. Useat näistä kenraaleista pyrkivät neuvottelusopimukseen NFL:n kanssa jotta verinen sisällissota olisi ollut vältettävissä. Niin kauan kuin näitä neuvotteluihin pyrkiviä ”roistoja” ilmeni heidät eliminoitiin.

George Kahinin tutkimukset osoittavat kuinka nämä syrjäytetyt kenraalit pyrkivät neuvotteluratkaisuun eri poliittisten puolueiden (ml. NFL) jotta Vietnamin eteläosat olisivat välttäneet amerikkalaisten intervention ja sodan. Kenraalien antamat lausunnot osoittivat että he pitivät NFL:ää valtaosaltaan ei-kommunistisena poliittisena liikkeenä. Historioitsija David G. Marrin mukaan kenraalien heittäminen ”yli laidan” on lopullinen signaali Etelä-Vietnamin asevoimien ylimmille upseereille ja poliitikoille että jokainen yrityskin neuvotteluratkaisuun NFL:n kanssa tulee välittömästi johtamaan amerikkalaisten vastatoimiin. Tie neuvotteluratkaisuun oli vietnamilaisilta suljettu.

 

"Etelä-Vietnam" ja "Pohjois-Vietnam"

Standardiversio miten Vietnamin tilanne amerikkalaiselle (ja läntiselle) yleisölle yleensäkin selitettiin on kuvaava. Amerikkalaiset kuvattiin olevan ”hyvän porukan” puolella taistelemassa ”pahoja” monentyyppisiä ”kommunistiporukoita” vastaan. ”Hyvät” olivat etelävietnamilaisia. Mutta miten selittää sitten se, että kaikesta valtavasta pomminkylvämisestä ja joukkomurhaamisesta sitten kohdistui 70-80%:sti juuri USA:n omiin ”liittolaisiin”, etelävietnamilaisiin?

Koko terminologiavalikoima oli suorastaan älytön. ”Etelävietnamilaiset” ja ”pohjoisvietnamilaiset” olivat lähinnä vilkkaan poliittisen määrittelyn terminologiaa. Saigonin USA:n pystyttämän hallinnon johdossa oli lukuisia henkilöitä jotka olivat kotoisin Vietnamin pohjoisosista. Hanoin hallinnossa oli lukuisia Vietnamin eteläisistä osista kotoisin olevia. NFL:ään kuului niin Vietnamin pohjoisosista kuin eteläosistakin kotoisin olevia. Kun laajemmat sotatoimet vuosina 1965-66 alkoivat siirtyi ensimmäisenä Vietnamin eteläosiin pohjoisesta ihmisiä NFL:n riveihin jotka olivat juuri kotoisin Vietnamin eteläosista.

Kysymykseen siitä ketä ”kommarit” olivat saa omituisia vastauksia. Jos NFL:n ihmiset – tai kuten USA heitä nimitti ”Vietkongilaiset” - olivat etelävietnamilaisia, niin kuinka he saattoivat siis tunkeutua omaan maahansa? Tarvitaan siis sanoja kuvaamaan sitä miten ihmiset puolustivat omaa maatansa amerikkalaisten invaasiolta. Propagandalla oli myös tiettyjä vaikeuksia ”pohjoisvietnamilaisten” kanssa. Ennen Geneven konferenssia v.1954 ei ollut mitään Pohjois-Vietnamia ja Etelä-Vietnamia. Lisäksi tuolloin synnytetty jako oli sopimuksessa myös esitetty ”väliaikaiseksi” ja jaon oli määrä päättyä vuoden 1956 vaaleihin, jotka USA siis esti. Kun USA aloitti sotatoimet Vietnamin eteläosissa olivat ensimmäisenä heitä vastustamassa NFL:n miehet ja naiset jotka olivat jokseenkin täysin etelävietnamilaisia. He saivat sittemmin ensimmäisessä vaiheessa täydennystä pohjoisesta sellaisista vietnamilaisista, jotka olivat myös kotoisin Vietnamin eteläosista.

Vietnamin sodan aikana maassa toiminut länsimainen media meni käsitteissä usein täysin sekaisin ja useimmille eteenkin amerikkalaisille toimittajille koitui kohtaloksi niellä koko virallinen jargon ”Etelä-Vietnamista” ja ”Pohjois-Vietnamista”, ”hyvistä” ja ”pahoista”. Useimmat eivät viitsineet vaivautua tutkimaan Vietnamin ainakin tuhatvuotista ongelmallista suhdetta sen perinteiseen suurvaltauhkaan – Kiinaan.

 

Tonkinin lahden lavastus

Vietnamin sodassa oli siis pohjimmiltaan kyse liian riippumattomaksi ja itsenäiseksi pyrkivän kehitysmaan joutumisesta suurvallan aggression kohteeksi. Koska sotaan kerran haluttiin Washingtonissa lähteä tarvittiin tietysti jonkilainen syy. Ja syy aina keksitään.

Vuosina 1971-72 vuodatti joukko USA:n touhuihin kyllästyneitä sisäpiiriläisiä Washingtonissa asiakirjat jotka paljastivat ns. Tonkinin lahden tapahtumat elokuussa 1964. Asiakirjat eivät sinänsä olleet kovinkaan mullistavia. Lyhyesti sanottuna elokuun alussa amerikkalainen vakoilualus USS Maddoxin ”kimppuun hyökättiin”. Maddox tunkeutui vakoilu- ja provosointitehtävissä ja kävi laukausten vaihdon vietnamilaisaluksen kanssa 2.8.1964. Amerikkalaisalus avasi tulen ensin. Kaksi päivää myöhemmin samainen alus väitti joutuneensa torpedohyökkäyksen kohteeksi. Hyökkäystä ei koskaan tapahtunut. Tämä jälkimmäinen episodi on myöhemmin tarkkaan selvitetty.

Mutta itseasiassa amerikkalaiset itse olivat suunnitelleet Tonkinin lahden tapahtumat jo kaksi kuukautta aiemmin. Jopa ääninauhat kertovat kuinka USA:n silloinen puolustusministeri, harvinaisen kapeakatseinen teknokraatin ja insinöörin maailmakuvalla varustettu Robert McNamara kertoo siinä presidentti Johnsonille, kuinka toisen hyökkäyksen jälkeen USA tulee saamaan aiheen sotilaallisiin toimenpiteisiin Pohjois-Vietnamia vastaan. Puolustusministeri tiesi ”toisesta hyökkäyksestä” ennen kuin sen oli määrä edes tapahtua (4.8.1964).

USA:n poliittisen järjestelmän rikkumattomasta yksimielisyydestä kertoo jotain se, että presidentti Johnsonille laajat valtuudet sodan aloittamiseen antoi senaatti lähes yksimielisesti. Vain Wayne Morse Oregonista ja Ernest Gruening Alaskasta vastustivat päätöstä ja niin amerikkalaiset aloittivat yli neljän miljoonan vietnamilaisen ja satojen tuhansien kamputsealaisten ja laosilaisten teurastuksen.

 

Miksi aggression pääkohteeksi valittiin Vietnamin eteläosat?

USA:n poliittinen ja sotilaallinen eliitti selitti siis sodan osapuoliksi ”Etelä-Vietnamin” ja ”Pohjois-Vietnamin”. Ensiksi mainittu oli osapuoli, jota USA ”puolusti”. Vain aivokääpiö ei tässä vaiheessa esitä kysymystä, että miksi USA kohdisti aggressionsa pääasiassa (n. 80%:sti) juuri Vietnamin eteläosiin. Jos kerran aggression tielle lähdetään niin miksi pohjoisosat Vietnamissa pääsivät sittenkin vähemmällä? USA:n oman Vietnamin sodan selitysmallin mukaan olisi päämaalitaulun pitänyt olla juuri ”Pohjois-Vietnam”.

Kuten edellä jo mainittiin USA noudattaa nykyisin periaatetta jossa kohteeksi valitaan ”pehmeitä maaleja”. Sellaisen kimppuun ei hyökätä joka voi iskeä takaisin. Tätä samaa logiikkaa noudatettiin jo Vietnamin sodan aikaan. Vietnamin pohjoisosissa oli kiinalaisten rautatieyhteyksiä ja tärkeitä siltoja, kiinalaisia ja neuvostoliittolaisia laivoja, aluksia ja muuta materiaaleja. Ts. Pohjois-Vietnamissa on amerikkalaisten kannalta aivan liian vaarallisia kohteita. Jos he olisivat lähteneet massiivisempaan Pohjois-Vietnamin tuhoamisoperaatioihin olisi se johtanut riskiin, että niin Kiina kuin Neuvostoliitto olisivat voineet jossain muualla tai jopa Vietnamissa suorittaa omia vastatoimiaan.

Etelä-Vietnamissa tilanne oli toisin. Siellä oli ”pehmeitä kohteita” rajoittamattomasti. Siellä oli ”vain ihmisiä”. Etupäässä tuolle suhteellisen suppealle alueelle pudotettiin mm. valtaosa Vietnamin sodan tai Amerikan sodan n. 8 miljoonasta tonnista erityyppisiä pommeja. Määrä oli moninkertainen verrattuna kuinka paljon pudotettiin Länsi-Eurooppaan koko II maailmansodan aikana.

 

Hävisikö USA Vietnamin sodan?

Useimmat ihmiset niin USA:ssa kuin muuallakin uskovat että USA hävisi Vietnamin sodan. Jos sodan tavoitteena olisi ollut NFL:n ja ”Pohjois-Vietnamin” sotilaallinen täydellinen tuhoaminen ja alueiden ottaminen haltuun niin on selvää ettei USA onnistunut operaatiossa. Mutta jos palautamme mieleen USA:n todellisen tavoitteen, riippumattomaksi kehittyväksi maaksi pyrkivän ankaran rankaisemisen ja tuon maan toiveiden murskaamisen, voimme päätyä vain yhteen johtopäätökseen: USA voitti sodan Vietnamissa. Se onnistui tavoitteessaan. Vietnamin riippumaton myönteinen kehittyminen oli estetty sukupolvien ajaksi kun maan talous, maaperä, vesistö ja väestön siedettävät elinolosuhteet tuhottiin brutaalilla sodankäynnillä.

 

Most people believe that the US lost the war. But by destroying Vietnam to its core, by poisoning the earth, the water and the gene pool for generations, Washington had in fact achieved its primary purpose: preventing what might have been the rise of a good development option for Asia.”

(William Blum, ”Roistovaltio – maailman ainoa supervalta”)

USA:n poliittiselle johdolle on 1900-luvusta lähtien ollut sinänsä täysin yhdentekevää minkä tahansa maan yhteiskunnallinen järjestelmä. Maa voi olla periaatteessa demokratia, diktatuuri, kommunistinen, sekularisoitunut, teokraattinen – mikä tahansa. Ratkaisevaa on sen geopoliittinen ja strateginen sijainti, pyrkiikö tällainen maa liian itsenäiseksi ja riippumattomaksi suhteessa USA:han ja pystyykö maa mahdollisesti vastatoimien kohteeksi joutuessaan ”iskemään takaisin”. Juuri se selittää sen miksi USA ei koskaan aloittanut sotatoimia esim. Neuvostoliittoa tai Kiinaa vastaan. Vietnam ja varsinkin sen eteläinen osa ei ollut yhtä onnekas. Vietnamista haluttiin tehdä varoittava esimerkki eteenkin muille kolmannen maailman maille.


( Päivitetty: 04.04.2012 20:39 )

 - pelontorjunta | Kommentoi



 Kielletty hedelmä – opettajan ja oppilaan intiimi suhde
10.03.2012 13:11 | pelontorjunta

"Haluatko ottaa uudestaan? Haluan. Haluan ottaa uudestaan." (Notes On A Scandal, 2006)

Get the Flash Player to see this player.

 

 

 

Vuonna 2006 ohjasi Richard Eyre elokuvan ”Paljastavat merkinnät” jossa käsiteltiin varsin taidokkaasti yksinäisyyden ja halun teemoja, sekä paljastettiin rakkauden ja riippuvuuden rajan häilyvyyttä. Elokuva on synkeäjuonteinen draamatrilleri, jonka suurimmat käänteet tapahtuvat henkilöhahmojen kehityksessä. Kuvaamataidonopettaja Sheba (Cate Blanchett) aloittaa työt Barbaran (Judi Dench) koulussa noviisina pitkän äitiysloman jälkeen. Barbara on tiukkasanainen ja -katseinen vanhapiika, joka kuitenkin pienen sulattelun jälkeen ystävystyy Sheban kanssa. Ystävyyssuhde saa pian jännitteitä, kun Barbara kiintyy Shebaan yhä enemmän ja saa yllättäen tietää tämän seksuaalisuhteesta alaikäiseen 15-vuotiaaseen oppilaaseen. Elokuvassa oli siis esillä valtavirrasta poikkeavaa kaksi rakkausteemaa, lesborakkaus sekä aikuisen ihmisen rakkaus- ja seksuaalisuhde alaikäiseen. Myös sukupolvi- ja luokkaeroja sivutaan, ollaanhan Britanniassa. Median verenhimoisuus pedofilian tapaisten skandaalien käsittelyssä tulee myös esille. Muodollisilta ja juonellisilta rakenteiltaan Paljastavat merkinnät on hillitty, mutta tyylikäs kuin elokuvan keskiluokkainen koti.

Oli jossain määrin kiinnostavaa havaita kuinka eräät ”edistykselliset feministit” mitä ilmeisemmin lesbomyönteisellä virityksellä teilasivat elokuvan kahden keskeisen hahmon välisen suhteen käsittelyn. Käsikirjoitusta ja nimenomaan Judi Denchin esittämää hahmoa haukuttiin ”yliampuvaksi” ja väitettiin että se noudattelee tunnistettavasti 1950- ja 1960-luvun skandaalielokuville tyypillistä "häiriintyneen lesbon" kaavaa. Tässä viitattiin esim. ”Sisar Georgen surmaan”, vuodelta 1968. Niissä homoseksuaali nainen oli itsetuhoinen surkimus tai ”Paljastavien merkintöjen” tapauksessa ”ahnas ja häikäilemätön tyttöjen ahdistelija”. Monet näistä ns. kriitikoista hämmästelivät kuinka Judi Denchin ja Cate Blanchettin kaltaiset ”älykkäät naiset” ovat lähteneet mukaan ”näin tympeään tuotokseen”.

Petri Sipilä kirjassaan ”Sukupuolitettu ihminen - kokonainen etiikka” väitti että lesbofeministit katsovat miehiä niin karsaasti, että heidän suurin huolensa suvunjatkamisen suhteen on se, miten lisätä lesbojen määrää siten, että miesten sukupuolielimiä ei tarvittaisi lainkaan. Tämän näkemyksen mukaan lesbojen eettisenä ihanteena on pelkästään lesbojen kansoittama yhteiskunta. Koska miehiä tässä kuitenkin tarvitaan, lesbojen ratkaisu on tyytyä pitkin hampain spermapankkeihin ja alistaa miehiä käyttämällä heitä pelkkinä siitosoreina. Ja ne syntyvät poikalapset, joita ei tarvita edellä mainittuun tehtävään, eliminoidaan armotta. Tämä mustalla huumorilla sävytetty kauhukuva lesbofeministeistä tuskin löytää vastinetta todellisuudesta. Tasa-arvofemismin suhteen Sipilä väitti, että elämme jo "naarashegemonian" kynnyksellä ja että naislähtöisestä diskurssista on muodostumassa hallitseva diskurssi. Eräät tuoreet tutkimukset ovat tuoneet joka tapauksessa esiin seikkoja jotka osoittavat että lesbojen keskuudessa ilmenee myös merkittävän paljon väkivaltaa.

Ajallemme on merkillistä se kuinka ns. seksuaalinen vapautuminen noudattaa kaksoisstandardia. Homoseksuaalinen rakkaus näytetään nostetun poliittisesti korrektien asioiden listan kärkisijoille. Siitä on tehty lähes hyve ja ”edistyksellisyyden” mitta. Tämä näkyi mm. Suomen vuoden 2012 presidentinvaaleissa. Sen sijaan rakkaus alaikäiseen on itse asiassa – jos huomioimme moraalikoodiston yleisen muutoksen länsimaissa - jopa hämmästyttävässä määrin homorakkauteen peilattaessa yhä tabu. Aikuisen ja alaikäisen välinen intiimi suhde on eräs länsimaisen kulttuurin viimeisiä tabuja ja tällaisten tapausten käsittely erityisesti mediassa saa usein lähes groteskeja noitavainomaisia piirteitä.

Erityisesti USA:ssa on paljastunut 2000-luvulla merkittävä määrä opettajien ja oppilaiden välisiä rakkaus- ja seksuaalisuhteita. Opettajan ja oppilaan suhteet ovat olleet jo ammattikunnan sukupuolisen jakaumankin takia voittopuolisesti naisopettajien suhteita alaikäisiin oppilaisiinsa, yleensä poikiin. Suorastaan uskomatonta on ollut myös tuomioiden kovuus USA:ssa vaikka hyvin harvoin tapauksissa olisi ilmennyt yksiselitteistä pakottamista, väkivaltaa, uhkailua ja ”uhrin traumatisoitumista”. Huippua edustaa mm. 39-vuotiaan Alicia Schmiederin saama 40 vuoden vankeustuomio Georgiassa sukupuolisuhteesta 14-vuotiaaseen koululaiseen (sama tuomio kuin minkä sama osavaltio tuomitsee taposta). Stephanie Ragosa tuomittiin 10 vuodeksi vankeuteen Floridassa suhteesta 16-vuotiaaseen koululaispoikaan. Esim. Ranskassa pisin mahdollinen tuomio voi tämäntyyppisissä tapauksissa olla vain 10 kuukautta vankeutta.

Suomessa paljastuneet tapaukset ovat olleet -ainakin toistaiseksi - hyvin harvinaisia. Viitteitä tällaisista suhteista on tosin ollut kautta aikojen. On luultavaa että vain murto-osa näistä on paljastunut yleiseen tietoon. Opetusalan eettisen neuvottelukunnan kannanotossa 12.12.2000 asiasta mainittiin seuraavasti:

 

Opettajan ja oppilaan väliset seurustelusuhteet

Julkisuudessa on viritelty keskustelua opettajan ja oppilaan välisen seurustelusuhteen hyväksyttävyydestä sattuneen yksittäisen tapauksen pohjalta. Siksi on aiheellista esittää joitakin yleisiä periaatteita, jotka on otettava huomioon eettiseltä kannalta opettajan ja hänen oppilaansa läheisissä suhteissa. Konkreettisissa yksittäistapauksissa tulee ottaa kantaa paikallisesti tarkan asiatiedon, kokemuksen ja voimassaolevien säännösten pohjalta.

Ihastuksen, kiintymyksen ja läheisyyden tunteet ovat elimellinen osa ihmissuhteita ja elämää. Niihin liittyy paljon positiivista energiaa ja välittämistä. Siksi ne ovat voimavara myös opetuksessa ja kasvatuksessa. Jos opetussuhde seksualisoituu ja muuttuu seurustelusuhteeksi, on vaarana, että se uhkaa oppimista ja kasvua ja rikkoo eettisesti hyväksyttävät rajat opettajan ja oppilaan riippuvuussuhteessa.

Opettajan ja oppilaan välinen suhde on luonteeltaan luottamus- ja riippuvuussuhde, jonka tarkoituksena on mahdollistaa oppiminen. Sen tulisi myös tukea oppilaan kasvua sellaisella tavalla, joka sopii oppilaan kulloiseenkin tilanteeseen ja elämänvaiheeseen.

On tavallista ja enimmäkseen hyödyllistä, että oppilas ja opettaja tuntevat toisensa läheisiksi ja hyväksyviksi. Oppilaan taholta tähän liittyy toisinaan ihannointia, ihastumista ja jopa rakastumista. Vuorovaikutukseen liittyy molemminpuolisia tunnekokemuksia. Siksi on edellytettävä, että opettaja tuntee oman vastuunsa ja pitää ammatilliset rajat selkeinä ymmärtäen samalla oppilaansa reagointia. Tämä on tärkeää myös siksi, että jos oppilas on lapsi, opettajan ja oppilaan suhteen seksualisoituminen sisältää psykologiselta kannalta arvioituna väistämättä insestisiä piirteitä.

Opetusryhmän kannalta on tärkeää tasapuolisuuden vaatimus. Jos opettaja nostaa ihastuksensa kohteen erityisasemaan opetusryhmässä, se herättää katetutta, vihaa ja kilpailua vieden ryhmää pois perustehtävästä. Tämä näkökohta koskee myös niitä tilanteita, missä kysymys on opettajan ja aikuisopiskelijan välisestä läheisestä suhteesta. Opettajan olisi myös muistettava, miten hankalaan tilanteeseen ja jopa painostukselle alttiiksi hän voi joutua antautuessaan liian läheiseen suhteeseen oppilaansa kanssa.

Ajassamme on piirteitä, joissa korostuu koko elämän seksualisoiminen lapsuusvuosista asti. Kaupalliset intressit ja julkisuus käyttävät lapsien ja nuorten seksuaalisuutta omiin tarkoituksiinsa hyvin esineellistävästi.”

Kannanotossa on siis selvästi viittauksia siihen että opettajan ja oppilaan suhdetta verrataan psykoloogisesti jonkinlaiseen ”perheen jäsenten” keskinäiseen suhteeseen (viittaus ”insestisiin piirteisiin”). Samoin kiinnostava on se kuinka opettaja voi joutua potentiaalisesti kiristyksen uhriksi. Kolmas silmiinpistävä piirre on viittaus siihen että ihastuminen ja rakastuminen aloite olisi aina oppilaasta. Mutta kuten esimerkit USA:sta ja arkihavainnut kautta aikojen myös Suomessa osoittavat ihastuminen ja halu seksuaalisuhteeseen voi olla hyvin usein molemminpuolista ja on lukemattomia tapauksia joissa esim. naisopettaja on ollut hyvinkin aloitteellinen. Onpa tapauksia joissa naisopettaja on tuntenut voimakasta mustasukkaisuutta ja petetyksi tulemisen tunnetta jos oppilas on ihastunut johonkin toiseen ihmiseen. Opetusalan eettisen neuvottelukunnan kannanotto väistää mielenkiintoisella tavalla opettajan omat motiivit.

On tavallista, että opiskelija rakastuu opettajaansa. Opettaja on vanhempi, kokenut, tietää paljon ja häntä voi katsoa ylöspäin, ihailla, arvostaa ja kunnioittaa. Jos hänen olemuksensa viehättää, tilanteesta tulee vastustamaton. Tunteelle ei mahdeta mitään. Se voi tehdä opiskelun jopa hauskaksi ja mielenkiintoiseksi, motivoi lukemaan eikä kouluun meno tunnu ikävältä.

Millainen voisi olla se ilmapiiri jossa opettajan ja alaikäisen oppilaan välinen intiimi suhde – todellinen ”kielletty hedelmä” - saattaisi syntyä? Maailmalla paljastuneet tapaukset on silmiinpistävän usein koostuneet hyvinkin tunnollisten ja pidettyjen opettajien suhteesta oppilaisiin jotka ovat olleet usein yksinhuoltajaperheestä. Valtaosaltaan opettajat ovat eläneet päällisin puolin tasapainoista elämää. Useimmat olivat naimisissa, heillä oli omia lapsia.

Mutta kuten hyvin usein ennenkin, ”päällisin puolin tasapainoinen elämä” on joskus hyvinkin pettävä savuverho. Juuri tällaisesta ”nurmijärviläisestä idyllistä” tulee niitä aviokriisiä tai järkyttäviä perhetragedioita joista lähes päivittäin saamme joko lukea mediasta tai kuulla tuttavilta. Tällaisesta idyllistä ovat usein tulleet myös ne opettajat joiden suhteesta alaikäiseen oppilaaseen media maailmalla on kohissut. Miten on mahdollista että vakaassa parisuhteessa elävä opettaja saattaa ihastua aivan mahdottomalta tuntuvaan, ”moraalittomaan” ja naurettavana pidettävään suhteeseen alaikäisen oppilaan kanssa? Kiinnostavaksi asian tekee näiden tapausten selvä valtavirta – naisopettaja ja koulupoika. Syynä tavallisesti yksipuoliseksi jääväksi tunteeseen voi olla se, että sitä ei pidetä sopivana eikä mahdollisena ikäeron, naimisissa olemisen ja sosiaalisen tilanteen takia - eihän esimies-alainen-suhteitakaan katsota hyvällä. Rikolliseksi tapauksen tekee oppilaan alaikäisyys. Alaikäisyys on puolestaan kulttuurinen määritys joka näkyy lainsäädännössä.

On syytä pohtia sitä toimintaympäristöä jossa suhde voi syntyä. Toisaalta omassa parisuhteessaan vakiintunut aikuinen, toisaalta voimakkaan seksuaalisen heräämisen kokeva nuori. Opetustilanteessa saattaa vuosien mittaan syntyä tilanne jossa aikuinen ikään kuin laskeutuu oppilaittensa tasolle. Vuosikausia kestänyt työ on saattanut tietyssä mielessä samaistaa opettajan oppilaidensa maailmaan. Tunnollisilla, herkillä, empaattisilla ja vastuuntuntoisilla opettajilla on amerikkalaistutkimuksissa havaittu selviä hoivaamisen ja huolehtimisen tarvetta. Opettajista ollaan myös tehty päätehtävänsä – opettamisen - lisäksi sosiaalityöntekijöitä, pappeja ja psykologeja. Heille kasataan aivan kohtuuttomia vastuita oppilaistaan samaan aikaan kuin vanhempien vastuu omista lapsistaan on joskus lähes olematon. Lapsen kasvatus ulkoistetaan koululaitokselle ja empaattinen opettaja voi voimakkaasti eläytyä oppilaansa maailmaan suruineen, murheineen ja iloineen.

Mutta seksuaalisuhteen syntymiseen opettajan ja oppilaan välillä tarvitaan vielä jotain lopullisesti ratkaisevaa. Aikamme arvomaailmassa nuoruutta palvotaan. Jokainen haluaisi olla ainakin jossain määrin ”ikuisesti nuori”. Keski-ikäinen tai keski-ikäistyvä aikuinen tuntee päivä päivältä vanhenemisen paineen. Ja vaikka useimmilla oma nuoruus ei aina ollut erityisen hohdokasta ja ”upeaa aikaa” niin ajalla on taipumus kullata muistot. Ympäristössä jossa on satoja voimakkaan seksuaalisen heräämisen kokeneita nuoria ihmisiä on kuin hormonien myrskynsilmä jonka keskelle voi tulla opettaja joka haluaisi olla kuin nuori mutta joka tosiasiassa vaistoaa oman nuoruutensa loittonevan vääjäämättömästi. Kotona opettajaa odottaa vakiintunut parisuhde, perhe, velvollisuudet, vakaus – sekä intohimo, joka loistaa totaalisella poissaolollaan. Amerikkalaisittain ilmaistuna opettaja tulee siis ”valkoisten lankkujen ympäröivästä oman kodin onnelasta” joka voi olla todellisuudessa varsinainen intohimojen tuhoamiskeskus. Avioerot ovat kaikkialla länsimaissa järkyttävän yleisiä ja avioliitto yleisenä instituutiona on kiistatta kriisissä. Erot ovat sitä yleisempiä mitä voimakkaimmilla emotionaalisilla tunteilla varustettuja nämä ihmiset ovat. Henry Louis Mencken totesi jo lähes sata vuotta sitten että ”avioliitto on hieno instituutio, mutta kuka haluaa elää instituutiossa”. Cate Blanchettin näyttelemä roolihahmo lähes nelikymppinen opettaja Sheba Hart sanoi elokuvan ”Paljastavat merkinnät” eräässä kohdassa:

Perhe-elämä on kyllä ihanaa, mutta ei anna elämälle merkitystä. Se tuo velvollisuuksia, mutta ei auta --- tuntuu kuin valtava rako erottaa unelmat ...ja todellisen elämän”.

On myös olemassa salaisuuksien ja ”kielletyn hedelmän” kombinaation valtava voima. Maailmassa on tuhansia vuosia yritetty ehdollistamisella, lainsäädännöllä, syyllistämisellä ja muilla tempuilla kontrolloida sitä että mahdollisimman harva ihminen tarttuu kiinni ns. kiellettyyn hedelmään. Ja vaikka on totta että tämä on tehokas tapa vaikuttaa useimpiin ihmisiin (ovat riittävän ”asiallisia”), vielä useammat ihmiset eivät lankea, koska heiltä puuttuu henkilökohtaiset ominaisuudet (estot, pelko, viehätysvoiman puute, tilaisuus langeta). Mutta sitten on niitä joille juuri nämä ”vaaralliset asiat” ovat aivan liian vastustamattomia, joilla on mahdollisuus langeta ja joilla on edellytykset siihen. Opettaja Sheba Hartin tunnustus mainitussa elokuvassa siitä miksi hän lankesi kiteyttää asian:

Kerroin hänelle etten opettaisi häntä enää. Mutta hän kieltäytyi hyväksymästä sitä, hän vain tuli takaisin. Se alkoi tuntua kuin meidän salaisuudelta ja salaisuudet, ne voivat olla ...vietteleviä. Minua ei ole tavoiteltu tällä tavalla vuosiin ...tiesin että se oli väärin, moraalitonta ja täysin naurettavaa, mutta, en tiedä. Minä sallin sen tapahtua.

Tämä kuulostaa sairaalta, mutta tunsin ansaitsevani sen. Olen aina ollut hyvä aikuisena. Olen ollut kunnollinen vaimo, velvollisuudentuntoinen äiti lapselleni. Ääni sisälläni sanoi: ”Miksi että olisi paha, miksi et hairahtuisi? Ansaitset sen.”

 

Himo, kiihkeä halua saada jotakin, on vahva inhimillinen ominaisuus. Eikä tavoiteltavan asian arkaluontoisuus, moraalittomuus tai rikollinen luonne ole mikään varma pidäke. Monille ihmisille, niillekin jotka yrittävät selittää - ”en ainakaan minä koskaan” - ”kielletty hedelmä” on pikemminkin sytyke. Varsinkin jos sen vaihtoehtona on tylsä ja intohimoton avioliittoinstituutio, henkinen vankila.


( Päivitetty: 13.03.2012 15:35 )

 - pelontorjunta | Linkki



 Mobiilivallankumous syrjäytti perinteisen PC:n valta-asemasta
11.11.2010 18:12 | pelontorjunta

 

 

Vuosi 2011 merkitsi vallanvaihtoa. Ensimmäisen kerran mobiililaitteet - älypuhelimet ja tabletit - ohittivat myynnissä sekä monissa maissa jopa internetin hakupalveluissa perinteiset pc-tietokoneet. Peräti 61% myydyistä uusista internetiin kytkettävistä laitteista vuonna 2011 oli joko älypuhelimia tai tabletteja. Vuoden viimeisellä neljänneksellä niiden osuus uusista myydyistä laitteista oli jo 66,4%.

Yli 900 miljoonasta laitteista enää vain hieman yli 200 miljoonaan oli myyty tai asennettu valmiiksi Microsoftin lisenssioitu käyttöjärjestelmä (esim. Windows 7 tai WP). Googlen Android-järjestelmiä tai muita Linux-järjestelmiä myytiin jo huomattavasti Microsoftin käyttöjärjestelmiä enemmän. Myös Applen eri käyttöjärjestelmien (iOS ym.) määrät lähestyvät Microsofin lukemia.


( Päivitetty: 14.02.2012 17:05 )

 - pelontorjunta | Kommentoi



 Modernisaatio, sen ilmiöt ja seuraukset
16.01.2012 13:31 | pelontorjunta

Se kuva mikä meillä länsimaalaisilla on viime vuosikymmeninä syntynyt maailmasta on katastrofaalinen. Päivästä päivään tiedotusvälineet ovat kertoneet vihan täyttämästä ja väkivallan runtelemasta maapallosta, jossa yksilöiden murhat ja kansakuntien joukkomurhat seuraavat toinen toistaan jatkuvasti kiihtyvään tahtiin: Ruandan kansanmurha, Nigerian ja Norsunluurannikon uskonnolliset yhteenotot, Somalian klaanien taistelut, Sierra Leonen raaka sisällissota, rikollisuus ja raiskaukset Etelä-Afrikassa, joka kuitenkin on vapautettu apartheidistä, valkoisten murhat ja karkotukset Zimbabwessa, terrorismi Algeriassa, Georgia, Tsetsenian sota, Iran, Tadzikistan, Kolumbia, Haiti, Sudan, Sri Lanka, Filippiinien eteläosa, Palestiinan tilanne jne. Päätämme luettelon WTC-tornien tuhoutumiseen, jonka itsemurhaan valmiit ihmiset, jotka tulivat kolmanneksi maailmaksi kutsumalta alueelta, saivat aikaan ”Allahin nimeen”.

Vaikuttavan uutisoinnin jälkeen on vaikea olla tekemättä tuosta tapahtumien luettelosta johtopäätöstä, että maailma on hulluuden vallassa ja että elämme jotenkuten suojellulla saarella – siis jos emme pidä lähiöissämme poltettuja autoja ja muita ikäviä tapahtumia merkkeinä lännen barbarisoitumisena. Vallitseva kuva väkivallan runtelemasta maailmasta vahvistaa tiettyä historiankäsitystä: maailma taantuu. Nykytilanteesta löytyy objektiivisesti tarkasteltunakin tiettyjä tarkasti kuvattavissa olevia taantuvia aineksia. Median tarjoaminen hätkähdyttävien kuvien tuollakin puolella on mitattavissa kasvuvauhdin hidastumista maailmassa: epätasa-arvon lisääntymistä köyhissä ja rikkaissa maissa, taloudelliseen ja rahataloudelliseen globalisaatioon liittyviä ilmiöitä. Ihmisiä saatetaan kilpailemaan keskenään ja näin painetaan palkkoja ja maailmanlaajuista kysyntää alas. 

Jos kuitenkin kyseenalaistetaan vallitsevat oikeistolaiset ja vasemmistolaiset taloustieteelliset teesit ja ajattelu, marxilainen tai uusliberalistinen, voidaan suunnattoman tilastoaineiston avulla mitata nykyisen maailman uskomaton kulttuurinen kehitys, joka näkyy kahdessa perustuvanlaatuisessa asiassa: lukutaidon leviämisessä ja syntyvyyden alenemisen yleistymisessä.

 

Kulttuurinen vallankumous

 

Vuosien 1980 ja 2010 välillä yli 15-vuotiaiden luku- ja kirjoitustaidon suhteellinen osuus aikuisväestöstä on noussut esim. Afrikassa n. 70%:n, Aasiassa 80%:iin ja Etelä-Amerikassa 93%:iin. Saharan eteläpuolisessa Afrikassa yli puolet (54%) 15-vuotta täyttäneistä naisista on Unescon tilastojen perusteella lukutaitoisia. Tämä ilmiö on nähtävissä kaikkissa köyhissä maissa, ne tuntuvat sitoutuneen yleiseen kulttuurisen kehityksen kulkuun, jopa kaikkein hitaimmin kehittyvät maat kuten Mali jossa lukutaitoaste on sielläkin noussut 14%:sta v. 1980 40%:iin v. 2010 ja 47%:iin v. 2010. Prosenttiluku on yhä alhainen mutta jo 10 vuotta sitten malilaisista 15-24-vuotiaista oli 65% lukutaitoisia.

Päämäärää ei ole saavutettu; kulttuurisen kehityksen tasot ovat edelleen hyvin erillaisia. Mutta voidaan aavistella, että ei niin kaukaisessa tulevaisuudessa maapallon väestö on kokonaisuudessaan lukutaitoisia. Jos vielä kiinnitämme huomiota siihen, kuinka tämä kehitys nopeutuu jatkuvasti, voimme arvioida nuorten ikäluokkien olevan kokonaisuudessan lukutaitoisia kaikkialla maailmassa suunnilleen vuonna 2030. Kehitys on huikea huomioituna se että ihmiskunnalta meni 5000 vuotta kirjoitustaidon omaksumisessa.

Lukemisen ja kirjoittamisen oppiminen – unohtamatta mukana seuraavia laskennon alkeita – on vain yksi piirre tai etappi siinä älyllisessä vallankumouksessa, joka on levittäytynyt joka puolelle maailmaa. Opittuaan lukemaan, kirjoittamaan ja laskemaan ihmiset tapaavat lähes luonnostaan ottaa aineellisen ympäristön hallintaansa. Samaan tapaan kuin Euroopassa 1600-luvun ja 1900-luvun alun välisenä aikana, taloudellinen nousu on nykyään Aasiassa ja Latinalaisessa Amerikassa koulutuksen kehittymisen lähes väistämätön seuraus. Vapaakaupan ja taloudellisen globalisaation johdosta kehitys hidastuu ja vääristyy, mutta silti sitä on. Amerikkalaisten, eurooppalaisten ja japanilaisten tulisi tiedostaa, että tehtaiden siirtäminen maihin, joissa tuotantokustannukset ovat matalat, ei olisi ollut mahdollista ilman brasilialaisten, meksikolaisten, kiinalaisten, thaimaalaisten tai indonesialaisten koulutuksen kehittymistä.

Entisen kolmannen maailman työntekijät, joiden niukkojen palkkojen varassa Amerikan, Euroopan ja Japanin korkea palkkataso lepää, osaavat lukea, kirjoittaa ja laskea ja juuri siksi he ovat hyväksi käytettävissä. Niille alueille, joilla koulutus ei ole vielä kehittynyt samalla tavalla, kuten Afrikassa, tehtaita ei siirretä. Taloudellinen globalisaatio ei ole ajan kulusta riippumaton malli, vaan voiton maksimoinnin keino koko maailman kattavassa ympäristössä sellaisessa historian vaiheessa, jossa lukutaitoista työvoimaa löytyy suhteellisen paljon teollisen nousun ensimmäisten keskusten ulkopuolelta.

Koulutus on tekijä, joka osaltaan selittää nykyistä Eurooppaan ja Amerikkaan suuntautuvaa muuttoliikettä. Yksilöt, jotka tungeksivat rikkaan maailman porteilla, ovat toki vielä köyhien maiden materiaalisen kurjuuden ajamia. Mutta heidän halukkuutensa paeta kurjuutta paljastaa jatkuvasti kasvavan imun, joka on seurausta lukutaistoisten nykyään huomattavasta määrästä alkuperämaissa. Koulutuksella on lukemattomia seurauksia. Yksi niistä on väestön henkinen irtautuminen juuriltaan.

 

Väestöllinen vallankumous

 

Lienee syytä alleviivata sitä tosiasiaa, että ihmiskunnan tulevaisuuden ratkaisun avaimia pitenee kädessään kehitysmaissa asuva nainen. Kun ihmiset, tai oikeastaan kun naiset osaavat lukea ja kirjoittaa, alkaa syntyvyyden säännöstely. Nykyinen maailma, jossa voimme aavistella nuorten ikäluokkien olevan lukutaitoisia vuonna 2030, on saamassa päätökseen myös väestöllisen muutosvaiheensa. Vuonna 1981 syntyvyysaste koko maailman alueella oli vielä 3,7 synnytystä naista kohden. Tällainen luku takasi maapallon väestön nopean kasvun ja teki todennäköiseksi olettamuksen alikehittyneisyyden jatkumisesta. Vuonna 2001 maapallolla syntyi enää 2,8 lasta synnytysikäistä naista kohden ja jatkuvasti lähestytään lukua 2,1 joka takaa vain yksinkertaisen suvunjatkumisen. Nämä luvut antavat aavistella aikaa, joka ei ole enää määrittelemättömän kaukana tulevaisuudessa vaan ehkä v. 2050, jolloin maapallon väestönkasvu on pysähtynyt ja maapallo on saavuttanut tässä suhteessa ”tasapainon”.

 

Kehittyneen ja alikehittyneen maailman välillä olevan suuren eron katoaminen ilmenee hätkähdyttävästi esimerkiksi seuraavassa taulukossa (hedelmällisyysluku: syntyneet lapset/synnytysikäiset naiset).

 

 

1981

2010

 

1981

2010

USA

1,8

2,05

Intia

5,3

2,7

Kanada

1,8

1,6

Sri Lanka

3,4

2,3

Iso-Britannia

1,9

1,8

Argentiina

2,9

2,2

Ranska

1,9

2,0

Meksiko

4,8

2,0

Saksa

1,3

1,4

Bolivia

6,8

3,3

Italia

1,7

1,4

Peru

5,3

2,5

Espanja

2,5

1,4

Brasilia

4,4

1,8

Romania

2,5

1,4

Kolumbia

3,9

2,4

Puola

2,3

1,4

Venezuela

4,9

2,5

Venäjä

2,0

1,5

Etelä-Afrikka

5,1

2,5

Ukraina

1,9

1,4

Ruanda

6,9

5,3

Japani

1,8

1,4

Sambia

6,9

5,7

Kiina

2,3

1,8

Zimbabwe

6,6

3,3

Taiwan

2,7

1,2

Kenia

8,1

4,9

Etelä-Korea

3,2

1,3

Tansania

6,5

5,5

Pohjois-Korea

4,5

1,8

Etiopia

6,7

5,2

Vietnam

5,8

2,0

Zaire

6,1

5,7

Thaimaa

3,7

1,8

Norsunluurannikko

6,7

4,5

Filippiinit

5,0

3,0

Sierra Leone

6,4

5,1

 

 

Viime vuosina ajoittain kiivaana käynyt keskustelu länsimaita uhkaavasta muslimi-invaasiosta perustuu yleiseen käsitykseen muslimimaista erityisen nopean väestönkasvun tyyppiesimerkkeinä. Tosiasiat kertovat jostain muusta. Itseasiassa eräissä muslimimaissa syntyvyys on viimeisen kolmen vuosikymmenen aikana suorastaan romahtanut aikaisemmalta erittäin korkealta tasolta lähemmäs länsimaiden hedelmällisyyslukemia.

 

 

1981

2010

 

1981

2010

Azerbaidzan

3,1

2,3

Libya

7,4

2,6

Turkmenistan

4,8

2,4

Qatar

7,2

2,3

Tunisia

5,0

1,8

Syyria

7,2

3,1

Kirgisia

4,1

2,8

Kuwait

7,0

2,1

Tadzikistan

5,6

3,3

Sudan

6,6

4,1

Libanon

4,7

1,8

Irak

7,0

3,9

Turkki

4,3

2,1

Pakistan

6,3

3,8

Iran

5,3

1,7

Saudi-Arabia

7,2

3,0

Indonesia

4,1

2,1

Senegal

6,5

4,7

Uzbekistan

4,8

2,6

Nigeria

6,9

5,6

Bahrain

7,4

2,2

Palestiina

6,9

4,9

Algeria

7,3

2,3

Afganistan

6,9

6,4

Malesia

4,4

2,5

Mauretania

6,9

4,4

Bangladesh

6,3

2,3

Oman

7,2

3,0

Marokko

6,9

2,3

Mali

6,7

6,5

Egypti

5,3

2,8

Jemen

7,0

5,1

Arabiemiirikunnat

7,2

1,9

Somalia

6,1

6,3

Jordania

4,3

3,3

Niger

7,1

7,1

 

Väite jonka mukaan islamilla ja korkealla syntyvyydellä olisi keskinäinen korrelaatio on yhtä kiistanalainen väite kuin vastaava rinnastus katolilaisuuden ja korkean syntyvyyden linkistä. Tästä viimeksimainitusta Espanja ja Italia lienevät kuvaavat esimerkit. Tunisiassa ja Iranissa, jälkimmäinen siis ”kovan linjan islamilainen tasavalta”, syntyvyys lienee siis jo alittanut mm. Ranskan ja Skandinavian lukemat.

 

Siirtymävaiheen kriisi

 

Lukutaidon yleistyminen ja syntyvyyden voimakas aleneminen yhdessä piirtävät maailmanhistoriasta kuvan, joka on täysin erilainen kuin se, jota television uutiskatsaukset levittävät. Ne paljastavat ihmiskunnan, joka on irrottautumassa alikehittyneisyydestä. Jos pitäisimme nämä tosiasiat paremmin mielessämme, emme olisi vain optimistisempia vaan saattaisimme jopa juhlia sitä, että ihminen on saavuttanut kehityksessään ratkaisevan vaiheen.

Joukkotiedotusvälineet eivät kuitenkaan ole yksin vastuussa vääristyneestä historiankäsityksestämme. Kehitys ei ole , kuten valistusajan filosofit kuvittelivat, suoraviivaista, iloista ja kaikin tavoin helppoa. Irrottautuminen perinteisestä elämänmuodosta, totutusta lukutaidottomuuden, korkean syntyvyyden ja korkean kuolleisuuden tasapainosta, aiheuttaa heti alkuun, paradoksaalista kyllä, lähes yhtä paljon hämmennystä ja kärsimystä kuin toivoa ja rikastumista. Hyvin usein, ehkä jopa suurimmassa osassa tapauksista, kulttuurinen ja henkinen nousu yhdistyy siirtymävaiheen kriisiin. Epävakaaseen tilaan ajautuneet väestöt käyttäytyvät sosiaalisesti ja poliittisesti väkivaltaisesti. Henkistä siirtymistä moderniin aikaan seuraa usein ideologisen väkivallan räjähdysmäinen lisääntyminen.

Tämä ilmiö ei esiintynyt ensimmäistä kertaa suinkaan kolmannessa maailmassa – vaan itseasiassa juuri meidän Euroopassamme. Suurin osa nykyään niin perin rauhallisesta Euroopasta on käynyt läpi brutaalin ja verisen ideologisen ja poliittisen käymistilan vaiheen. Ilmaistut arvot ovat olleet hyvin monenlaisia. Liberaaleja ja tasa-arvoisuutta suosivia Ranskan vallankumouksen aikaan, tasa-arvoisuutta suosivia ja autoritaarisia Venäjän vallankumouksessa, autoritaarisia ja epätasa-arvoa painottavia saksalaisen natsismin tapauksessa. Ei pidä myöskään unohtaa Englantia joka oli kuitenkin maanosan ensimmäinen vallankumouksellinen kansakunta, sehän aloitti poliittisen modernin aikansa erään kuninkaan teloituksella vuonna 1649. Englannin vanha vallankumous on kuvaava esimerkki modernisaation paradoksista. Kukaan ei kiistäne Englannin olennaista roolia Euroopan poliittisessa ja taloudellisessa nousussa. Maan väestöstä tuli lukutaitoista varsin varhaisessa vaiheessa. Kuitenkin ensimmäisistä näkyvistä englantilaisen kehityksen seurauksista oli juuri ideologinen, poliittinen ja uskonnollinen kriisi, joka johti sisällissotaan, jota eurooppalaisten olisi nykyään hyvin vaikea ymmärtää.

Suomi kulki tässä prosessissa eurooppalaisessa jälkijunassa. Maamme väkiluku kasvoi 1800-luvulla aina 1910-luvulle asti erittäin nopeaa tahtia. Huolimatta Amerikan siirtolaisuuden varaventtiilistä väkiluku kohosi n. miljoonasta yli 3 miljoonaan. Tuon ajanjakson loppupuolella luku- ja kirjoitustaito alkoi kasvaa. Samaa tahtia alkoi yleistyä syntyvyyden säännöstely, ensin etelässä, myöhemmin idässä ja pohjoisessa. Tämä muutosprosessin kävi Suomikin läpi erittäin veristen vaiheiden koettelemana. Nälänhätä tappoi n. 8% väestöstä 1860-luvulla ja maan poliittista elämää riivasi 1900-luvun alussa terrorismi, luokkaristiriidat ja lopulta lyhyt mutta sitäkin brutaalimpi sisällissota.

Kun siis aikamme länsimaalainen ihminen kauhistelee niitä tapahtumia mistä aiemmin mainittiin, on kyse vain huonosta historiankäsityksestä sekä osittain myös median luomista vääristymisestä. Modernisaatioon näyttää todellakin liittyvän hyvinkin julmia mutta kuitenkin ohimeneviä ilmiöitä. Iranin esimerkki on jatkumo pitkässä ketjussa. Syntyvyyden laskua seurasi nopeasti ajatollah Khomeinin valtaannousu. Ideologia, jotka on ilmaistu shiiojen uskonnollisella kielellä, ei ole kristilliseen perinteeseen kasvaneiden eurooppalaisten tavoitettavissa; se ei kuitenkaan ole sen ”mielettömämpää” kuin kiistat protestanttien ja katolisten välillä Cromwellin aikoina. Se että shiiateologia katsoi paljastavansa maailman epäoikeudenmukaisuuden, viittaa vallankumouksen mahdollistavaan potentiaaliin, samaan tapaan kuin alkuperäinen protestanttinen metafysiikka, joka näki ihmiset ja yhteiskunnan korruptoituneena. Luther ja Calvin vaikuttivat uudistuneen ja puhdistuneen yhteiskunnan syntyyn: USA on uskonnollinen hurmion lapsi siinä kuin moderni Irankin.

 

Maailma jossa lapsemme ja lastenlapsemme tulevat varttumaan

 

Se maapallon jossa ihmiset asuvat vuonna 2050 on joko jo käynyt läpi tai on paraikaa käymässä (Afrikka) muutosprosessia jota leimaa väestönkasvun pysähtyminen, kasvuvaiheessa tapahtuneet väestönsiirtymiset, luku- ja kirjoitustaidottomuuden häviäminen sekä siitä seuraavat modernisaatioon liittyvät mullistukset, kumoukset ja kaaokset. Muutos johtaa väistämättömästi perinteisten ”länsimaiden” painoarvon vähenemiseen.

 

 

2010

2050

Aasia

4 138 386 000

5 205 799 000

Afrikka

1 027 823 000

2 270 435 000

Eurooppa

735 634 000

679 290 000

Pohjois-Amerikka

342 173 000

463 812 000

Latinalainen Amerikka

589 565 000

773 285 000

Oseania

34 943 000

48 477 000

 


( Päivitetty: 16.01.2012 14:54 )

 - pelontorjunta | Kommentit (1)Kommentoi



 Sodassa tappaminen ja sen psykologinen hinta
05.12.2011 13:14 | pelontorjunta

Erityisesti isäinpäivänä ja itsenäisyyspäivän aikaan Suomessa puhutaan paljon ihmistä ja heidän kokemuksistaan viime sodissa. Sen sijaan harvoin asiaa lähestytään kansainvälisten lääketieteellisten ja psykologisten tutkimusten kautta. Tällaiset tutkimukset ovat siinäkin mielessä kiinnostavia, sillä ne jos mitkä avaavat kuin ikkunan tarkastelemaan mitä isämme ja isoisämme, jos he olivat etulinjan joukoissa, aivan oikeasti kokivat mm. vuosien 1939-45 aikana.

Viihdeteollisuus on loistava esittämään sodankäynnin yksinkertaisena tapahtumana myös yksilötasolla. Niinpä useimmat uskovat, että ihmiset tappavat toisiaan koska heille on näin kerrottu, koska he ovat sisäistäneet säännön: tapa tai tule tapetuksi. Uskotaan että vihollista vihataan jne. Viihdeteollisuus ja kaikenlainen verenkarvainen populaarikirjallisuus yrittää saada meidät uskomaan, että kaikki sotilaat ampuvat toisiaan kohti epätoivoisesti ja yrittävät tuhota ja tappaa toisensa. Vaikka tässä lähtökohdassa on mukana myös totuutta, se on useimmiten kuitenkin väärä.

Erinomainen kirja sodassa tappamisesta on esim. Dave Grossmanin ”On Killing : The Psychological Cost of Learning to Kill in War and Society". Kirjaa voi suositella kaikille luettavaksi, koska se menee hyvin yksityiskohtaisesti aiheeseen josta vallitsee suorastaan uskomaton määrä väärinkäsityksiä.

Kun useimmat ihmiset puhuvat sodassa tappamisesta, he ovat kuin puberteetti-ikäisiä neitsyitä jotka yrittävät puhua seksistä. Siitä voidaan puhua vaikka viikko yhteen soittoon, mutta ymmärtää et voi ennen kuin olet sen itse kokenut. Kun tulee toiminnan hetki se ei olekaan sellaista millaiseksi sen luulit.

Ja taistelutilanne sodassa. Kun luodit alkaa lentämään ja tykistötuli pyyhkii taistelumaastoa on sillä voimakas vaikutus miten yksilö alkaa kaiken nähdä ja kokea. Viisisataa taistelijaa näkee asiat viidelläsadalla eri tavalla. Elokuvat haluavat saada ihmiset ajattelemaan, että maailma on mustavalkoinen, ilman mitään harmaan eri sävyjä.

Historiaa tarkastelemalla voidaan havainnollistaa sitä mitä todellisuudessa tapahtui. Ja heti tulee vastaan hätkähdyttäviä tuloksia. Esim. Toisessa maailmansodassa 1939-45 vain 15-20 prosenttia sotilaista ampui vihollista kohti. Grossmanin keräämien tutkimustulosten mukaan nimittäin vähemmän kuin yksi amerikkalaissotilas viidestä ampui taistelutilanteessa kohti saksalaista tai japanilaista sotilasta. Amerikkalainen sotilas tuskin oli erilaisempi kuin muiden armeijoiden. Ja vaikka äärimmäisissä olosuhteissa suurempi osa sotilaista on voinut ampua vihollissotilasta kohti, useimmissa taistelutilanteissa sotilaat olivat haluttomia tappamaan toisiaan. Amerikan sisällissodissa ja sitä edeltäneissä tilanne ei ollut dramaattisesti erilainen. Toisen maailmansodan aikana vain 1% prosentti lentäjistä suoritti 30-40% kaikista vihollisen lentokoneiden alasampumisista. Hyvin monet hävittäjälentäjistä eivät ampuneet alas ainuttakaan viholliskonetta.

Korean sodassa niiden sotilaiden osuus jotka eivät halunneet ampua vihollissotilasta kohden laski -  55% sotilaista ampui vihollista kohti. Vietnamissa osuus nousi noin 95%:iin, mutta tämä ei suinkaan tarkoita, että he yrittivät osua kohteeseen. Itse asiassa Vietnamin sodassa jokaista kuollutta vihollissotilasta kohden amerikkalaiset ampuivat peräti 52 000 luotia! Voi olla mielenkiintoista havaita että kun erikoisjoukot tilastoivat ammuskulutuksensa taisteluissa sekä kuolleet vihollisen sotilaat he tosiasiassa usein soittivat tykistölle (tai ilmavoimille) tilaten epäsuoraa tulta vihollista kohden. Jo toisessa maailmansodassa arviolta 90% niin länsi- kuin itärintaman sotilaistakin kuolivat tosiasiassa sirpalevaikutuksen takia, ei suinkaan luoteihin. Tämä on eräs asia joka yllättää tämän päivän ihmiset, joiden tietämys sodista perustuu pääasiassa elokuviin sodasta.

Historiaa tutkimalla voidaan eliminoida kaikenlaista sotaan liittyvää hypeä ja hyvin usein havaitaan miten tavattoman haluton ihminen on tappamaan toista lähimmistään. Tulos on nähtävissä: sodassa taistelija traumatisoituu koska hänen pitäisikin nyt tappaa toinen ihminen. Vastoin yleistä luuloa sodassa kuoleminen ja haavoittuminen ei suinkaan ole kaikkein suurin sotilaan pelko. Pelottavinta on juuri ihmisen tappaminen.

 

Taistele, pakene, näyttele, alistu, antaudu

 

Eläinkunnassa pääsääntö on selvä: useimmat eläimet eivät tapa lajitoveriaan. Ihmiset eivät tässä suhteessa juurikaan tee poikkeusta. Emme halua tappaa toisiamme; vain äärimmäisen harvoissa tapauksissa eläinten tavoin teemme näin. Nämä liittyvät usein ns. torjuntatilanteisiin tai hyvin poikkeuksellisiin yksilöihin. Väite jonka mukaan ”kuka tahansa voi tappaa” ei täysin pidä paikkaansa. Kynnys on useimmilla erittäin korkea.

Kun kaksi saman lajin eläintä kohtaavat toisensa he aloittaa teeskentelyn. Molemmat yrittävät pelotella vastustajaa uskomaan sen olevan huonompi ja vaarassa. Tässä vaiheessa ne voivat taistella, tai toinen voi alistua tai paeta. Silloinkin kun ne taistelevat toiminta erittäin harvoin johtaa kuolemaan. Kun toinen eläimistä lannistaa toisen se useimmiten vahingoittaa sitä vain jonkin verran, esim. puremalla sitä kaulasta. Muttei silloinkaan tappamalla toista lajin yksilöä.

Ihmiset eivät ole kovinkaan erilaisia tässäkään. Tuliaseet ovat erinomainen tapa teeskennellä taisteluissa, he ovat äänekkäitä ja vaarallisia, ja luodit viuhuminen päiden yläpuolella voi hirvittävää vihollista. Ne tarjoavat alkukantaista vapauta ja antaa ampujalle tunteen vallasta. Teeskentely ja poseeraaminen on hyvin yleinen osa taistelutaktiikkaa. Sotahuudot, karjumiset ym. osa tätä teeskentelyä. Taisteluhuudolla ei tapeta, mutta se tarjoaa alkukantaisen vapauden ja sillä voi pelotella vihollista. Luotien räjähtäminen maahan tai seiniin voi tuntua sotilaasta pelottavalta ja siihen yhdistetään monenlaista karjumista se on entistä pelottavampaa.

Ainakin osittain tästä syystä Vietnamissa räiskittiin niin paljon ilman todellisia osumia (52000 laukausta/ osuman saanut vihollissotilas). USA:n joukot olivat usein ylivoimaisia tässä taistelukenttien teeskentelyssä ja muussa poseeraamisessa. Kun todellinen taistelutilanne tulee eteen, useimmille ihmisille, riippumatta siitä kuinka kovilta kavereilta he kuulostivatkaan kasarmilla, heille oli liian vaikeaa tappaa heidän lähimmäistään ja mieluummin teeskentelivät taisteluissa kuin todella pyrkivät tappamaan silloin kun se oli mahdollista.

Tuliylivoima mahdollistaa toiselle osapuolella sen, että pelottelulla voidaan vaikuttaa myös taistelujen lopputulokseen. USA:n sisällissodassa oli tapauksia, joissa huutamisella ja muulla mesomisella saattoi tosiasiassa heikommassa asemassa ollut osapuoli karkottaa vahvemman. Näin eteenkin maastossa jossa osapuolet eivät tarkalleen päässeet näkemään toisiaan. Asevoimat ei yleensä luokittele tätä teeskentelyksi, he kutsuvat sitä vihollisen uhkaamiseksi.

Kaikki edellä mainittu ei tarkoita sitä, että kaikkia sotilaat yrittävät vain pelotella vihollista sijaan että yrittäisivät tappaa hänet. Muutama yksilö voi aktiivisesti yrittää tappaa vihollisen ja tämä varsin pieni osa taistelijoista aiheuttaakin suuren osan vihollisen kivääritulituksesta tulleista tappioista. Aivan kuten esimerkki siitä kuinka vain 1% hävittäjälentäjistä aiheutti vihollisen taistelutappioista jopa 40%.

Taistelu on sotilaan toinen vaihtoehto ja silloin molempien osapuolten tulee pyrkiä tappamaan toisiaan. Toinen osapuoli voi antautua mutta ihmiselle se on taistelukentällä vaarallisimpia vaihtoehtoja, koska vangit saavat usein surmansa taistelun tuoksinassa, eivätkä aina tarkoituksella! Pakenemisesta tulee silloin parempi vaihtoehto muttei sekään ole suinkaan vaaratonta, sillä ihmisen on aina helpompi tappaa toinen ampumalla tätä kaukaa selkään. Vaikeinta on aina ampua ihmistä jonka kasvot hän selvästi näkee.

Etäisyys muiden ihmisen suoraan vaikuttaa siihen, miten helppoa hänet on tappaa. Pommituslentäjät eivät tunne tunnontuskia sillä kilometrien päästä maalista he eivät näe uhrejaan eivätkä kuule heidän ääniään. Maavoimien etulinjan taistelijoille, jääkäreille, tilanne on täysin toisenlainen. He näkevät pelon toisen ihmisen silmistä, hien otsalla, kivun hänen kasvoillaan, veren purkautuvan haavoista, epätoivoiset avunhuudot. Vihollisesta tulee hyvin todellisia ja eläviä, ihminen jolla on toiveita, unelmia, pelkoja, äiti, isä, kenties vaimo, aivan kuten ampujallakin. Tavallaan ampuja näkee vihollisen hyvin vähän itseään erilaisena ja niin tappaminen olisi samanlaista kuin ampuja ampuisi itseään. Siksi jalkaväen sotilailla on selvästi enemmän traumoja sodasta kuin muiden aselajien sotilailla. Kuinka monella suomalaisella tykkimiehellä oli valtavia sodasta johtuvia traumoja verrattuna etulinjan konepistoolimiehiin?

Sodat joissa ihmiset taistelevat keskenään merkitsee kauhua ja kaaosta, pelkoa ja traumaa. Siksi ammuntamäärä taistelujoukkojen keskuudessa on pienempi kuin useimmat ihmiset ajattelevat. Ihmiset ovat valmiita kohtaamaan kuoleman ja silpoutumisen halukkaammin, jos heillä ei tarvitse tappaa ketään. Lääkintähenkilökunnat ovat tunnettuja esimerkkejä siitä että he muita useammin olivat valmiita vaarantamaan henkensä pelastaakseen jonkun haavoittuneen ja vaarassa olleen sotilaan. Sen sijaan taistelutilanteessa oleva sotilas – vaarassa siis hänkin – ampuu useimmiten umpimähkään vailla todellista tappamistarkoitusta.

Sotilaan kolmas mahdollisuus on pakeneminen. Jälleen ihmiset ovat kuin eläimiä. Pakenet suurta vihaista koiraa, tämä tulee perässä, pakottaa sinut ehkä maahan ja puree sinua. Ihmiset taistelutilanteessa toimivat samoin. Juuri siksi pakenemistilanteessa tapahtuu sodan dramaattisimpia tappamisia. Sotilas ei enää katso silmiin kauhuissaan vihollista kuin itseään, hän katsoo kuin häneltä taaksepäin pakenevaa saalista ja silloin löytyy jo paljon halukkaita ja kykeneviä ampumaan toista ihmistä selkään. Pakeneva sotilas ei enää ole hänelle toinen ihminen vaan saalis, joka pyrkii häneltä pakoon. Pakenemaan ja antautumaan pyrkivän sotilaan tappaminen on hyvin yleinen tapahtuma, koska tappajassa on usein silloin valtava määrä adrenaliinia, on tunnekuohussa ja eikä usein ymmärrä hänen vastustajansa olevan antautumassa. Sitten on aina psykopaatteja, jotka ovat melko valmiita ampumaan antautuvia sotilaita ja näitä persoonia on joka ainoassa armeijassa.

 

Tappaa tai olla tappamatta

 

Tämä on erittäin vaikea päätös sotilaalle ja hyvin monet tekijät voivat vaikuttaa sotilaiden kykyyn tappaa lähimmäistään. Ennen taistelua sotilaat voivat puhua paljon ja vaikuttaa hyvinkin verenhimoisilta, pelkoa herättävältä joukolta. Kokeneemmat sotilaat ovat todennäköisesti hillitympiä elleivät ne ole ”psyykanneet” itseään.

On huomattava, että vaikka sotilas voi ampua, hän voi välttää tappamista. Häntä voidaan komentaa ampumaan, mutta se on hyvin vaikea osoittaa yrittikö hän todella osua toiseen ihmiseen. Tilastot Vietnamissa, pienikaliberisten panosten suuri kulutus maailmansodissa verrattuna vain 10%:n osuuteen vihollisten kokonaistaistelutappioista, nämä viittaavat siihen, että suurin osa kivääri- ja konepistoolimiehistä ei tosiasiassa halunnut tappaa vihollista.. Ihmiset olivat valmiita tulittamaan vaikka tuntikausia, mutta eivät halunneet osua kohteeseen.

Useimmat täysijärkiset ihmiset, jos saavat valita, eivät tapa lähimmäistään ja ovat erittäin haluttomia tekemään niin, huolimatta siitä, mitä Hollywood, kirjallisuus ja media sinulle uskottelee. Kun heidän on pakko tehdä niin, moni voi kokea paljon psykologisia traumoja. Ylivoimaisesti eniten sotatraumoja löytyi juuri kivääripataljoonien miehiltä. He joutuivat katsomaan toista ihmistä joita hänen olisi pitänyt ampua.

Sotilaskoulutuksella pyritään helpottamaan yksilön päätöstä ampua toista ihmistä . Tämä on eräänlaista aivopesua, mutta se on usein välttämätöntä. Toisessa maailmansodassa ihmiset oppivat ampumisen ampumalla pahvimaaleja harjoituksissa. Kun he pääsivät taistelukentällä heillä saattoi olla erinomainen ampumistaito, mutta he käsittivät kohteiden olevan toisia ihmisiä, joku nimeltään Hans, Frederick, James, Sergei tai Anatoli. Nykyään tappaminen yritetään tehdä automaattiseksi, enemmän vaistomaiseksi toiminnaksi. Mikäli koulutus onnistuu ja sotilas kykenee tällä aivopesulla ampumaan toisen ihmisen hänestä tulee traumatisoitu tappaja. Tämän vuoksi modernin ajan sodissa tappajista tulee entistä traumaattisempia – he tappoivat vastoin omaa haluaan.

Emotionaalinen ja fyysinen etäisyys vaikuttaa paljon siihen voiko ihminen tappaa toisen. Emotionaalinen etäisyys voidaan luokitella mekaaniseksi, sosiaaliseksi, kulttuuriseksi ja emotionaaliseksi etäisyydeksi. On paljon vaikeampi tappaa ihminen jonka hengitykseksen voit tuntea ja nähdä pelon hänen silmissään. Tämä on verrattavissa toisen tappamiseen veitsellä. Tykkimiehen ja pommittajan on helpompi kieltää kohteensa inhimillisyys.

Emotionaalisen etäisyyden avulla henkilön halu tappaa lähimmäisensä vaihtelee ja antaa hänelle mahdollisuuden perustella sen helpommin. Kulttuurisessa etäisyydessä vihollinen luokitellaan erilaiseksi kuin itse. Vihollinen on epäinhimillistetty ja häntä pidetään alempiarvoisena. Natseille heitä edustivat mustalaiset, juutalaiset ja mustaihoiset. Moraalisessa etäisyydessä esim. USA:n joukoille saksalaiset olivat natseja eli julmia ja raakoja teurastajia. Natsit olivat syyllisiä ja heitä oli rangaistava. Se oli oikein ja kohtuullista. Sosiaalisesta etäisyydestä löytyy esimerkkejä mm. keskiajalta. Ns. ritarit pyrkivät välttämään toisten samassa sosiaalisessa asemassa olevien tappamista ja he valitsivat uhreikseen usein alemmista sosiaalisista ryhmistä tulleet viholliset. Mekaaninen etäisyys mahdollistaa sen että vihollinen nähdään hyvin kaukana. Tämä ei tuo hänen inhimillisyyttään lähemmäksi. Moderni sota pimeänäkölaitteineen on tuonut sodan Nintendo-pelin kaltaiseksi. Tämä on ilmennyt mm. Persianlahden sodassa, sekä Iranin ja Afganistanin sodissa. Merkittävä vaikutus on myös ylemmillä komentajilla. Joukoille joille auktoriteetti määrää  tehtäväksi tulittaa kohdetta on päätös usein helpompi. Kosto, viha ja pelko ovat kaikki erilaisia tekijöitä, jotka voivat mahdollistaa sen että sotilas pystyy ampumaan toista ihmistä.

 

Taisteluväsymys

 

Sodankäynti on eteenkin etulinjan joukoille hyvin traumaattista sekä tappamisen että tapetuksi tulemisen kannalta. On hyvin paljon pelottavampaa jos joku yrittää tappaa sinut veitsellä kuin pommittamalla sinua. Toiseen maailmansotaan lähdettiin ideologialla jossa uskottiin strategisilla pommituksilla murrettavan vihollisen kotirintaman moraali ja puolustustahto. Tulokset olivat useimmiten täysin päinvastaisia. Persoonattomat hyökkäykset vain lujittivat vastarintaa.

Totaalisen sodankäynnin kannalta merkittävämpi vaikutin oli kokonaisvaltainen hyökkäys kokonaista aluetta kohtaan jolloin perinteinen etulinja ja sen takainen rauhallinen alue jaottelu alkoi muuttua. Myös siviiliväestö koki lisääntyvän paineen kun tieto tai huhu aluetta kohtaavaa musertavaa sotilaallista operaatiota kohtaan lisääntyi. Kun vihollisen hyökkäys tuhoaa yksikön päämajan, ihmiset siellä ymmärtävät, että he ovat tavoite ja vihollinen ei kiinnostunut tappamaan etulinjan yksiköitä. Tämä voi aiheuttaa suurta psykologista traumaa pataljoonan komentajassa, kun hän tajuaa vihollisen maalitaulu. Tällainen tekijä aikaansaa psykologisen paineen lisääntymisen myös etulinjan joukoissa, kun edes turvallista takalinjaa ei ole olemassa. Tästä on enää lyhyt matka nykyaikaiseen syvään sodankäyntiin jossa mitään turvallisia paikkoja harvoja linnoituksia lukuun ottamatta ei enää ole.

Tutkimukset ovat osoittaneet, että mitä enemmän aikaa sotilas viettää taisteluissa sitä todennäköisemmin hänestä tulee psyykkinen uhri. Psyykkinen uhri on yksikölle hyödytön sotilas ja hänestä tulee pikemminkin yksikölle riskitekijä aivan vihollisen tapaan. Tutkimukset osoittavat että 60 päivää etulinjassa taistelutehtävissä tuhoaa yksikön tehokkaan taistelutehon, koska 60 päivän kuluessa 98% yksikön sotilaista ovat todennäköisesti sodan psyykkisiä uhreja.

Tämän estämiseksi yksiköitä kierrätetään takalinjojen suhteellisen turvallisella alueella. Jos vihollinen on tunkeutunut myös selustaan eikä alue ole enää turvallinen on kierrätys hyödytöntä. Tämä saattaa olla yksi syy miksi monille ihmisille olo Vietnamissa "etulinjassa" sekä "turvallista" alueilla oli lähes yhtä turvatonta. Yksiköt usein kierrätetään osaksi siksi että heille annetaan aikaa "toipua".

Entä mitä tapahtuu joukoissa jotka ensi kerran siirtyvät taistelutehtäviin, siis etulinjaan?

Noin 10 ensimmäisen päivänä yksiköstä kehittyy taisteluun tottunut. Sotilaat tottuvat vaatimuksiin elää joka suunnalta tulevaa vihollisen uhkaa vastaan. Yksikkö saavuttaa 10-30 päivän aikana maksimaalisen tehokkuutensa. Suomalaisten panikointi talvisodan alussa kuvaa tätä alun tottumattomuutta hirveisiin olosuhteisiin. Kahden viikon kuluessa joukot kaikkialla suorittivat yhä paremmin tehtävänsä ja saavuttivat tammikuun alkuun mennessä huomattavia torjuntavoittoja. Jatkosodan hyökkäysvaiheessa nopeimmat ja tehokkaimmat operaatiot suoritettiin heinäkuun puolivälistä aina elokuun puoliväliin saakka jolloin melkein koko Laatokan puoleinen menetetty alue oli jo vallatta takaisin ja edetty jo syvälle Itä-Karjalaankin.

Noin 30 päivän jälkeen sotilaat saattavat uskotella jo itselleen kokemuksen ja ”karaistumisen” jälkeen ettei niiden kyky taistella enää heikkene. Tosiasiassa taistelukyvyn heikkeneminen alkaa juuri tässä vaiheessa. Uupumus, väsymys, innostuksen väheneminen, huono ruoka ja eteenkin psyykkisen paineen kasvu alkaa vasta nyt todella vaatimaan veronsa. Jatkuvat adrenaliinin eritys kehossa – ylämäet ja alamäet tunnetasolla alkavat vähitellen vaikuttamaan yksikön suorituskyvyssä. Yhä useampi alkaa henkisesti murtumaan aivan hirvittävissä olosuhteissa. Seuraavien 30 vuorokautta taistelujoukoissa, taistelutehtävissä, jatkuvan pelon, uhan, tappamisen paineessa murtavat yksikön taisteluarvon. Jo noin 45 päivässä on emotionaalinen tukehtuminen yksikössä tapahtunut ja yksikön tehokkuus laskee dramaattisesti. Joukot eivät halua hyökätä, he eivät halua kaivaa taistelukaivantoja ja välttävät partiointeja. Heiltä puuttuu tahto ja halu mikä niillä aiemmin oli. .

Tämä peruslaskelma päti viime sotien aikana kaikissa asevoimissa siis myös Suomen. Itseasiassa se selittää erittäin hyvin sen äärimmäisen kriisin mihin suomalaiset joukko-osastot joutuivat talvisodassa helmikuusta 1940 lähtien sekä jatkosodan hyökkäysvaiheen traumaattisen jälkipuoliskon jolloin kokonaisia rykmenttejä oli lähes mahdotonta saada suorittamaan niille annettuja tehtäviä. Ellei vastapuolella olisi ollut kenties vielä kurjemmassa fyysisessä ja psyykkisessä kunnossa olleita joukko-osastoja ei katastrofia kenties olisi voitu välttää. Neuvostojoukkojen eteneminen sodan loppupuolella sekä toisaalta sen joukoissa lisääntyneet karkuruudet, kieltäytymiset ja omien sotilaiden valtavat teloitukset kertovat äärimmäisestä joukkojen loppuunpalamisesta.

 

Psykiatrinen uhri

 

Henkilöstä tulee monen eri asteen psykiatrinen uhri sodassa. Useiden kuukausien taistelutehtävät tekevät lähes jokaiselle henkisen stressin vuoksi oireita. Tämä ei tarkoita että he ovat muuttuneet täysiksi hulluiksi ja joissakin tapauksissa lepo ja palautuminen auttaa paljon. Kun se edennyt todella pahaksi siihen ei ole olemassa helppoa ratkaisua. Joissakin tapauksissa henkilö voi esitellä oireitaan välttääkseen taisteluja. Tapauksen hoitoon käytetään erityyppisiä ratkaisuja järjestelmän ominaisuuksien mukaan.

Uupumistapauksissa sotilaasta on tullut "väsynyt" ja on haluton tekemään oikeastaan mitään. Hän ei halua olla ystävien kanssa tekemisissä tai osallistua mihinkään fyysistä tai henkistä toimintaa tai vastuuta vaativaan tehtävään. Hän voi altistua koville äänille ja hänessä ilmenee itkukohtauksia tai ahdistusta. Monin tavoin kaikki hän haluaa tehdä, on elää tyhjää elämää mutta hänen mielialansa vaihtelee. Paras hoitotapa on poistaa henkilö taistelualueella lepoon.

Sekavuustilassa psykiatrinen uhri alkaa menettää ajan, paikan ja ympäristön tajunsa. Väsymyksestä kärsivät ihminen voi nopeasti siirtyä tähän tilaan ja tulla psykoottiseksi. Joihinkin oireisiin kuuluvat delirium, psykoottiset dissosiaatiot ja maanis-depressiiviset mielialan vaihtelut. Toinen mahdollinen vaikutus on nimeltään Ganzer-oireyhtymä. Kun psykiatrinen uhri kärsii Ganzer-oireyhtymästä hän saattaa vitsailla, toimia typerästi tai muuten yrittää välttää kauhua ja pelkoa huumorilla. Väinö Linnan Tuntematon sotilas-romaani oli täynnä tällaisia persoonia, joiden humoristisuuden takaa pilkistää joitain aivan muuta kuin pelkkää parodiaa.

Konservionaalinen hysteria voi tapahtua taistelujen aikana tai vuosia myöhemmin. Tämä on vakava muoto jos on kyse sekavuustilasta. Kärsijä menettää kaiken kosketuksen todellisuuteen ja harhailla riippumatta vaaroista, kuten miinakentät, vihollisen tarkka-ampujat jne.. Sotilas voi olla sikiöasennossa ja yrittää olla välittämättä ympäristöstä tai täristä. Suuri osa muistista voi olla lukossa jotta hän yrittää sulkea ulkopuolelle kauhun mielestään. Toinen mahdollisuus on tietty osa ihmisen elimistöä ei enää toimi, kuten sormi joka vetää liipaisimesta. Konversionaalinen hysteria voi näkyä sotilaassa aivotärähdyksen jälkeen ja kun hän sai pieniä haavoja tai hän oli ollut ”läheltä piti” tilannetta. Hysteria voi näkyvät sairaalassa tai taka-alueella. Joskus se ilmenee kun sotilas määrätään palaamaan yksikköönsä tai hänet siirretään taisteluun.

Ahdistus voivat vaikuttaa sotilaan kykyyn nukkua. Ei ole väliä kuinka paljon nukkua tai levätä hän saa, hän on aina väsynyt. Hänen uniansa vaivaavat painajaiset ja sotilaalle voi tulla pakkomielle kuolemaan. Hän alkaa pelätä, hän voi olla pelkuri, hän voi epäonnistua taistelutovereidensa kanssa tai muut voisivat havaita hänen olevan pelkuri. Jotkut oireet ahdistuneisuudessa ilmenevät hengenahdistuksena, heikotuksena, kipuna, näön hämärtymisenä, huimauksena, tilapäisenä paralyysinä ja pyörtymisenä. Eräs vaikutus on PTSD (traumaperäinen stressireaktio). Vuosia taistelujen jälkeen hänen verenpaine saattaa nousta dramaattisesti yhdessä hikoilun, hermostuneisuuden ja muiden syiden kanssa.

Pinttynyt ja pakonomainen tila on kuin konversionaalinen hysteria paitsi että sotilas on tietoinen siitä, mitä on tekeillä. Sotilas ymmärtää, että pelko aiheuttaa kaikkea, mutta hän ei voi tehdä asialle mitään. Tämä voi ilmetä hallitsemattomia vapinana, sydämentykytyksenä, änkytyksenä, nykimisenä jne. Hetken päästä sotilaassa voidaan havaita jonkinlaista hysteriaa.

Luonnehäiriöitä on sellaiset kun sotilaalle tulee päähuomioksi tiettyjä toimia tai asioita. Paranoia saattaa sisältyä ärtyisyyttä, masennusta ja ahdistusta hänen henkilökohtaisesta turvallisuudesta. Skitsoista on tullut yliherkkiä ja he haluavat olla yksin. ”Epileptoid” on taudin määritelmä henkilöstä joista on tullut alttiimpia väkivaltaisuuksiin ja joskus arvaamattomaan raivoon. Joillekin tulee pakkomielle uskontoon ja joistakin tulee psykoottisia. Tälle ihmisellä ominainen luonne on muuttunut.


( Päivitetty: 06.12.2011 09:02 )

 - pelontorjunta | Linkki



 Mikä ja missä on vasemmiston tulevaisuus?
17.11.2011 09:39 | pelontorjunta

Get the Flash Player to see this player.

 

Pitkän aikavälin historiallinen vertailu osoittaa, että maailmantalouden nykyistä globalisaation astetta on paisuteltu aivan yli äyräiden. Talous on tällä hetkellä suunnilleen yhtä globalisoitunutta kuin se oli juuri ennen ensimmäistä maailmansotaa. Sen jälkeen talouden globalisoitumisaste aleni jyrkästi. Suurin osa niistä keinoista, joilla yksittäiset kansallisvaltiot pystyivät vaikuttamaan omaan talous- ja sosiaalipolitiikkansa ennen väitettyä globalisaatiota, ei ole kadonnut yhtään mihinkään; vastuutaan vähätteleville poliitikoille on vain tarkoituksenmukaista levittää myyttiä, että ne ovat globalisaation myötä hävinneet peruuttamattomasti kuin tuhka tuuleen. Verotaakan ja sosiaalimenojen sekä kansainvälisen kilpailukyvyn välillä ei vallitse mitään suoraa positiivista tai negatiivista korrelaatiota. Kilpailukykyisiä tai kilpailukyvyttömiä voivat olla sekä niukan että anteliaan hyvinvointivaltion maat. Sen sijaan on täysin selvää, että pelkän globalisaatiolle altistumisen ja hyvinvointivaltion välillä vallitsee suora kohtalonyhteys: niissä maissa, joiden talous on kaikkein avoimin ulkomaiselle kilpailulle ja investoinnille, on myös säännönmukaisesti kaikkein suurin julkinen sektori. Jos poliittista taitoa, tahtoa ja röyhkeyttä vain löytyy ja voivat ulospäin näytellä miten globalisoitunutta ja uusliberalisoitunutta tahansa samaan aikaan kun kulissien takana vanhat globalisaatiota edeltävän ajan rakenteet ovat pääosin koskematta. Ja ne saavatkin olla koska niillä ei ole mitään kielteistä vaikutusta kansakunnan menestymiseen kansainvälisessä kilpailussa. Näin on käynyt esim. Ruotsissa.

Ei ole olemassa mitään historiallisia todisteita, että yksinkertainen laissez faire-talous on kaupan ja hyvinvoinnin edellytys. Tosin Kansainvälinen valuuttarahasto ja eräät muut teologiset tiedekunnat väittävät päinvastaista mutta heidän omat tilastonsakin puhuvat toista. Sama koskee myös Suomea. YYA-Suomen talous kasvoi vuosina 1946-74 keskimäärin 4,9% vuodessa, liberalisoituvan talouden aikana v.1974-2003 kasvu oli enää vain 2,5% vuodessa ja odotettavissa on että kasvu tulee jatkossa jopa laskemaan entisestään. Toiset maat on kehityksessä puolestaan sellaisessa vaiheessa että ne hyötyvät globalisaatiosta. Mutta oleellisinta tässä on se että nämä nykyisin kovassa kasvussa olevat kansantaloudet pyrkivät retoriikasta huolimatta suojaamaan mahdollisemman paljon omaa talouttaan jotta ne voivat vahvistuttuaan lähteä valtaamaan yrityksillään maailmanmarkkinoita.

Siinä lyhykäisyydessään se viitekehys jossa poliittisen kentän eräs merkittävin voima – vasemmisto – toimii. Mutta mikä on se vasemmisto joka kaikkialla lännessä on eteenkin reaalisosialismin romahtamisen jälkeen menettänyt asemiaan ellei suorastaan romahtanut? Alennustilasta on käyty viime vuosikymmeninä kiivastakin keskustelua. Missään tapauksessa syy ei ole suinkaan kapitalismin voitossa. Tosiasiassa markkinafundamentalistinen kapitalismi on juuri tyrmännyt itse itsensä ja vähintäin roikkuu köysissä odottaen pelastavaa kongin kumahdusta (veronmaksajien apua). Täytyy olla fantastisen humoristin se veikko joka kaiken jälkeen vielä kehtaa väittää markkinatalouden osoittaneen paremmuutensa.

Vasemmiston tragedia liittyy lähinnä siihen, että siitä tuli vallanvuosina aluksi omien poliittisten vastustajiensa vanki ja lopulta niiden suoranainen asiamies. Sosiaalidemokratia voitti työväenliikkeen sisäisen taistelun kommunisteja vastaan mutta samalla sen itsensä koetaan hylänneen oman olennaisen ytimensä, ja tätä hylkäyksen kokemusta ovat innokkaimmin artikuloimassa ja hyödyntämässä jäljelle jääneet kommunistiset sirpaleet ja erityyppiset populistiset uudet puolueet. Karl Marx väitti aikoinaan että kapitalismiin kuuluu oleellisesti säätelemättömyys. 1900-luvun historia kertoo kyllä jostain muusta. Porvarilliset puolueet suorastaan kilpailivat siitä kuinka paljon yhteiskuntaa on säädeltävä. Ne olivat melkein yhtä innokkaasti kuin sosiaalidemokraatit vaatimassa julkisen sektorin aktiivista osallistumista talouteen kunnes uusi uskonnollinen ilosanoma 1930-luvulla itsensä munanneesta finanssikapitalismista nostettiin jälleen kultaisena vasikkana palvonnan kohteeksi. Viimeiset kolme vuosikymmentä sekä vasemmisto että oikeisto on uskonut kaikkia niitä mantroja joita ”vastuullisesta taloudenpidosta” (lue: markkinoiden liberalisoinnista) on heille luennoitu. Poliittisen rälssin harmonisoituminen ”vastuun” kantamisessa on kuohinut vasemmiston siinä kuin poliittisen keskustankin. Taloudellisen fiaskon jälkeen poliittinen kenttä on valmis ottamaan jälleen yhteiskunnallisen ohjauksen voimakkaimmin käyttöön aivan toisen maailmansodan jälkeisten kolmen vuosikymmenen tavoin.

Vasemmiston alennustilasta käydyn keskustelun eräs ongelma liittyy siihen, että keskustelu sinänsä on sittenkin liian Eurooppa- ja länsikeskeistä. Unohdamme sen mitä muualla maailmassa on tapahtumassa. Paavo Haavikko totesi aikoinaan että ajattelu alkaa vasta sitten kun rahat ovat loppuneet. Lännessä ne eivät ole vielä loppuneet mutta muualla rahasta on aina ollut puutetta. Kääntäkäämme siis hetkeksi katseemme pois länsimaista vaikkapa latinalaiseen Amerikkaan. Serge Halimi kirjoitti taannoin CounterPunchissa julkaistussa artikkelissa ”Where Did the Left Go?” - ”Minne vasemmisto meni”:

The Brazilian Labor Party (PT), a generally moderate party, thinks the Latin American left should take over from the Old World left, which is too capitalist, too Atlanticist, and unconvincing in its claims to defend the interests of the people: “The ideological leadership of the left is moving to a new part of the world,” according to a document for the PT Congress in September. “South America is the salient example. … The left in European countries, which has had such an influence on the left worldwide since the 19th century, has not managed to produce an adequate response to the crisis and appears to be capitulating to the forces of neoliberalism.” The decline of Europe may also signal the end of the ideological influence of the continent where trade unionism, socialism and communism were born. Europe now appears more resigned than others to their demise.”

Brasiliassa, kuten suurin piirtein koko latinalaisessa Amerikassa on jo jonkin aikaan nähty eurooppalaisen vasemmiston henkinen väsähtäminen ja kyvyttömyys ottaa aloite omiin käsiinsä. Ideologinen vasemmiston johtajuus on siirtymässä ”uusiin maanosiin” pois Euroopasta ja USA:sta. Onko tätä asiaa edes ihmeteltävä? Vuosi 2011 tulee jäämään maailmanhistoriaan paitsi finanssikapitalismin romahduksena (josta päävastuun saavat kantaa lännen poliittiset johtajat) myös lukuisien arabimaissa suoritettujen kansannousujen vuotena. Samaan aikaan esim. latinalaisessa Amerikassa vasemmisto on kaikkea muuta kuin henkitoreissaan. Maanosan oikeistokin on melkoiselta osin omaksunut sosiaalidemokraattisen yhteiskunnallisen ajattelun. Ja nyt olisi syytä miettiä tämän toisaalta lännen sekä sen ulkopuolisen maailman välillä vallitsevan kummallisen ristiriidan perussyytä.

Poliittiset tutkijat toinen toisensa perään näyttävät jostain kumman syystä usein unohtavan erään hyvin tärkeän tekijän yhteiskunnallisessa analyysissään. Se suunnaton muutos joka kirkkaasti kaikkia muita ylimpänä auktoriteettina määrää niin poliittisen, taloudellisen kuin kulttuurisen muutoksen suunnan, voiman ja seuraukset liittyy kansanomaisesti sanottuna ”naisen lanteisiin”. Jokaisen olisi syytä pysähtyä demografisen prosessin – maapallon väestön painopisteen suuren muutoksien ja vaikutuksien, myös poliittisten, äärelle. Niin muslimimaissa kuin latinalaisessa Amerikassa on huikeasti nuorempi väestörakenne kuin lännessä. Niitäkin suurempi poliittinen mullistus, suoranainen räjähdys, on tulossa vielä Saharan eteläpuolisesta Afrikasta. Jo pelkästään Nigeriassa kasvaa nuoria ikäluokkia jotka ovat ovat lukumäärältään suurempia kuin kaikkien EU-maiden nuorten ikäluokat yhteensä.

 

Get the Flash Player to see this player.

On jokseenkin varmaa, että juuri demografinen muutos tulee siirtämään niin vasemmiston kuin vaikkapa kirkonkin toiminnallisen sekä aloitteellisuuden painopisteen pois vanhenevien ikäluokkien lännestä. Luultavampaa onkin, että lännen poliittinen vasemmisto tästä lähtien pikemmin ottaa vaikutteita ns. kolmannesta maailmasta kuin antaa sille. Aloite on siirtynyt etelään.


( Päivitetty: 17.11.2011 10:23 )

 - pelontorjunta | Linkki



 Valkoisen rodun keksiminen
03.11.2011 18:16 | pelontorjunta

 

 

Eri arvioiden mukaan maapallon väkiluku on joko ylittänyt tai ylittää lähikuukausina 7 miljardin ihmisen rajan. Demografinen muutos on ollut huikea eteenkin toisen maailmansodan jälkeen niin että väkiluku on kasvanut jopa 12 vuodessa aina yhdellä miljardilla. Suhteellisen kasvuvauhdin hiljenemisen lisäksi myös absoluuttinen kasvu lienee kuitenkin jo hidastumassa ja ehkä kääntymässä negatiiviseksi niin, että todennäköisesti vuosisadan lopulla maapallolla tuskin elää kovinkaan paljon enemmän ihmisiä kuin nykyisin.

Ihmiskunnan jakaminen erilaisiin rotuihin voidaan jäljittää aina muinaiseen Egyptiin saakka, jossa Porttien kirja määritti neljä egyptiläisten tuntemaa rotua. Tämä määritelmä on kuitenkin liittänyt rodun lähinnä heimo- tai kulttuuri-identiteettiin. Antiikin kreikkalaiset ja roomalaiset yrittivät myös luokitella heitä ympäröiviä ihmisiä näkyvien biologisten ominaisuuksien perusteella. Näissä jaotteluissa oli usein myös mielikuvituksellisia kuvauksia kaukaisissa maissa asuvista ihmisistä. Keskiaikaiset rotumallit sekoittivat klassisia käsityksiä ajatukseen Nooan kolmesta pojasta Seem, Haam ja Jaafet. Heidän jälkeläisiään olisivat selkeästi toisistaan eroavat ihmisryhmät Aasian seemiläiset, Afrikan haamilaiset ja Euroopan jaafetilaiset.

Nykyajan ihmisille voi olla tosin yllätys, että ns. rotutietoisuus ei mitä ilmeisemmin ole kovinkaan vanha ilmiö. Ennen klassisia rotuluokitteluja oli rotu Euroopassa yleensä käsitetty kansallisuuden kanssa rinnastettavaksi ilmiöksi, mutta 1600- ja 1700-luvuilla eurooppalaiset alkoivat identifioitua laajempaan "valkoihoisten ryhmään". Ts. sitä ennen tällaista käsitettä ole juuri ollut. Mutta mikä aikaansai sen että eurooppalaisista ja heidän merentakaisista jälkeläisistä alettiin käyttää nimikettä ”valkoinen” tai ”valkoinen rotu”?

Viime vuosikymmenien eräs kiinnostavin alan tutkimukseen liittyvä kirja lienee vuonna 2005 syöpään kuolleen Theodore W. Allenin teos ”The Invention of the White Race”, suomeksi ”Valkoisen rodun keksiminen” (1997). Allen tutki elämänsä viimeisen neljän vuosikymmenen aikana eteenkin oman maansa USA:n rotuerottelujärjestelmää ja siihen liittyvää valkoisen rodun ylivaltaa sen yhteiskunnallisen merkityksen kannalta.

Tässä yhteydessä on syytä tuoda esille Allenin poliittinen vasemmistolaisuus sekä sen myötä ilmeinen mahdollisuus että arvostettu tutkija ja luennoitsija olisi tietoisesti politisoinut tutkimuskohdetta. Mutta massiivisessa tutkimuksessaan Allen marssittaa sellaisen todistusaineiston (lähdemateriaali, dokumentit, muut tutkimukset) joka on epäilemättä asettamassa kyseenalaiseksi perinteistä käsitystämme roduista ja eteenkin valkoisten ns. rotutietoisuudesta. Sitä nimittäin Allenin mukaan ensimmäisillä Amerikkaan matkanneilla eurooppalaisilla ei ollut.

Allen korostaa tutkimuksissaan että ”kun ensimmäiset afrikkalaiset saapuivat Virginiaan vuonna 1619, ei ollut valkoisia ihmisiä" ja hän lisäsi, ettei hän löytänyt oikeusasteen virallisessa käytännössä sanaan 'valkoinen' mitään viittamaan sosiaaliseen asemaan ennen vuotta 1691. Hän havaitsi myös saman kuin historioitsija Lerone Bennett, Jr.,että lähes koko 1600-luvulla afroamerikkalaisten ja eurooppalaisten työläisten, pakkotyöläisten ja orjien olot olivat hyvin samankaltaiset. Suurin osa eurooppalaisista nimittäin työskenteli usein ensimmäiset kymmenen vuotta (jopa enemmän) sopimustyöläisenä maksaakseen Atlannin matkansa kustannukset. Olot eivät käytännössä eronneet yhtään mustien asemasta. Tällaisissa olosuhteissa solidaarisuus työtätekevien keskuudessa saavutti huippunsa todennäköisesti Baconin kapinassa. Pääkaupunki Jamestown oli poltettu ja noin kaksituhatta kapinallista pakottivat kuvernöörin pakenemaan koko Chesapeakelahdelta ja peräti 6 / 7 Virginian alueesta oli kapinallisten hallussa. Myöhemmästä kapinan vaiheesta löytyy dokumentteja joissa mainitaan mm."neljänsadan englantilaisen ja neekerin " vaatineen vapautta orjuudesta. ("foure hundred English and Negroes in Arms" ...demanded their freedom from bondage. )

Allenin ja muutaman muun tutkijan havainnot viittaavat Baconin kapinan (joka ei ollut ainutlaatuinen tulla ajalla) osoittaneen hallitsevalle luokalle että maasta puuttuu ”välikerros” hallitsevan luokan ja rahvaan väliltä. Juuri tähän ongelmaan haettiin ratkaisu tyypillisellä klassisella jo Rooman vallan ajoilta tultulta ”hajoita ja hallitse”-periaatteella. Näin syntyi tarve erottaa afroamerikkaiset ja eurooppalaiset, joiden sosiaalisessa asemassa ei siis ollut juurikaan eroa, toisistaan. Syntyi ensimmäiset kudokset rotuajattelulle. Oli löydetty ”valkoinen rotu”. Tavoitteena oli Allenin mukaan "porvarillisen sosiaalisen kontrollin muodostuminen työväestön levottomuutta vastaa." Hän kuvaili ”establishmentin” politiikkaa, jolla alettiin myöntää joitakin etuoikeuksia eurooppalaisille työntekijöille ja palvelijoille sekä sakottamaan ja estämään afroamerikkalaisia vapaasti liikkumasta siirtokunnassa. Samoin afroamerikkalaiset menettivät iät ajat olleen oikeutensa äänestää Virginian siirtokunnan vaaleissa.

Allenin mukaan avain rotusorron ymmärtämisessä löytyy ”sosiaalisesta puskurista” joka Virginiassa luotiin valkoisista. Niihin ei kuulunut mustat ja mulatit. Sen sijaan Karibialla jossa oli kertakaikkisen liian vähän valkoihoisia sama menetelmä toimi hieman toisin. Siellä mulatit (sekä joissakin tapauksissa jopa käytännössä mustat) saattoivat nousta puskuriksi eliitin ja massojen välille. Käytännössä eliitti siis tarvitsi ”keskiluokan” patoamaan alhaalta tulevaa painetta, joista Baconin kapina, sekä lukuisat muut vastaavat kautta Amerikan mantereen olivat aina hallitsevaa luokkaa uhkaamassa.

Theodore Allen on tutkimuksessaan verrannut Atlannin takaista tilannetta Englannin toimiin Irlannissa. Sielläkin syntyi tietty ”rotutietoisuus” kun hallitseva eliitti rakensi puskurin massojen (katoliset irlantilaiset) sekä eliitin (protestanttiset rikkaat englantilaiset) välillä. Saarelle rahdattiin siirtolaisia Englannista ja Skotlannista. Syntyi aina meidän päiviimme asti ulottuva ”Irlannin kysymys” saaren pohjoisosassa, Pohjois-Irlannissa. Allenin mukaan englantilaiset toivat hyvin pitkälle juuri Irlannin kokemuksen perusteella mallin Amerikkaan jota sovellettiin siten hieman eri tavalla nykyisen USA:n alueella ja toisaalta Karibialla. Irlantilaisista tuli omalla saarellaan toisen luokan kansalaisia, joita englantilainen saattoi kohdella miten tahansa pelkäämättä joutumasta oikeudelliseen vastuuseen. Ilmiö oli myöhemmin tuttu USA:n rotuerottelulainsäädännössä, jossa afroamerikkalaiset olivat käytännössä valkoisille ”vapaata riistaa”.

Hyvin monet eurooppalaiset ovat ihmetelleet miksi USA:ssa ei ole Euroopan kaltaista voimakasta poliittista (ja vasemmistolaista?) ammattiyhdistysliikettä eikä – kuten täällä ainakin aiemmin - ”luokkatietoisuutta”. Vastaus löytyy juuri USA:n rotukysymyksen kautta. USA:ssa ”luokkatietoisuuden” murtaminen tapahtui luomalla rotuajattelu jonka yhteydessä tuli samalla luotua myös ns. ”valkoinen rotu”. Sen tehtäväksi tuli toimiminen puskurina taloudellis-poliittisen eliitin ja rahvaan välillä. Ja koska valkoisia on USA:ssa yhä 5-6 kertaa afroamerikkalaisiin verrattuna on luonnollista ettei läheskään kaikki valkoiset, eurooppalaisten jälkeläiset koskaan päässeet eivätkä koskaan pääsekään pelkästään ihonvärinsä perusteella etuoikeutettuun asemaan. Heitä on yksinkertaisesti liian paljon. Heistä on käytetty jo vuosisatoja nimitystä ”valkoinen roskaväki”. Takavuosina heitä, näitä nöyryytettyjä, lohdutettiin sillä, että heidän alapuolellaan oli sentään vieläkin heikommassa asemassa olevia.

Valkoinen rotu on hyvin abstrakti käsite siinä kuin monet muutkin (vrt. isänmaallisuus). Kun ensimmäiset suomalaiset matkustivat Delawaren siirtokuntaan 1600-luvulla heidän ”rotutietoisuuden” kanssa saattoi olla vähän niin ja näin. Aikalaiskuvaukset siitä kuinka tämä kovia kokenut Värmlannin kautta Amerikkaan matkannut joukkio suuressa määrin lyöttäytyi paikallisten intiaanien joukkoon sulautuen heihin mitä ilmeisemmin suurissa määrin (aviosuhteet yleisiä) on myös omalta osaltaan valottamassa koko rotukäsitettä. Ilman intiaaneja monet Delawaren suomalaisetkin olisivat kuolleet armottomissa ensimmäisten vuosien olosuhteissa.

Suomen televisiossa esitettiin suosittua sarjaa ”Perhe on pahin” 1970-luvulla. Eräässä sen jaksossa vietettiin mustan Jeffersonin perheen pojan kihlajaisjuhlia. Vauras perhe oli palkannut valkoisen baarimikon palvelemaan kutsuvieraita. Tarjoillessaan talon isännälle Jeffersonille hän puhutteli tätä kohteliaasti termillä ”sir”. Valkoisesta ”rotutietoisuudesta” varma Archie Bunker hämmästyi tällaista ennenkuulumatonta asiaa, jolloin isä-Jeffersonin totesi Archille: ”Kuuntele kun kerron vähän elämästä. Tuo baarimikko työskentelee minulle. Sillä kun sinulla sattuu olemaan ”vihreää” (seteleitä) taskussa, silloin mustasta tulee hänen suosikkivärinsä.”

Sitä mukaa kun ”rotutietoisuus” on laantunut ympäri maailmaa on myös etnisesti valkoisiksi arvioitujen määrät jouduttu laskemaan uudelleen. Kuuban kommunistihallinto on aiemmin väittänyt maan asukkaista 65%:n olevan valkoisia, todellisuudessa Miamin Yliopiston tutkimuksen mukaan kuubalaisista vain 38% on valkoisia. Brasiliassa valkoiset ovat myös vähemmistönä (48%) ja USA:ssa he ovat vähemmistönä vajaan 40 vuoden kuluttua. Kyse ei ehkä ole aina sekoittumisesta vaan yksinkertaisesti siitä että määritteestä ”valkoinen” tehtiin usein synonyymi määritteelle ”etuoikeutettu”. Se aikakausi on jo kuitenkin peruuttamattomasti takanapäin.

 

 


 - pelontorjunta | Kommentoi



 Jungle fever – värillä ei ole väliä?
11.10.2011 11:00 | pelontorjunta

linkki videoon

 

Rotujenväliset suhteet eivät ole koskaan olleet missäänpäin maailmaa niihin helpoimpiin kysymyksiin kuuluvia. Joskus on tosin yritetty selittää ongelmien kuuluvan vain johonkin toiseen maahan tai järjestelmään. Tyypillistä oli esim. reaalisosialismin väite, jonka mukaan rotusorto ja rotuerottelu oli kapitalististen, jälkikolonialististen valtioiden ongelma, joka ratkeaa kuin itsestään kun siirrytään sosialismiin. Myös Brasilia on pyrkinyt enemmän tai vähemmän kiistämään oman rasisminsa. Pintapuolisen tarkastelun jälkeen huomataan kuitenkin sikäläisen yhteiskunnan oleva mitä merkillisimpien värivivahteiden, ns. ”halveksunnan vesiputouksen” kyllästämä. Rikas hyvin valkoinen pieni eliitti, hyvin suuri tummahko, jopa musta alaluokka. Välissä toistaiseksi liian pieni yhteiskunnallisesti tasoittava ja rauhoittava keskiluokka, sekin pääasiassa valkoisista eurobrasseista koostuva.


Rotusuhteissa kiinnostavan tärkeän osa-alueen muodostaa myös erirotuisten ihmisten rakkaus- ja seurustelusuhteet. Ne usein paljastavat miten yhteiskunta mikrotasolla todellisuudessa reagoi rotukysymykseen. Usein virheellisesti luullaan, että tämä problematiikka olisi vain valkoisten päänvaiva, mutta todellisuudessa siitä ei ole yksikään rotu tai etninen ryhmittymä vapaa.

Vuonna 1991 Spike Lee ohjasi tunnetun elokuvansa ”Jungle fever”, joka käsitteli rotukysymystä tästä perspektiivistä. USA:n kansalaisoikeusliikkeen ja eteenkin yhteiskunnan yleisen muutoksen myötä rotujenvälisen jännitteen rajuin vaihe oli maassa takanapäin ja oli aika vilkaista miten ”racial harmony” mikrotasolla oli edennyt. Spike Leeta ei ainakaan tarvitse syyllistää siitä, että hän olisi vajonnut siirappimaiseen näkemykseen rotujenvälisen seurustelun tai avioelämän mutkattomuudesta ja onnesta. Päähenkilöihin kuuluvien Flipperin (Wesley Snipes) ja Angien (Annabella Sciorra) rakkausuhde on jo lähtökohtaisesti tuhoon tuomittu kuten molemmat henkilöt elokuvan loppupuolella sen tunnustavatkin. Suhteen aloittaa voima joka sen lopulta tuhoaakin: pelkkä uteliaisuus.

Rasismiin yhdistetään usein ajatus jonkin rodun tai etnisen ryhmän vallasta tai ylivallasta. On esimerkiksi valkoista ylivaltaa ja mustaa ylivaltaa ajavia tahoja. Rodullista tai etnistä ylivaltaa ajavat liikkeet haluavat yleensä muodostaa yhteiskunnan, jossa vallitsee rotujen välinen arvojärjestys ja epätasa-arvoiset olosuhteet. Toinen rasismin muoto liittyy rotupuhtauteen, jonka kannattajat pyrkivät estämään kielloin rotujen tai kulttuurien sekoittumisen. Rotusyrjintä on määritelty tiettyyn rotuun tai etniseen ryhmään kuuluvien suosimiseksi tai johonkin tiettyyn rotuun tai etniseen ryhmään kuuluvien syrjinnäksi esimerkiksi työelämässä, oikeudenkäytössä, julkisissa palveluissa tai asunnonvuokrauksessa.

Kun rasismin yleiset taustat ja historia tiedetään ja se että sen jyrkimmän vaiheen varjo on pitkä ja synkkä voi se synnyttää myös vastareaktiona ilmiön jota on myös syytä varoa. USA:ssa siitä käytetään joskus nimikettä ”kielletty hedelmä”. Näin saattaa syntyä nuoressa  ihmisessä syntymäkodistaan irtautuvan ja luonnolliseen itsenäistymisvaiheeseen liittyvä tarve ”rikkoa rajat”. Nykyisin kansainvälistyvässä maailmassa se on helpompaa kuin aiemmin. Syntyy rasismin eräänlaisena peilikuvana seksuaalinen uteliaisuus toista rotua edustavaa ihmistä kohtaan. Mukana saattaa olla myös uhmaa, näyttämisen halua, motiivi osoittaa ”edistyksellisyytensä” ja ”liberaalisuutensa”. Suorastaan koomiselta kuulostaa myös ne myytit joita eri etnisten ryhmien seksuaalisuuteen liitetään. Ikään kuin ihmisen anatomia ei olisi tutkinut näitä mahdollisia eroja ja todennut ne voittopuolisesti täydeksi hölynpölyksi. Näitä hauskoja esimerkkejä ovat esim. sukuelinten kokoerot (jotka tunnetusti ryhmä sisällä ovat huikean paljon suuremmat kuin ryhmien välillä), sukupuoliset kyvyt (yksikään rotu ei ole sen kyvykkäämpi tai kyvyttömämpi kuin toinen) sekä tavat (ne liittyvät tietysti tapakulttuuriin, on tosin luultavaa että ihmiset eri puolella maailmaa rakastelevat aika lailla samalla tavalla puhukoot ihmiset lämpimikseen mitä tahansa).

Spike Leen sanoma omassa elokuvassaan liittyy juuri rasismin jyrkimmän vaiheen aikaansaaman pitkän varjon vaikutuksiin. Yhteiskunnan asenteet, mutta hyvin paljon yksiköiden persoonallisetkin asenteet aiheuttavat sen, että kansainvälistenkin tutkimusten mukaan eri etnisten ryhmien välillä solmitut seka-avioliitot hajoavat keskimääräistä useammin. Se taas ei merkitse sitä, etteikö maailmassa olisi paljon esimerkkejä onnistuneista ja tasapainoisista seka-avioliitoista. Missä siis lepää arvoitus suhteellisen onnellisesta seka-avioliitosta tai seurustelusuhteesta?

Jungle feverissä esittäytyy tällainen alkava seurustelusuhde, jonka Lee tavallaan jättää kuitenkin arvoituksellisesti ikäänkuin ”ilmaan”. Paulie Carbone (John Turturro) on nuori mies, joka on leskeksi jääneen isänsä silmäterä ja tämän tiukan kontrollin ja ohjauksen alla. Pauli pitää isänsä perustamaa amerikanitalialaisen paikallisen väen suosimaa pikkukahvilaa. Jokapäiväisenä vieraana kaupassa käy myös Orin Goode-niminen afroamerikkalainen nuori nainen ostamassa lehtiä. Työväentaustaisessa etniseltä koostumukseltaa yhtenäisessä lähiössä pyritään ”pitämään yhtä”, vaalimaan ”samoja arvoja”. Nämä tietysti aikaansaavat sen, ettei eri etnisiin ryhmiin kuuluvien seurustelusuhteita ja liittoja katsota hyvällä silmällä.

Ratkaisevaa Paulie Carbonen tapauksessa ei kuitenkaan ole rotukysymys, vaan pikemminkin itsenäistyminen ja pyrkimys henkiseen vapauteen. Paulie on eri maata kuin ne vanhaan New Yorkin amerikanitalialaiseen työväenkulttuuriin sitoutuneet ihmiset, joita hän palvelee pikkukaupassaan. Hän lukee, on kiinnostunut elämästä oman ahtaan elinpiirinsä ulkopuolella (turha kuvitella että New Yorkissa ja muissa suurkaupungeissa ei olisi myös nurkkakuntaisuutta). Orin on tuonut hänelle myös yliopiston pääsyhakemuslomakkeita. Paulie haluaa ”jotain uutta”. Ja ennen kaikkea: hän haluaa oman elämän. Elokuvan alussa hän seurustelee kulmakunnan tytön Angien kanssa. Kun kulovalkean tavoin leviää ”järkyttävä tieto” Angien olleen seurustelusuhteessa mustan miehen kanssa, suhtautuu Paulie asiaan hyvin eri tavalla kuin ympäristönsä. Hän suree sitä, ettei hänen suhteestaan Angien kanssa sinällään tullut mitään muttei lähde yleiseen rotuhysteriaan mukaan. Myöhemmin hän tyynesti ilmoittaa Angielle, tämän palattua takaisin, ettei ajattele enää asioista kuten aiemmin eikä ole enää kiinnostunut seurustelemaan hänen kanssaan. Ikkuna meni kiinni.

Mutta toinen on aukeamassa. Elokuvan loppupuolella viriävän Paulien ja Orinin seurustelusuhteen mahdollinen onnistuminen on jätetty tietoisesti arvoitukseksi. Mutta Spike Lee halusi todennäköisesti muuten aika kyyniseen elokuvaansa tuoda toivon pienen ikkunan, jossa näkyvät Paulie Carbonen ja Orin Gooden kasvot. Onnistumisen mahdollisuutta nimittäin parantaa juuri se, että Paulie ei lähde seurustelemaan Orinin kanssa koska tämä edustaa ”kiellettyä hedelmää” kaikkine siihen liittyvine fantasioineen vaan koska tämä nuori nainen on ajatusmaailmaltaan ja asenteiltaan lähempänä häntä kuin kulmakunnan lievästi sanottuna kanamaiset ja perin rajoittuneet italialaistytöt.

Jungle fever on siis paitsi elokuva rotusuhteista myös, ja ehkä ennen kaikkea, elokuva henkisestä vapautumisesta ja maailmankuvan avartumisesta. Spike Lee ansaitsee kiitoksen siitä, että hän toi yleiseen tietoisuuteen sen, ettei rasismi ja rotuennakkoluulot niihin liittyvine pitkine varjoineen ole suinkaan vain valkoisten etuoikeus. Samanlaisten taakkojen alla tappelee myös USA:n musta väestö. Ns. viharikoksia tekevät myös afroamerikkalaiset, jotka niin hämmästyttävältä kuin se kuulostaa, toisaalta usein kohtelevat yhteisönsä naisia hyvinkin alentuvasti, mutta toisaalta näiden aloitettua seurustelusuhteen valkoisen miehen kanssa, syyttävät tätä pian ”rotunsa pettämisestä”. Heitä voi verrata tiukan linjan muslimeihin jotka samalla logiikalla ”suojelevat yhteisönsä naisia” kun taas heille on annettu vapaus seurustella kenen kanssa tahansa.

Kuluneen fraasin mukaan ”tieto lisää tuskaa”. Jungle feverissä ne jotka muita rohkeammin hakevat tietoa,  pyrkivät riippumattomuuteen ja ajattelunvapauteen – nimittäin Paulie Carbone ja Orin Goode – keräävät potin. Miinussarakkeista löytyvät toisaalta vanhoissa rotuennakkoluuloissa piehtaroivat ikuiset pelkääjät sekä toisaalta viidakkokuumeessa hourailevat ”liberaalit” rajojen rikkojat.


( Päivitetty: 11.10.2011 15:48 )

 - pelontorjunta | Linkki



 Björn Wahlroos ja raadannan ihanuuden evankeliumi
26.09.2011 08:38 | pelontorjunta

Sammon hallituksen puheenjohtajan Björn Wahlroosin mukaan suomalaiset työskentelevät melko vähän. Äskettäin MTV:n haastattelussa Wahlroos peräsi tiukempaa kuria erityisesti työelämään aikoville nuorille.

Miksi ihmeessä meillä on Euroopan pisimmät opiskeluajat? Miksi ihmeessä opiskelijat pitävät luonnollisena, että kun he ottavat paperinsa ulos, ilmoittautuvat heti työttömyyskortistoon? Kyllä meidän pitää vaatia nuorisolta jotain, jos me vaadimme tulevilta eläkeläisiltä, kertoo Wahlroos.

Työssä käyvää väestöä Wahlroos moittii liian vähäisestä puurtamisesta. Hänen mukaansa verotusta pitäisi kehittää työllisyyttä kannustavaksi yritysveroa, pääomaveroa ja marginaaliveroa alentaen.

Suomalaiset työskentelevät aika vähän. Me työskentelemme vain runsaat 1 500 tuntia vuodessa, joka on vähän enemmän kuin ruotsalaiset ja norjalaiset, mutta lähes kolmanneksen vähemmän kuin amerikkalaiset työskentelevät ja vain runsaat puolet siitä mitä Kauko-idässä, toteaa Wahlroos.

Wahlroos tuntee epäilemättä suurta huolta siitä että työtä ei enää arvosteta uusien sukupolvien keskuudessa kuten aiemmin. Siksi meidän olisikin kiinnostavaa viivähtää hetki aikakaudessa jolloin ”työtä arvostettiin”. Seuraavassa lainaus 1860-luvun englantilaisen tehdastarkastajan raportista:

Eräässä valssaamossa, jossa nimellinen työpäivä kesti kello 6:sta aamulla kello 5.30 illalla, eräs poika työskenteli 4 yötä joka viikko vähintäin kello 8.30:een illalla seuaavana päivänä...Ja tätä hän teki 6 kuukautta”

Eräs toinen, 9-vuotias työskenteli usein kolme 12-tuntista työvuoroa peräkkäin ja 10 vuoden vanhana 2 päivää ja 2 yötä peräkkäin.”

Kolmas, nyt 10-vuotias, työskenteli kello 6:sta aamulla kello 12:een yöllä, kolme yötä läpeensä ja kello 9:ään illalla muina öinä.”

Neljäs, nyt 13-vuotias, työskenteli kello 6 iltapäivällä seuraavan päivän kello 12:een kokonaisen viikon ajan, ja toisinaan kolme vuoroa peräkkäin, esim. maanantaiaamusta tiistaiyöhön.”

Viides, nyt 12-vuotias, työskenteli eräässä Stavelyn rautavalimossa kello 6:sta aamulla kello 12:een yöllä 14 päivää; hän oli kykenemätön sitä enää tekemään.”

George Allingworth, 9-vuotias, sanoi:

Tulin tänne viime perjantaina. Meidän oli aloitettava seuraavana päivänä kello 3 aamulla. Jäin sen vuoksi tänne koko yöksi. Asun 5 mailin (8 km) päässä täältä. Nukuin lattialla nahkainen esiliina allani ja pieni takki peitteenäni. Kahtena muuna päivänä olin täällä kello 6 aamulla. Niin, tämä on kuuma paikka! Ennen kuin tulin tänne, työskentelin niin ikään kokonaisen vuoden sulatossa. Se oli suuri tehdas maalla. Minä aloitin samoin lauantaiaamuisin kello 3, mutta saatoin ainakin mennä maata kotiin, koska se oli lähellä. Muina päivinä aloitin kello 6 aamulla ja lopetin illalla kello 6 tai 7 illalla”.

 

Ei ole siis epäilystäkään siitä, että nämä lapset elivät maailmassa jossa työtä todella ”arvostettiin”. Niiden, joista kansa on länsimaissa nykyään sivistymättömämpää ja yhteiskunnallisesti passiivisempaa kuin koskaan ja jotka päivittelevät esimerkiksi sen yleistiedossa olevia kammottavia aukkoja, on mielenkiintoista muistaa aika, jonka tyypilliset, omimmat edustajat kuulostaisivat nykyään lähinnä kehitysvammaisilta:

Jeremias Haynes, 12 vuoden ikäinen:

Kuningas on se, jolla on kaikki raha ja kulta. Meillä on kuningas; sanotaan, että hän on kuningatar, sanovat häntä prinsessa Aleksandraksi. Sanotaan, että hän on nainut kuningattaren poja. Prinsessa on mies.”

William. Turner, 12-vuotias:

En elä Englannissa. Luulen, että sellainen maa on olemassa, mutta en ole ennen tiennyt siitä mitään.”

John Morris, 14-vuotias:

Olen kuullut kerrottavan, että jumala on luonut maailman ja että kaikki kansa hukkui yhtä ihmistä lukuun ottamatta; olen kuullut, että tämä oli ollut pieni lintu.”

William Smith, 15-vuotias:

Jumala loi miehen, mies vaimon.”

Edward Taylor, 15-vuotias:

En tiedä mitään Lontoosta.”

Henry Matthewman, 17-vuotias:

Perkele on hyvä mies. Minä en tiedä, missä hän elää. Kristus on huono mies.”

Tämä tyttö (10-vuotias) tavaa God[Jumala]-sanan asemesta Dog [koira] eikä tiedä kuningattaren nimeä.”

 

Suurin osa maailman tähänastista historiaa on Jeremias Haynesin, William Turnerin, John Morrisin ja Edward Taylorin historiaa. Kehityksen nopeus on ollut lähes käsittämätöntä, varsinkin kun huomioidaan, että he elivät kurjaa, passiivista, kasvimaista elämäänsä maassa, joka heidän elinaikanaan oli ehkä koko maapallon edistynein. Kirjallisuuden nobelisti Elias Canetti totesi kerran, ettei hän voinut katsoa maailmankarttaa tuntematta nenässään käristyvän ihmislihan hajua. Niin täynnä kärsimystä kuin viime vuosikymmenet ovat monille ihmisille olleetkin, on ensimmäistä kertaa ihmiskunnan historiassa tultu vaiheeseen, jossa merkittävä osa maailman ihmisistä elää sentään elämäänsä päivästä päivään herättämättä tätä teurastuksen ja elävältä paistamisen hajua. Nälkä on aina nälkää, mutta haarukalla ja veitsellä syödyllä keitetyllä lihalla tyydytettävä nälkä on toista kuin nälkä, johon hotkitaan raakaa lihaa käsin, kynsin ja hampain.

Kansainvälisen työjärjestön ILO:n arvion mukaan maailmassa on vähintään 250 miljoonaa 5-14-vuotiasta lapsityöntekijää. Näistä noin 140 miljoonaa tekee täyspäiväistä työtä. Pahimmillaan työnteko on orjatyötä. Ei ole pientäkään epäselvyyttä etteivätkö ne maat jossa ”työtä arvostetaan” olisi samalla myös maailman köyhimmät. Siellä missä ”lorvailu” ja ”joutenolo” ovat saaneet lisääntyvässä määrin Wahlroosin tapaiset huolestumaan, eletään ihme kyllä lisääntyvässä määrin ihmisarvoisempaa elämää. Ruotsalaiset ja norjalaiset jotka ovat meitä suomalaisia ”pahempia lorvailijoita” ovat myös meitä vauraampia kun taas amerikkalaiset joiden ahkeruutta meidän olisi seurattava ovat kaikilla mittareilla mitattuna joko elintasoltaan ja elämänlaadultaan meidän tasollamme tai peräti jo jääneet meistä jälkeen. Wahlroosin ja hänen hengenheimolaistensa logiikka ontuu ja siitä luulisi median toimittajienkin olevan enemmän kiinnostuneita.


 - pelontorjunta | Linkki



 Suuri Hiljaisuus
17.06.2011 11:16 | pelontorjunta

Italowesterneistä puhuttaessa useimmat ihmiset muistavat ehkä Sergio Leonen mutta todellisuudessa Leone teki hyvin pienen osan kaikista Italian 1960-luvun ja 1970-luvun alun noin 600:sta westernistä. Toinen todella tunnettu ohjaaja oli Sergio Corbucci, joka ohjasi moinissa maissa suorastaan kulttiasemaan nousseet Django-elokuvat sekä mm. Companerosin.

Sergio Corbucci (1927-1990) aloitti uransa monen muun ohjaajan tavoin kriitikkona ja elokuvasta kirjoittajana. 1950-luvulla hän alkoi toimia myös apulaisohjaajana, josta tie omien käsikirjoitusten ja pitkien ohjausten pariin alkoi aueta. Hän ohjasi paljon lännenelokuvia ja perusteltua onkin pitää Corbuccia yhtenä tärkeimmistä spaghetti-westernin ohjaajista esimerkiksi Leonen ja Sergio Solliman rinnalla. Corbucci siirtyi myös komedian pariin myöhemmällä urallaan ja ansioitui myös kyseisen, lännenelokuviakin sävyttäneen, kevyemmän lajityypin parissa. Vuonna 1966 valmistunut Django sekä hieman myöhäisempi Compañeros (1970) osoittavat hyvinä esimerkkeinä Corbuccin mieltymyksen huumoriin, enemmän tai vähemmän absurdiin sellaiseen.

Vuonna 1968 oli kuitenkin vuorossa western, joka tulisi hylkäämään kaikki kyseisen lajityypin komedialliset ja keveät elementit ja potentiaalin. Eräässä 1970-luvun alkupuolen haastattelussa hän myönsikin vastustavansa onnellisia loppuja, vaikka se ei aina hänen muusta tuotannosta näkynytkään. Tämä valittu linja itsessään ei tietenkään vielä riitä sillä onneton ja itsetarkoituksellisesti ”vaikuttava” lopetus voi olla vain halpa ja nihilistinen metodi välittää vaikka omaa tuskaansa maailmalle elokuvaa keppihevosena käyttäen, ilman pienimpiäkään motiiveja uudenlaisen, ehkä parantavan asian rakentamiseen ja esittämiseen. Western lajityyppinä on hyvinkin potentiaalinen myyttisten ja kuolemattomien sankarihahmojen esittämiseen, mikä on siis käytännössä yhtä kuin onnellinen loppu. Juuri siksi Corbuccille tarjoutuikin oiva tilaisuus rikkoa tätä tottumusta.

Suuri Hiljaisuus, Il Grande Silenzio, sijoittuu vuoden 1898 Utahin lumisille vuoristoille, joissa vallitsee irvokkaaksi kasvanut ihmisjahti, vieläpä lain ja auktoriteettien hyväksymänä. Palkkamurhasta ja ihmisjahdista on kehittynyt elinkeino, jolla myös elokuvan tehokas ja määrätietoinen alan ammattilainen Loco (jota näyttelee Klaus Kinski) elättää itsensä ja turvaa tulevaisuuttaan. Läheisellä kaupungilla kuitenkin alkaa näennäinen sivistys nostaa mielenkiintoaan myös pienimmille syrjäseuduille, ja elokuvan päähenkilöiden tietämättä virkamiehet, kuvernöörit ja lakia edustavat tahot miettivät kuumeisesti keinoa yksinkertaisesti tappamisen lopettamiseen. Mykkä Silenzio (Jean-Louis Trintignant) on lapsuudestaan juontavan erittäin väkivaltaisen henkisen ja fyysisen trauman vanki, mutta myös seudun kavahdetuin aseenkäyttäjä; mies joka ei koskaan vedä asettaan ensin ja joka surmaamisen sijasta ampuu vastustajiltaan peukalot poikki, jotta he eivät enää ikinä kykenisi käsittelemään asetta. Väkivaltaan alituisesti turvautuvat tahot ovat potentiaalisia unohtamaan sen jälkeiset seuraukset, ja näistä aineksista elokuvan selkeä, tarpeettomat hahmot pois jättävä, mutta sitäkin rikkaampi tarina syntyy.

 

Get the Flash Player to see this player.

 

 

 

Suuri Hiljaisuus on useimmista muista westerneistä poiketen väkivaltainen elokuva väkivallasta, ja tapahtumien kammottavin aines onkin henkistä laatua. Käsikirjoituksen Corbuccin kanssa toteuttivat Mario Amendola, Vittoriano Petrilli ja Bruno Corbucci. Kaikki turha on karsittu niin hahmoista kuin dialogistakin, ja asetelma lopullisesti vanhenevasta, villin luonnon moraalista eläneestä maasta on samalla tavalla vastaansanomattoman uskottava ja todenmukainen. Ns. sivistys on saanut ihmisten silmiä auki, mutta ei edes sekään näytä kykenevän poistamaan kaikkea sen itsensä suojissa tehtävää ja hyväksyttävää omaneduntavoittelua ja mahdollisesti entistäkin jatkuvampaa ja laajempaa väkivaltaa. Elokuvan hyväntahtoinen, hieman naiivi, mutta lahjomaton sheriffi Burnett toimiikin tämän ironisena vertauskuvana. Lähestyvä sivistys ja auktoriteetit - joihin sheriffi olennaisesti lukeutuu – ei kykene poistamaan todellista potentiaalia ihmisluonnossa ja yhteiskunnassa.

Elokuvan palkkamurhaajat tekevät ihmismetsästystä vain työnään. Näin kovissa oloissa jokaisen on ajateltava omaa tulevaisuuttaan vaikkapa vain lähestyvää vanhuutta. Tehokas palkkamurhaaja Loco ei tunne hetkeäkään toimivansa "väärin" tai "epäinhimillisesti", onhan hänellä myös kylän viranomaisten antama myönnytys ja rahallinen motiivi kaikille teoilleen, jotka loppua kohden yltyvät jo järjettömiin mittasuhteisiin.

Päähenkilö Silenzio kuuluu elokuvahistorian vaikuttavimpiin kuoleman ja melankolian ruumiillistumiin. Trintignantin koko suoritus tässä roolissa on upea, ja jokainen kohtaus jossa hän on läsnä kertoo jo sanattomasti olennaisen koko väkivaltateemasta ja päättymättömästä kierteestä. Trintignantin kyky välittää kaikki oleellinen ihmisen tunnekirjosta vain kasvojensa ja silmiensä välityksellä vailla ainuttakaan lausuttua sanaa on merkki ranskalaisnäyttelijän ja Corbuccin yhdessä tavoittamasta näkemyksestä ja käsityksestä siitä mistä ihminen henkisiltä ominaisuuksiltaan koostuu.

Suuri Hiljaisuus herätti aikoinaan suurta huomiota erityisesti tumma- ja vaaleaihoisten ihmisten välisellä rakastelukohtauksella, sillä ihonväriltään eri väristen ihmisten suhteet, varsinkin seksuaaliset, olivat elokuvan julkaisuaikana tabu kaikkialla maailmassa. Suomessa elokuva sai esitysluvan vasta vuonna 1989, silloinkin leikattuna versiona. Puolisonsa murhaamisesta kostoa Locolle janoava tummaihoinen nuori Pauline (Vonetta McGee) rakastuu Silenzioon ja huomaa elokuvan loppupuolella tosiasiallisesti jo luopuneensa koko kostotavoitteestaan.

 

Get the Flash Player to see this player.

 

 

 

Mitkä tekijät vaikuttavat siihen että Corbuccin Suuri Hiljaisuus on suuri italowestern ja suuri elokuva yleensäkin? Miksi sen arvostus on myös viimeisen 40 vuoden aikana vain entisestään kasvanut? Pelkkä spagettiwesterneille ominainen raakuus ja kyynisyys ei riitä selittämään syytä. Pikemminkin juuri elokuvan lohduttomuus eteenkin loppuratkaisussa ja sanoma yleensäkin puhuttelee yhä elokuvan nähneitä. Se on ns. ”rankka elokuva” eikä sitä todellakaan voi suositella niille joiden mielestä elokuvan pitää ehdottomasti olla ”hauska”. Nimittäin tämän elokuvan katsominen ei ole taatusti ”popcorn-nautinto” . Mutta hieno se on ja sen viesti on äärimmäisen ajankohtainen myös tämän päivän ihmiselle.

Jos näet olisimme rehellisiä myöntäisimme että todellisuudessa ns. ”onnellista loppua” ei useimmiten olekaan. Maailmanhistoria on täynnä tapahtumia jossa voiton eivät todellakaan ole vieneet hyvät, puhdasmieliset, oikeudenmukaisuuden puolesta toimineet ja säädylliset. Corbuccin elokuvan loppuhuipennus ahdistaa varmasti joitakin sadisteja lukuun ottamatta jokaista ihmistä. Juuri tuossa vaiheessa on kuitenkin syytä miettiä myös sitä ovatko ”hyvät ihmiset” sittenkään niin hyviä. Juuri tämä inhottava kysymys esitetään päin naamaa kymmenissä Leonen, Corbuccin, Solliman ja muiden genren suurten ohjaajien teoksissa.

Paulinea ja Silenziota keskeisempään osaan elokuvassa nousee sittenkin Klaus Kinskin loisteliaasti esittämä palkkiometsästäjä Loco. Millaisella moraalisella oikeudella siis tuomita ihmistä jolla on tekojensa takana ”laillinen oikeus”? Tämä kysymys on vaivannut ihmiskuntaa tuhansia vuosia. Olivatko siis elokuvan Utahin syrjäseutujen vuoristojen nälkää nähneet ja sen vuoksi omalakiselle yhteiskunnalliselle tasoituksen tielle lähteneet vuoriston kapinalliset vain ja ainoastaan ”hyviä ihmisiä”? Oliko Suomen punaisella osapuolella moraalinen oikeus lähteä toteuttamaan omankäden oikeuttaan vuosina 1917-18? Mikä oli oikeus jolla valkoinen osapuoli kosti keväällä ja kesällä 1918? Miksi laupeus ei saanut toteutua? Miten lujalla perustalla Stalinin hallinnon oikeus lepäsi? Entä tämän päivän monien kehitysmaiden despoottien? Entä näiden maiden kapinallisten omien tekojen oikeutus ja eteenkin vastuu näiden tekojen seurauksista? Miksi ihmeessä joku Che Guevara edustaa edelleenkin sankaruutta vasemmistoradikaaleille nuorille?

Professori Heikki Ylikangas on omissa lain historiaa käsittelevissä tutkimuksissa osoittanut että erityisesti köyhät ja ”alistetussa asemassa” olevat hyötyvät laillisuudesta sittenkin enemmän kuin ne joilla on taloudellista ja poliittista valtaa takanaan. Huono, puutteellinen ja epätasa-arvoisena mielletty laki on kaikesta aiheellisestakin kritiikistä huolimatta sittenkin aina parempi kuin selkeä laittomuus. Suomen historiassa 1500-luvun laittomuus johti ennennäkemättömään rikollisuuteen ja raakuuteen, josta eteenkin köyhät kärsivät hirvittävästi. Maata riivannut kostojen ja verikostojen kierre katkaistiin 1600-luvulla ottamalla käyttöön tosiasiallisesti Mooseksen laki. Tuomioiden määrä kasvoi, mutta varsin pian rikollisuus väheni ”normaalitasolle”.

Corbuccin elokuva on hiljainen, äärimmäisen voimakas ajatelma ihmisestä, joka tiedostamattaan petaa itselleen onnettoman ja usein hyvin pikaisen lopun siinä vaiheessa, kun hän lähtee toteuttamaan kostoaan tai muuten seuraa sokeasti väkivaltaimpulssiaan. Vaikeaan ja aj