Suntuubi-palvelussa käytetään evästeitä. Palvelua käyttämällä hyväksyt evästeiden käytön. Lue lisää. OK
2930311234
567891011
12131415161718
19202122232425
262728293012

RSS

 Afrikkalainen Exodus
20.11.2012 18:46 | pelontorjunta

Ihmisen evoluutiolla tarkoitetaan ihmisen kehittymistä ja eriytymistä omaksi lajikseen ihmisen ja muiden apinoiden tai apinaihmisten yhteisestä kantamuodosta. Ihmisen evoluution tutkimukseen liittyy useita tieteenaloja, muun muassa fyysinen antropologia ja perinnöllisyystiede. Ihmisellä tarkoitetaan tässä yhteydessä ensisijaisesti ihmisten (Homo) suvun jäseniä, mutta ihmisen evoluution tutkimus käsittelee yleensä myös muita hominideja.

Uutta tietoa on saatu viimeisen kahdenkymmenen vuoden aikana fossiililöydösten myötä runsaasti. Ihmisten, apinaihmisten ja ihmisapinoiden kehitystä kuvaavat sukupuut näyttivät vielä jokin aika sitten varsin selkeiltä. Uusimpien löytöjen myötä sukupuu on kuitenkin muuttunut ”kehityspensaaksi”, johon pitäisi saada mahdutettua lukemattomat viime vuosina löydetyt uudet sukulaiset. Monet entiset käsitykset ovat osoittautuneet liian yksinkertaisiksi: ihminen ei ole suoraan kehittynyt nykyisenlaiseksi ihmisapinoista, vaan kehityslinjassa on ollut useita haaroja. Maapallolla on elänyt samanaikaisesti useita eri ihmis- ja apinaihmislajeja. Vasta noin 30 000 vuotta sitten neandertalinihmisen kuoltua sukupuuttoon syntyi nykyinen tilanne, jossa maailmassa on vain yksi ihmislaji, nykyihminen. Huomattavaa on myös se miten hidasta esim. Euroopassa eläneen neandertalilaisen ihmisen kehitys parin sadan tuhannen vuoden aikana lopultakin oli. Ja vaikka täyttä tieteellistä varmuutta ei vielä ole vaikuttaa myös siltä että yksikään nykyisin elossa oleva ihminen ei ole minkään muun kuin nykyihmisten jälkeläinen. Uusimmat tutkimukset ovat myös kyseenalaistaneet viime vuosina esitetyt väitteet neandertalilaisen ihmisen ja nykyihmisen risteytymisestä vaikka neandertalilaisgeeniä on havaittu ehkä 2% eurooppalaisissa (muttei afrikkalaisissa). Tämä johtunee siitä että neandertalilaisella ja nykyihmisellä on yhteinen ehkä puolen miljoonan vuoden takaa mutta joka ei näy enää afrikkalasissa. DNA-tutkimukset osoittavat ettemme ole neandertalilaisten jälkeläisiä. Itseasiassa neandertalilaiset olivat tuoreen brittitutkimuksen mukaan vähentyneet murtoosaan aiemmasta määrästään Euroopassa ennenkuin ensimmäiset nykyihmiset saapuivat Eurooppaan.

Noin 35 vuoden aikana on tieteellinen konsensus voimistunut siitä että kaikki nykyisin elävät yli 7 miljardia ihmistä on todellisuudessa yhden ainoa kerran eläneen afrikkalaisen äidin – todellisen ”Eevan” - jälkeläisiä. Useimmat vähänkin asiasta kuulleet ihmiset hyväksyvät tämä tieteellisen teorian mutta kaikesta huolimatta kertomus ”lisääntymisestä ja maan täyttämisestä” ihmisillä on epäilemättä eräs järisyttävimmästä ihmeistä. Täyttä tieteellistä varmuutta tapahtumaketjusta ei vieläkään ole mutta erään varsin todennäköisen skenaarion mukaan kaikki sai alkunsa Afrikan itäosissa, suurten järvien ja maanosan itärannikon välisellä seudulla.

 

Afrikka

 

Kaikki nykyisten Afrikan ulkopuolisten väestöjen (”rotujen”) ominaisuudet ovat kehittyneet selvästi alle 100 000 vuodessa. Yhden syntykodin hypoteesia tukevat fossiilit, arkeologiset löydöt sekä biokemialliset ja geneettiset todisteet. Vanhin nykyihmisten fossiili on noin 195 000 vuoden ikäinen. Yli 130 000 vuoden ikäisiä nykyihmisten fossiileja ei ole löydetty muualta kuin Afrikasta. Lisäksi Afrikan väestöissä on selvästi enemmän perinnöllistä muuntelua kuin muiden mantereiden väestöissä ja muiden mantereiden populaatioissa ei juurikaan ole geenimuotoja, joita ei olisi Afrikassa.

DNA-molekyylien perusteella on laskettu nykyihmisen kehittyneen omaksi lajikseen noin 200 000 vuotta sitten. Kehitys oli vaiheittainen ja noudatti evoluutiolle ominaista vaihetta jossa eri ihmislajit elivät rinnakkain kunnes nykyihminen syrjäytti kehittyneempänä aiemmat ihmislajit. Nämä kuolivat sukupuuttoon ensiksi Afrikassa, myöhemmin Afrikan ulkopuolella. Kaikki ihmisen kehityslinjan alkujuuret on löydettävissä vain Afrikassa. Nykyihminen kehittyi Afrikassa. Vain Afrikassa oli olemassa parhaat mahdolliset olosuhteet nykyihmisen kehitykselle.

 

Afrikkalainen ”Mitokondrio-Eeva”


Kaikkien nykyihmisten DNA-tutkimuksin osoittavissa oleva kantaäiti asui siis itäisessä Afrikassa n. 200 000 vuotta sitten. Seuraavan n. 50 000 vuoden aikana tapahtui ensimmäiset DNA-tuloksin hahmotetut haarautumat. Me perimme kummankin vanhempiemme DNA:n ja koska saamme ainutlaatuisen sekoituksen molemmilta jokainen meistä on aivan aavistuksen verran erilainen DNA-rakenteeltaan. Meidän oma DNA on kuin ainutlaatuinen sormenjälki. Kirjaimilla A, G, C ja T se voisi olla vaikka kuvattavissa näin:

 

vaihtoehto a ACTTTCAATGGGTGTATCCTAGGGTGTACATATTTACT

vaihtoehto b ACTTTCAATGAGTGTATCCTAGGGTGTACATATTTACT

vaihtoehto c ACTTTCAATGGGTGTATCCTAGGGTGTATATATTTACT

vaihtoehto d ACTTTCAATGAGTGTATCCTAGGGTGTACATACTTACT

 

Tutkijoiden onneksi on olemassa kaksi osaa DNA:sta jotka eivät uudelleen yhdisty. Tämän ansiosta voidaan jäljittää ihmisen perimää tämän muuttumattoman DNA:n osan tietojen perusteella. Niitä on kaksi. Mitokondrio sisältää DNA:ta (mtDNA), joka on noin 16 600 emäksen mittainen rengasmainen DNA-molekyyli. Mitokondriossa DNA:ta on kuitenkin huomattavasti vähemmän kuin tumassa. Jälkeläinen saa hedelmöityksessä mtDNA:n vain äidiltä (uniparentaalinen periytyminen), kun taas tuman DNA:n jokainen saa molemmilta vanhemmiltaan. Toinen jota voidaan hyödyntää on muuttumaton osa Y-kromosomia.

 

Ensimmäinen sukuhaara

 

Noin 135 000-160 000 vuotta sitten tapahtui Afrikassa ensimmäinen nykyihmisen jälkeenpäin DNA-tutkimuksin todennettavissa oleva ”sukuhaarautuma”. Kuten aiemmin ja tulevaisuudessa näissä muutoksissa merkittävää roolia näytteli ilmaston ja olosuhteiden muutos joka pakotti suhteellisen pientä, tuskin paria tuhatta yksilöä suuremman nykyihmisen populaation siirtymistä toisistaan erilleen jotta ihmiset ylipäätänsä saattoivat selvitä hengissä. Tälle ajanjaksolle ajoittui jääkausi joka laski mm. merenpintaa kaikkialla maailmassa jopa sadalla metrillä. Mm. Euroopassa se näkyi siten että ihminen olisi voinut kävellä suoraan Ranskasta nykyiseen Iso-Britanniaan. Ilmasto viileni paikoitellen jopa 6 asteella. Afrikassa, jossa ainoastaan asui nykyihmisiä, osa ihmisistä vaelsi kuivuuden ja huonontuneiden olosuhteiden vuoksi kohti nykyistä Etelä-Afrikkaa, osa Kongon aluetta ja osa läntistä Afrikkaa kohden.

Oli myös neljäs ryhmä joka aloitti siirtymisen kohti Itä-Afrikan rannikko seutuja nykyisen Etiopian, Kenian ja Tansanian aluetta. Tätä viimeksi mainittua haaraumaa nimitetään DNA-tutkimuksissa L3:ksi.

 

Pois Afrikasta – ensimmäinen yritys

 

Arkeologiset löydöt Lähi-Idässä (Israel ja Arabiemiraatit) osoittavat että n. 100 000 -125 000 vuotta sitten pieniä ryhmiä afrikkalaisia nykyihmisiä siirtyi ilmeisesti pohjoisen reittiä pitkin Siinain kautta Israeliin ja jopa Turkin ja Syyrin väliselle seudulle. Varmuudella tiedetään vain se, ettei DNA- tutkimusten perusteella yksikään nykyihminen Afrikan ulkopuolella kuitenkaan polveudu näistä ihmisistä. Todennäköisin syy siihen miksi näin ei käynyt johtui yksinkertaisesti siitä syystä että nämä Afrikan ulkopuolelle siirtyneet ensimmäiset nykyihmiset menehtyivät olosuhteiden huonontuessa. Alkoi jälleen aika jolloin pohjois-Afrikka aavikoitui, samoin Arabian niemimaa.

 

Maailman ensimmäinen ”osteriravintola”

 

Nykyihmisen sukuhaara L3 siirtyi ilmastonmuutoksen ja huonontuneiden olosuhteiden vuoksi n. 100 00 vuotta sitten itäisen Afrikan rannikkoseudulle. Arkeologisten löytöjen perusteella aikakautena jolloin merenpinta oli nykyistä 5-10 metriä korkeammalla löytyy vielä tänään mm. Eritrean alueelta rinteistä selvät merkit entisestä merenrannasta jossa on täynnä nykyihmisten käyttämiä ostereita. Ihmiset myös kalastivat tänä aikana pääravinnokseen. Ehkä korkeintaan muutamien satojen tai tuhansien ihmisten ravintona kala ja osterit olivat merkittäviä siksi että syntyi kokonainen rantojen keräämis- ja kalastamiskulttuuri. Tuollaisen ravinnon tiedetään myös olevan aivojen kehittymisen kannalta hyväksi.

On myös todennäköistä että aikansa ilmastossa rannikolla eläminen saattoi olla varmin tapa säilyä hengissä. Todennäköisesti populaatio myös jossain vaiheessa lisääntyi niin paljon että joukon oli pian pakko siirtyä muualle.

 

Historian merkittävin Exodus

 

Viime vuosien tutkimukset ovat osoittaneet että nykyihmisten määrä Afrikassa vajaat 100 000 vuotta sitten oli varsin vähäinen. Arviot liikkuvat 2000 ja 10 000 ihmisen välillä. Saattoi olla että ihmiskunnan tulevaisuus olisi ollut jopa vain noin 500 lisääntymiskykyisen naisen varassa. Elettiin ankaraa jääkautta, jonka huippukohta lienee ollut n. 80 000-85 000 vuotta sitten. Ei ollut mahdollisuutta siirtyä sisämaahan, koska alueet olivat pahasti aavikoituneita. Jo se että populaatio ylipäätänsä selvisi rannikolle oli jo osoitus evoluution etenemisestä. Nämä afrikkalaiset nykyihmiset olivat kykeneviä siirtymään pois kun elinmahdollisuudet heikkenivät. Rannikolla eläminen oli kuitenkin kalastuksen varassa. Entä jos saaliit vähenivät ihmisten määrän pysyessä ennallaan tai jopa kasvaessa? Tässä vaiheessa astui esiin ilmastonmuutoksen, tässä tapauksessa jääkauden mahdollistama avautunut ikkuna – merenpinnan huomattava lasku myös Punaisella merellä.

Runsaat 80 000 vuotta sitten laski Punaisen meren pinta ehkä jopa sadalla metrillä sen kapeimmassa kohdassa – Afrikan ja Jemenin rannikon välisessä salmessa. Monet myöhemmin paljastuvat arkeologiset löydöt sekä DNA-tutkimukset osoittavat että todennäköisin paikka jolloin ensimmäiset nykyihmiset siirtyivät Afrikan ulkopuolelle tapahtui juuri tässä ratkaisevan tärkeässä paikassa ja se tapahtui juuri siksi koska jääkausi aikaansai myös ilmiön ettei ihmiset muualta voineet edes päästä Afrikan ulkopuolelle. Sahara on vielä ankarammin autiomaa kuin tänään. Tie pohjoisen kautta Afrikan ulkopuolelle oli tukossa. Ainoaksi mahdollisuudeksi jäi kahlaaminen ja lautoilla siirtyminen vastarannalle nykyisen Jemenin alueelle.

Nykyisen tiedetään että diversiteetti Afrikkaan jääneiden ihmisten keskuudessa on huomattavan paljon suurempi kuin Afrikan ulkopuolella asuvien keskuudessa. Tämä ja useat muut tosiasiat kertovat saman viestin: se joukko joka todennäköisesti siirtyi Afrikan ulkopuolella oli lopultakin hyvin pieni. Tutkijoiden arvioit liikkuvat korkeintaan tuhannessa. Useimmat, kuten mm. Stephen Oppenheimer ovat päätyneet ehkä vain noin 250 ihmisen joukkoon. Tämä on uskottava arvio siksi koska afrikkalaiset eivät yleensä liikkuneet pienissä ryhmissä. Yli 200 ihmisen klaani koostui yleensä kymmenistä perheistä. Eikä tuona äärimmäisen ankarana aikakautena nykyihmisen kuoleminen sukupuuttoon ollut kaukana. Suurin osa nykyihmisistä jäi Afrikkaan (geneettisesti nimetty L1, L2, L4, L5 ja L6). Heitä asui hyvin pieninä erillisinä ryhminä maanosan keski-, etelä- ja länsiosissa. Heitä jäi myös itäosiin. Mutta osa jälkimmäisistä ylitti punaisen meren silloin kuin siihen vielä oli mahdollisuus. Ihmiskunnan historian merkittävin Exodus oli alkanut.

 

Pitkin rannikkoa kohti itää

 

Se mitä nyt tiedämme on hyvin hämärän peitossa. Ja syykin on selvä. Se rannikko jota myöten afrikkalaiset siirtyivät Jemeniin siitä pitkiin Arabian niemimaan etelärannikkoa, kauas, kaus kohti itää ei ole se missä tuon alueen rannikko tänään sijaitsee. He olivat rannikkojen keräilijöitä ja kalastajia. He olivat sen kulttuurin jälkeläisiä joka oli säilynyt hengissä läpi ankarat vuosituhannet pyydystämällä kaloja ja syömällä ostereita Afrikan itärannalla Punaisella merellä. On täysin selvää että tämä joukko – huomioiden sen että ympäröivä sisämaa ei kuivuuden takia tarjonnut parempaa mahdollisuutta – siirtyi silloin rannikkoa pitkin. Vauhti ei ollut edes kummoinen. 1-2 kilometriä vuodessa rannikkoa pitkin tarkoittaisi sitä että parissa tuhannessa vuodessa siirtyjien jälkeläisistä osa olisi jo Intian niemimaalla. 6 000 vuodessa oltaisiin siirrytty Arabian rannikolta aina Kaakkois-Aasiaan, Malesiaan, nykyisille Sumatran, Jaavan ja Borneon saarille asti. Voisiko todellakin olla mahdollista että esim 74 000 vuotta sitten näitä afrikkalaisten siirtolaisten jälkeläisiä olisi jo asunut Intiassa ja Kaakkois-Aasiassa?

Tutkimustulokset vahvistavat tämän. Arkeologiset kaivaukset paljastavat nykyihmisten työkaluja löytyneen kymmenistä eri paikoista. DNA-tutkimukset paljastavat myös sekä Intian että Kaakkois-Aasian alueella eristyksessä kauan eläneiden afrikkalaisia muistuttavien pienten ihmisryhmien olevan juuri tämän ensimmäisen muuttoaallon jälkeläisiä. Heidän sukupuunsa paljastuu L3N:ksi tai L3M:ksi. Heitä asui Arabian, Pakistanin, Intian, Bangladeshin, Malesian, Sumatran, Jaavan, Borneon ja muiden Kaakkois-Aasian saarilla. Tämä tukee teoriaa että oli olemassa vain yksi ”pois Afrikasta”-muuttoaalto joka jäi geneettisesti näkyviin aasialaisissa, eurooppalaisissa, australialaisissa sekä Amerikan ensimmäisissä ihmisissä. 

 

Toba-tulivuoren purkaus – 74 000 vuotta sitten

 

Varmin todiste siitä että afrikkalaisten jälkeläiset saapuivat viimeistään n. 74 000 vuotta sitten mm. Kaakkois-Aasian saarille oli Pohjois-Sumatran keskiosassa sijainneet Toba-tulivuoren purkaus. Tutkijoiden mukaan tämä maapallon historian hirvittävin tulivuorenpurkaus ainakin 2 miljoonaan vuoteen tapahtui tutkijoiden mukaan todennäköisemmin juuri 74 000 vuotta sitten.

Purkaus oli seuraamuksiltaan kaamea. Se synnytti mm. kymmeniä kilometrejä korkean tuhkapilven niin että laajat alueet aina Intiassa ja Pakistanissa peittyivät kymmeniä senttejä korkean tuhkan alle. Tuhka peitti kasvillisuuden, tuhosi sen. Arvion mukaan Toba-vuoren purkaus vaikkakaan ei synnyttänyt uutta jääkautta (eräiden tutkijoiden mukaan jääkausi oli jo alkanut hieman aiemmin) mutta se todennäköisesti hetkellisesti viilensi entisestään ilmaa. Se aikaansai laajan ekologisen tuhon ja vähensi radikaalista tuhoalueelta hyvinkin kaukana asuvien ihmisten määrää aikana jolloin nykyihmisten lukumäärä oli muutenkin hyvin alhainen. 

Toba-tulivuoren purkauksen seurauksena maapallolla vallitsi tuhansia vuosia tilanne jossa nykyihmiset asuivat kahdessa osassa maapalloa erillään toisistaan: Afrikassa ja Arabian etelärannikolla sekä Kaakkois-Aasiassa pieninä erillisinä ryhminä saarilla sekä Kiinan kaakkoisrannikolla. Intiassa, Pakistanissa sekä Malesiassa asutus näytti joko tuhoutuneet täysin ja jäljelle jäi hyvin vähäisiä pieniä yhdyskuntia. Vasta tuhansia vuosia myöhemmin mm. Malesia ja Intian niemimaa asutettiin jälleen uudelleen. Tällä kertaa todennäköisemmin idän suunnasta ”paluumuuttona”. Intian niemimaalle muodostui jälleen asutusta jolla on hyvin suuri merkitys Aasian ja Euroopan myöhemmälle asuttamiselle.

 

Ilmaston viileneminen – ikkuna Australiaan

 

Kuten aiemmin Afrikassa, myös Kaakkois-Aasiassa ilmaston voimakas kylmeneminen aikaansai tutun jääkauden seurauksen. Vettä sitoutui entistä enemmän jäätiköihin jolloin merenpinta laski. Tämä mahdollisti sen että muutenkin evoluution kautta merelliseen ympäristöön sopeutunut uusi väestön kykeni helpommin siirtymään saariryhmiltä toisille. Tämä ilmiön seuraus oli lopulta se, että väestöä siirtyi Timorin saaren kautta jopa Australiaan asti. Tämä tapahtui todennäköisemmin n. 65 000 vuotta sitten. Aiemmin se ei voinut tapahtua eikä esim. 50 000 vuotta sitten sillä silloin merimatka olisi muodostunut liian pitkäksi eikä esihistoriallisella ajalla tunneta tapausta jolloin olisi siirrytty yli 200 km:n matkoja meritse. Kuten aina esihistoriallisena aikana vesitse tehtävät siirtymiset tehdään silloin kun jääkauden ote on kireimmillään ja merenpinta matalimmillaan. Australiaan siirtyminen tapahtui todennäköisemmin siis n. 65 000 vuotta sitten. Arkeologiset löydöt vahvistavat tämän skenaarion. Australian alkuperäiskansat kuuluvat samaan DNA-haaraan kuin Kaakkois-Aasian alkuperäiskansat. He ovat L3M/L3N:n eli Afrikan itärannikolla asuneen ”toisen Eevan” jälkeläisiä.

 

Miksi ei heti Eurooppaan?

 

DNA-tutkijoiden ja nykyihmisen alkuperää tutkivien ihmisten suurin mysteeri on ollut kautta aikojen se, miksi modernin ihmisen (Homo Sapiens Sapiens) ensimmäiset Afrikan ulkopuolella tehdyt havainnot liittyvät varmuudella Intian valtameren rannikkoseutuihin, kuten Intiaan, Malesiaan, Jaavaan tai jopa Australiaan eikä Eurooppaan. Miten voi olla mahdollista että nykyihminen ei siirtynyt suoraan Eurooppaan kun tie olisi ollut sinne suorin ja lyhyin? Jotkut tutkijat ovat viime vuosiin asti uskoneet että nykyihmiset olisivat kuitenkin siirtyneet ehkä Lähi-Idän kautta Eurooppaan. Mutta näin ei ole tapahtunut. DNA-tutkimukset osoittavat että Eurooppaan tultiin aivan toista reittiä ja aivan eri ajankohtana. Kuten aiemmin mainittiin oli nykyihmiset saapuneet mm. Palestiinan alueelle ja jopa Levantiin aiemmin kuin vaikkapa Kaakkois-Aasiaan. Mutta he eivät koskaan selvinneet pitemmälle. Ja syy oli selvä – ankara ilmasto, kuivuus, mahdottomuus pysyä hengissä esti Eurooppaan tulon.

Sitten tapahtui ilmastollinen käänne. Noin 52 000 vuotta sitten alkoi aikakausi jolloin ilmasto eteenkin Intian niemimaalla, Pakistanissa, nykyisessä Iranissa sekä Persianlahdella muuttui nykyihmisille edullisemmaksi. Sateet tekivät entisistä autiomaista vehreitä ja uomat täyttyivät vedestä. Monsuuni Intiassa oli voimakkaampi kuin nykyään. Tämä avasi vihdoin ja viimein Intian niemimaalla asuvien nykyihmisten tien kohti luodetta, kohti nykyistä Kaukasusta, Turkkia - Eurooppaa.

Eurooppaan ensimmäisenä saapuneet ihmiset eivät siis suinkaan olleet Lähi-Idän asukkaita vaan tarkalleen määriteltynä Pakistanin niemimaan asukkaiden jälkeläisiä. DNA-tulokset osoittavat tämän. Sama geenikartta on havaittavissa mm. Espanjan baskialueilla tai Balkanilla asujaimistossa kuin Intian niemimaalla. Eurooppaa asutettiin myöhemmin myös toisestakin suunnasta mutta ensimmäisten eurooppalaisten geenikartta viittaa selkeästä Pakistanin suuntaan.

Toinen Eurooppaan suuntautunut muuttoaalto tapahtui hieman toista kautta. Muuttovirta kulki Indus-joelta Intiasta kohti Kashmiria ja sieltä Keski-Aasian alueelle. Tästä tuloalueelta siirtyi n. 40 000 vuotta sitten metsästäjiä Eurooppaan. Mutta tässäkin tapauksessa Euroopan pohjoisosat jäi asuttamatta sillä ilmasto kylmeni n. 45 000 vuotta sitten. Jääkautta kestikin sitten joitakin suhteellisia lämpöjaksoja lukuun ottamatta peräti yli 30 000 vuotta. Vain etupäässä maanosan eteläpuolisko asutettiin.

Ja jotta Euroopan nykyinen väestö tietäisi juurensa vielä selkeämmin on geneettisestä taustasta havaittavissa sekin mitä kaikkien muuttoaaltojen kokonaissaldo kertoo: 80% muuttajista oli metsästäjä-keräilijä kulttuurin ihmisiä ja viljelykulttuurista tulleet (kaikkein myöhäisemmät tulijat) muodostavat tuskin viidettä osaa. Geneettisesti Eurooppa on intialais-pakistanilainen DNA-sukupuun haara. 

Stephen Oppenheimer:

 

Europa was genetic daughter of R ('Rohani'), who was genetic daughter of Nasreen, who was the genetic daughter of the out-of-Africa L3. By what route, however, did the Europa maternal clan arrive in the Levant, and where was her daughter U5, who colonized Europe, born? Both the N ('Nasreen') and Rohani root types are unknown except in South Asia, where Nasreen root types are found at low rates and Rohani is found in great variety. Most Rohani types in India are found nowhere else, and the great diversity of Rohani in India allows us to estimate when her line began to expand. This was at least 55,000 years ago, thus predating the arrival of Rohani's daughter Europa in the Levant and making a strong case for South Asia as the ultimate ancestral home of European lines. Even this expansion date is likely to be an underestimate of the age of the Rohani clan. Rohani may well be older than 55,000 years in Asia: much older estimates of the ages of two Asian subgroups of Rohani have been obtained in China.

 

Aasian ja Amerikan mantereet

 

Samoin kuin eurooppalaiset myös Aasian sisäalueiden asuttaminen lähti liikkeellä Pakistanin ja nykyisen Iranin alueilta. Liikkuminen noudatti vanhaa sääntöä: pysy vesistöjen lähellä, todennäköisten sadealueiden tuntumasta, vältä aavikkoja ja kuivia paikkoja, seuraa jokia ja pidä mielessä pelin säännöt. Vesistöä seuraamalla ja sieltä ravinnon ottamalla afrikkalaisten jälkeläiset siirtyivät tuhansia kilometrejä aina Kaakkois-Aasiaan, Kiinan rannikolle ja Australiaan asti. Samalla periaatteella asutettiin Aasian sisäosat n. 40 000-45 000 vuotta sitten.

Keskiajalla tutkimusmatkailija Marco Polo havaitsi pian sen millaiset esteet siirtymisellä Aasiassa oli olemassa. Siirtyminen Euroopasta Aasiaan kulki myöhemmin Silkkitienä tunnetun reitin kautta. Vastaavasti idästä länteen siirryttiin samaa reittiä. Burmasta kulki reitit Tiibetiin. Pohjoisin reitti tunnetaan Venäjällä Altain-väylänä. Siperian asuttaminen tapahtui väestöllä joka kuten Euroopankin oli metsästäjä-keräilijöitä. He eivät kromosomirakenteen perusteella kovinkaan paljon sitten eronneetkaan eurooppalaisista. Itse asiassa mammutinmetsästyskulttuuri alkoikin kukoistaa ensimmäisenä juuri kaukana Keski- ja Itä-Euroopassa, ei suinkaan Siperiassa. Aasian pohjoisempien osien asuttaminen tapahtui 25 000-30 000 vuotta sitten.

Evoluutiokehitys ja sopeutumien uusille alueille oli johtanut tilanteeseen jossa ihminen alkoi kyetä (tietyin reunaehdoin) liikkumaan hyvinkin kylmillä alueilla. Ja juuri tästä väestöstä polveutui ne jotka asuttivat myöhemmin viimeisen tyhjillään nykyihmisistä olevan mantereen – Amerikan. Ensimmäisessä vaiheessa asutettiin Alaskaa n. 22 000 -25 000 vuotta sitten. Koostuiko tämä joukko Aasian pohjoisosien monikielisistä, monimuotoisista, monivärisistä ryhmistä jotka sekoittuivat keskenään? Tuskinpa vain.

Beringin alueella ollut ryhmät olivat toisistaan erillään. Todellisuudessa näet Amerikan alkuperäiskansat ovat geneettisesti hyvin monimuotoista joukkoa. Tulivat samansuuntaista reittiä mutta lähtöalueet olivat täysin eri puolilta Aasiaa. Ainakin ryhmät A, B, C, D ja X on havaittu DNA-tutkimuksissa. Erilleen toisistaan nämä ryhmät myöhemmin asettuivatkin uudella mantereella asumaan. Viimeisimmän jääkauden ankarin vaihe ajoittui 18 000- 22 000 vuotta sitten. Amerikan alkuperäiset asukkaat asuivat kaukana toisistaan Alaskassa rannikolla, kolmas havaittu seutu on ollut USA:n Suurten Järvien pohjoispuolella. Missään muualla ei ollut asutusta. Mantereen eteläosien asuttaminen alkoi n. 15 000 vuotta sitten.

 

Euroopan pohjoinen puolisko – viimeinen periferia

 

Maapallon viimeiset tutkimattomat laajat alueet nykyihmisille löytyivätkin sitten jääkauden päätyttyä Euroopan pohjoisosista. Noin 30 000 vuotta sitten oli maanosassamme aiemmin asunut neandertalilainen ihminen kuollut sukupuuttoon, koska ei kyennyt kilpailemaan hitaana, huonona juoksijana nykyihmisille. Ne eivät osanneet metsästää aukeilla ja kun jääkausi vähensi metsien määrää Euroopassa joutuivat ne yhä enemmän eristyksiin syrjäisille alueille tuhoisin seurauksin. Niiden kommunikointi ja ryhmässä toimiminen ei ollut kehittynyttä. On kuvaavaa kuinka tämä Eurooppaa asuttanut ihmislaji oli perin vähän kyennyt kehittymään satojen tuhansien vuosien aikana verrattuna Afrikassa kehittyneeseen nykyihmiseen. Afrikka oli siis ihmisen evoluutiokehityksen kärjessä kun taas Eurooppaa asutti katoava ihmislaji. Maanosan pohjoisin osa olikin sitten se viimeinen periferia jonka ihminen asutti. Tämä tapahtui n. 8 000 -10 000 vuotta sitten.

 

Miksi olemme kaikki ”afrikkalaisia” vaikka näytämme niin erilaisilta?

 

Ihon epidermiksen melanosyytit tuottavat pigmenttijyväsiä, melanosomeja, joiden sisältämä melaniini erittyy keratinosyytteihin. Melanosyyttien määrä eriväristen ihmisten välillä on miltei vakio, mutta vaaleaihoisilla melanosomit ovat keskittyneet tyvikerrokseen, kun taas tummaihoisilla niitä löytyy kaikista epidermiksen kerroksista. Lisäksi vaaleaihoisilla melaniini hajoaa nopeammin lysosomaalisen toiminnan johdosta.

Nykyihminen (Homo sapiens) kehittyi trooppisessa Afrikassa mustaihoisena. Evoluutio on tuottanut vuosituhansien kuluessa vaaleamman ihonvärin, sopeuman oloihin, joissa auringon UV-säteilyä on vähemmän. Vaalea ihonväri on kehittynyt ihmisille vasta heidän vaellettuaan Afrikasta viileämmän ilmaston vyöhykkeille. Toisaalta geenipoolissa on säilynyt mahdollisuus ihonvärin tummentumiselle, kun ihmiset ovat vaeltaneet Beringinsalmen kautta Etelä-Amerikkaan takaisin päiväntasaajalle. Yleisesti ottaen päiväntasaajalta poispäin mentäessä auringonsäteilyn määrä vähenee ja ihmisten ihonväri vaalenee. Ihonväri on kehittynyt suojaamaan Auringon haitalliselta UV-säteilyltä ja foolihapon hajoamiselta, mutta silti sallimaan D-vitamiinin muodostumisen iholla auringonvalon vaikutuksesta. Vaaleaihoiselle ihmisille ihosyöpävaara on korkeampi päiväntasaajan seudulla, kun taas tummaihoinen voi kärsiä pohjoisen pimeydessä D-vitamiinin puutoksesta. Keskimäärin naisilla on hieman vaaleampi iho kuin miehillä, mikä voi johtua suuremmasta kalsiumin tarpeesta raskauden ja imettämisen aikana. Melaniini on ihon väriaine.

Ihonväri on myös yksi silmiinpistävimmistä ihmisen ominaisuuksista. Aiemmin ihmisiä on eroteltu ihonvärin perusteella eri rotuihin.

Tohtori Nina Jablonski on suorittanut vuosikymmenien aikana uraauurtavaa työtä ihonvärin evoluution tutkimisessa. Hän on päätynyt arvioon jonka mukaan tummaihoisen ihmisen ihonväri muuttuisi vaaleaksi muuttuneissa olosuhteissa 15 000 – 20 000 vuoden aikana. Evoluutio, siihen liittyvät monet valinnat (mm. seksuaalinen), monenlaiset ilmastolliset olosuhteet, ravinto, mutaatiot ym vaikuttavat myös ihonvärin sävyn ohella kasvonpiirteisiin. Tämä näkyy paitsi maapallolla eri puolin päiväntasaajaa myös esim. Afrikan sisällä.

Erittäin todennäköisesti eurooppalaisten ja itäaasialaisten vaaleaihoisuus on kehittynyt toisistaan riippumatta erilaisin geneettisin mekanismein. Vaaleaihoisuus johtuu muutamista geeneistä (mm. ASIP, MATP, TYR, OCA2 ja MC1R). Erityisesti geeni SLC24A5 säätelee eurooppalaisilla tumman melaniinin määrää ihossa. SLC24A5-geenistä on kuitenkin vaaleilla itäaasialaisilla ja tummilla afrikkalaisilla sama versio, joten se ei yksinään voi selittää kaikkea ihmiskunnassa esiintyvää vaaleaihoisuutta.

Eurooppalaiset ihmiset ovat maapallolla vaaleaihoisimpia. Mutaationopeuden arvioinnin perusteella eurooppalaisten SLC24A5-geeniversio on syntynyt todennäköisimmin 5 300–6 000 vuotta sitten ja aikaisintaan 12 000 vuotta sitten. Vaaleaihoisuudesta tuli etu maanviljelyn levitessä Lähi-idästä Eurooppaan. D-vitamiinia on eläintuotteissa, erityisesti kaloissa, maksassa, munissa ja maidoissa, mutta viljalla ja juureksilla elävän ihmisen täytyy valmistaa D-vitamiininsa itse ihossaan. Metsästyksestä siirtyminen maanviljelyyn vähensi eurooppalaisten D-vitamiinin saantia ravinnosta ja auringonsäteilyn aiheuttama D-vitamiinin tuotanto ihossa tuli entistä tärkeämmäksi.

 

Rotuteorian loppu

 

Ei ole koskaan ollut mitään "keltaista" tai "valkeaa" rotua. Rotu ei perustu biologiaan vaan ideologiaan ja kulttuuriseen jaotteluun. Tieteellisesti on osoitettu jo niin vakuuttavasti että kaikki Afrikan ulkopuolella asuvat ihmiset ovat yhden ainoan Afrikassa kerran asuneen "kantaäidin" jälkeläisiä että vanhoja rotuteorioita on turha enää ylläpitää 21. vuosisadan maailmassa. Se että olemme kaikki suorastaan ällistyttävän samanlaisia geneettisesti vaikka näytämme usein niin erillaisilta on afrikkalaisen exoduksen ja evoluution tulos. Kun katsomme itseämme peilistä voimme lukea samalla tämän ihmiskunnan huikeimman kansainvaelluksen ja luonnonvalinnan omista kasvoistamme.

 


( Päivitetty: 24.11.2012 10:39 )

 - pelontorjunta | Kommentoi